Searching for pathogenic fungi of Passiflora foetida sensu lato in Colombia, South America, with potential for classical biological control in Australia

ABSTRACT

Interest in plant pathogens for classical biological control (CBC) of invasive introduced plants has increased steadily since the 1970s. The introduced plant Passiflora foetida sensu lato invades large tracts of land across northern Australia and CBC represents a possible solution to reduce its abundance and spread. Field surveys for foliar fungal pathogens of P. foetida s.l. were performed between 2017 and 2020 in Colombia. Molecular sequencing was used to confirm the identity of plants surveyed at each site and to explore genetic variation between sites. Leaf spots of various sizes and sometime associated with chlorosis as well as necrosis of leaf edges were the main disease symptoms observed. These symptoms were not severe and did not appear to affect plant growth. No disease symptoms caused by obligate biotrophic fungi nor girdling lesions on stems were observed. Of the 125 fungal isolates recovered from the collected diseased material, only 21 were considered as pathogenic on P. foetida s.l. in detached-leaf assays. Morphological examinations and sequencing of the 21 pathogenic isolates revealed that they belong to 11 genera. Based on the low severity of disease symptoms observed in the field, we conclude that these isolates do not warrant further investigations as potential CBC agents.

KEYWORDS:

• Invasive plant
• weed biocontrol
• centre of origin
• natural enemy surveys
• plant pathogens

Introduction

The search for co-evolved, specialist natural enemies of an invasive weed in its centre of origin is a key component in the initiation of a classical biological control (CBC) programme (Goolsby et al., 2006). For years, arthropod natural enemies were the primary focus of field surveys and investigations in weed CBC (Schwarzländer et al., 2018). Interest in plant pathogens, however, steadily increased from the 1970s following the successful biological control of the narrow-leaf form of skeleton weed (Chondrilla juncea L.) with an introduced rust fungus (Puccinia chondrillina Bubák & Syd.) in Australia (Cullen et al., 1973). By 2020, a total of 36 foliar fungal pathogens had been intentionally introduced to new regions worldwide for weed CBC (Morin, 2020). Three additional fungi have since been introduced, all in Australia: Venturia paralias G.C. Hunter, I. Zeil-Rolfe, M. Jourdan & L. Morin sp. nov. on sea spurge (Euphorbia paralias L.) (Hunter al., 2021), Puccinia rapipes Berndt & E. Uhlmann on African boxthorn (Lycium ferocissimum Miers.) (Department of Agriculture, Fisheries and Forestry, 2021b; Ireland et al., 2019; B. Gooden, pers. comm.) and Puccinia cnici-oleracei Pers. (ex. Conyza) on flaxleaf fleabane (Conyza bonariensis (L.) Cronquist) (Department of Agriculture, Fisheries and Forestry, 2021a; B. Gooden, pers. comm.). More than 70 percent of all these intentionally introduced fungi are obligate biotrophs, requiring living plant tissue to survive and complete their life cycle. Bacteria, viruses, and soil-borne root infecting fungi have not been considered in weed CBC (Morin et al., 2006). This is because they are more likely to require a vector for long-distance dispersal, to have a broad host range, and/or to change their host range over time (Eigenbrode et al., 2018; Morris & Moury, 2019).

The introduced plant Passiflora foetida L. sensu lato (Passifloraceae; commonly referred to as stinking passionflower in Australia) invades large tracts of land across northern Australia, from Shark Bay in Western Australia to the north coast of New South Wales (Ohlsen, 2020). It is a fast-growing biennial, herbaceous, climbing, or scrambling vine that smothers low vegetation and small trees and produces fruits that are consumed primarily by birds, enabling long-distance dispersal of seed (Lohr et al., 2016; Preece et al., 2010).

Passiflora foetida s.l. is a highly variable species, likely representing a complex of species, that belongs to section Dysosmia of subgenus Passiflora of the family Passifloraceae (Svoboda & Ballard, 2018; Vanderplank, 2013). Delineation between taxa within Dysosmia based on morphology has been controversial for years and therefore comprehensive molecular phylogenetic analyses and chromosome counts are required to characterise the P. foetida s.l. complex in Australia and elsewhere (Ohlsen, 2020).

In Australia, P. foetida s.l. grows mostly on coastal dunes, creek banks and in gorges (Ohlsen, 2020). It adversely affects native flora and fauna by altering habitat structure and poses a substantial fire risk due to large above-ground biomass accumulation (Lohr et al., 2016; Somaweera et al., 2019; Jucker et al., 2020). Small infestations in areas of high biodiversity, cultural and recreational value can be controlled by combining manual removal of above-ground biomass with applications of glyphosate (Jucker et al., 2020). These control approaches, however, are unsuitable for large infestations because of prohibitive costs and for infestations in remote areas because of inaccessibility. The large-scale application of glyphosate can also have negative effects on non-target native plants. The introduction of one or more effective, host-specific biological control agents sourced from the native range of P. foetida s.l. represents a possible solution to reduce the abundance and spread of this invader at a landscape scale across northern Australia.

The native range of P. foetida s.l. is reported to include southern USA, Mexico, the Caribbean, Central America, and South America (CABI, 2024). Such an extensive range is probably due to the historical widespread dispersal of the plant by indigenous people who incorporated its fruits into their diet soon after their arrival (Vanderplank, 2013). Hopley et al. (2021) used whole chloroplast sequencing to elucidate the introduction history of P. foetida s.l. in Australia. Their study revealed the presence of three phylogenetically distinct P. foetida s.l. lineages in Australia, each with affinities to samples from different areas in the native range, suggesting multiple introductions. In one lineage, samples from across northern Australia clustered with samples from Ecuador and Peru (Hopley et al., 2021). The other two lineages comprised Australian samples from Queensland and New South Wales, that clustered with samples from Brazil and Colombia, and from the Caribbean, respectively. Colombia is ranked as the country with the highest richness of Passifloracea, and with Ecuador, constitute the centre of diversity of the genus Passiflora (Ocampo Pérez et al., 2007).

In this paper, we report on results from field surveys and laboratory studies conducted in Colombia to identify fungal pathogens with potential for CBC of P. foetida s.l. in Australia. To ascertain the identity of putative P. foetida s.l. plants surveyed as well as explore genetic variation between sites, a representative individual from each site was sampled and two regions of the nuclear genome were sequenced. The research focused on answering the following questions: (i) Do any disease symptoms typically attributed to fungi occur in P. foetida s.l. in Colombia?, (ii) if so, do fungi isolated from these disease symptoms infect P. foetida s.l. under laboratory conditions?, and (iii) if so, what is the identity of the pathogenic fungi isolated and do they have prospects for CBC of P. foetida s.l. in Australia?

Materials and methods

Records of P. foetida s.l. in Colombia

Records of occurrence of P. foetida s.l. in Colombia were obtained from the Global Biodiversity Information System (GBIF) (GBIF.org, 2023). A distribution map of P. foetida s.l. in Colombia, including elevation in metres above sea level (masl) obtained from WorldClim (Fick & Hijmans, 2017), was created using the software R (R Core Team, 2022) through the biomod2 package (Thuiller et al., 2023).

Field sampling and plant propagation

Field trips to collect diseased material of putative P. foetida s.l. were performed between 2017 and 2020. Because of resource constraints and to increase likelihoods of finding the target plant, areas surveyed were within regions with the highest number of P. foetida s.l. records according to GBIF (GBIF.org, 2023). At each site, three to five whole plants of Passiflora sp. with pubescent leaves (one of the morphological characteristics of P. foetida s.l.) were dug out and immediately planted into potting mix contained in plastic bags. Pieces of healthy leaves of putative P. foetida s.l. plants from each site as well as other Passiflora species with glabrous leaves found during surveys were collected and placed in vials containing silica gel beads. When available, seeds from those plants were collected, placed in paper envelops and kept dry until further use.

Foliage and fruits of putative P. foetida s.l. exhibiting signs of possible fungal infection were collected, placed between paper towels or in paper bags and transported within a Styrofoam cooler for subsequent processing in the laboratory.

Field-collected whole plants were grown in a net house at the Universidad Nacional de Colombia branch Medellín and regularly fertilised with a complete nitrogen-phosphorus-potassium fertiliser. Collected seeds were sown in potting mix contained in trays under the same conditions. Seedlings that emerged were transplanted in potting mix contained in plastic bags and grown in the net house. The following cultivated Passiflora species were acquired from nurseries and grown in the net house to provide material for sequence comparison: Passiflora edulis Sims. f. edulis (gulupa), Passiflora edulis f. flavicarpa Degener (maracuyá, passionfruit), Passiflora ligularis Juss. (granadilla, sweet passionfruit), Passiflora quadrangularis L. (badea), and Passiflora tripartita var. mollissima (Kunth) Holm-Niesen & & Jørgensen (curuba).

Molecular sequencing of plant samples

DNA from dried leaves of field-collected putative P. foetida s.l. plants (with pubescent leaves) and other Passiflora species with glabrous leaves, as well as fresh leaves of the other Passiflora species acquired in nurseries was extracted using the modified CTAB2X method (Doyle & Doyle, 1990). Leaves were macerated with liquid nitrogen and approximately 100 mg of the macerate was mixed with 700 µL of CTAB buffer (100 mM Tris-HCl (pH 8.0), 1.4 M NaCl, 20 mM ethylenediaminetetraacetic acid (EDTA) and CTAB 2%) plus β-mercaptoethanol. The solution was incubated at 65°C for 45 min. Chloroform-isoamyl alcohol (24:1 v/v) was added to the solution, before it was centrifuged at 12,000 rpm for 20 min. The aqueous supernatant was recovered, and a second wash was performed by adding chloroform (24:1 v/v) and centrifuging at 12,000 rpm for 10 min. The aqueous phase was recovered and the nucleic acids were precipitated with one volume of isopropanol for 1 h at −20°C. The sample was centrifuged at 12,000 rpm for 15 min, before the supernatant was carefully removed and the pellet washed twice with 70% and 90% Ethanol. Finally, the pellet was allowed to dry and then resuspended in 50 µl of the TE buffer solution (10 mM Tris – HCl, 1 mM EDTA; pH 8.0). The DNA obtained was treated with RNAsa for 1 h at 37°C. DNA integrity, quality and quantity were determined by separation on agarose (1.5%) gel electrophoresis in TBE (tris-borate-EDTA) buffer and spectrophotometry (Thermo Scientific^TM NanoDrop 2000^TM, Thermo Fisher Scientific). DNA was used for amplification of the internal transcribed spacer between the 16S and 23S rRNA gene loci (ITS) using primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') (White et al., 1990), and the nuclear-encoded glutamine synthetase gene (ncpGS) using primers GScp839f (5'-CACCAATGGGGAGGTTATGC-3') and GScp1056r (5'-CATCTTCCCTCATGCTCT TTGT-3’) (Yockteng & Nadot, 2004).

Polymerase chain amplification reactions (PCR) containing Taq buffer 1X, MgCl₂ 1.5 mM, dNTPs 250 µm, primers 0.2 µM, Taq DNA polymerase 0.06 U/ µl (Thermo Fisher Scientific), DNA 2 ng/ µl and molecular biology grade water to complete a final volume of 25 µL, were performed. ITS region was amplified using a thermal cycler with a programme of one initial denaturation cycle at 95°C for 3 min followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s and extension at 72°C for 1 min. After the 35th cycle finished a final extension at 72°C for 10 min was performed. Glutamine synthase region was amplified using a thermal cycler with a programme of one initial denaturation cycle at 95°C for 3 min followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 58.7°C for 45 s and extension at 72°C for 1.5 min. A final extension at 72°C for 10 min was also performed for this region after the 35th cycle finished. Five µL of each PCR reaction were mixed with one µL of DNA Gel Loading Dye (6X) (Thermo Fisher Scientific) for loading in the gel wells. A 1 kb Generuler ladder was used as molecular marker (Thermo Fisher Scientific). PCR products of three to four reactions of the same sample showing a single and clear band in the agarose gel electrophoresis were purified using QIAquick® (Qiagen) or GeneJET (Thermo Fisher Scientific) purification kits following the manufacturer’s instructions. Integrity of purified products were verified by agarose (1.5%) gel electrophoresis as described. Purified PCR products were sent to a third party for sequencing by the Sanger method following the company’s guidelines (Macrogen, Republic of Korea).

Sequences were cleaned and edited using the tool Trim ends with high sensitivity and an error probability limit of 5%, implemented in the computational package Geneious R9 version 9.0.5. Other sequences of Passiflora species were retrieved from GenBank and aligned with sequences obtained using the algorithm ClustalW implemented in the software MegaX version 10.0.5 (Kumar et al., 2018). Best model was selected using the lower value of Bayesian information criteria (BIC). Phylogenetic trees were built using the maximum likelihood method and Tamura-Nei model (Tamura & Nei, 1993) for ITS sequences and Tamura 3-parameter (Tamura, 1992) for ncpGS. Initial tree(s) for heuristic search were obtained automatically by applying algorithms Neighbor-Join and BioNJ to a matrix of pairwise distances estimated by the Maximum Composite Likelihood (MCL) approach, then the topology with superior log likelihood value was selected. Discrete Gamma distribution was used for modelling differences in the evolutionary substitution rates among sites. Sequences of Adenia gummifera (Harv.) Harms were used as outgroup. Phylogenetic trees were edited with INKSCAPE 0.92 software.

Fungal isolation from disease symptoms and pathogenicity tests

Whenever present, fungal structures were scraped from collected diseased material and placed on the surface of potato dextrose agar (PDA; 39 g PDA (Merck) and water to 1L) culture medium contained in Petri dishes. In addition, small pieces of diseased tissue (∼ 5 mm × 5 mm) were surface sterilised by immersing in 70% Ethanol for 30 s, followed by rinsing with sterile distilled water (SDW), immersing in 1% sodium hypochlorite for 5 min and rinsing twice with SDW. Surface sterilised pieces were dried on sterile paper towels before placing onto PDA in Petri dishes within a sterile laminar flow cabinet. Plates were incubated on the laboratory bench (approx. 25−30°C and 12-hour photoperiod) until fungal colonies began to grow. A small piece of agar with mycelium was cut from the edge of each colony and transferred to a fresh PDA plate incubated as above. A further purification of each isolate was performed by transferring a hyphae tip onto another fresh PDA plate and incubating as above. Purified isolates were transferred to fresh PDA plates each month and colonised plates were stored at 4°C. For long-term storage of isolates, agar disks with mycelia cut from the colonies with a sterile metal punch (∼5 mm diameter) were placed in glycerol or SDW contained in cryovials and stored at −20°C and 4°C, respectively.

Pathogenicity tests were performed by inoculating each fungal isolate on three detached fresh leaves obtained from whole plants of each of two different accessions of P. foetida s.l. (after identification was confirmed by sequencing) growing in the net house, for a total of six detached leaves per isolate. The plant accessions used were from the same and/or nearby municipalities from where the isolate was recovered from. Each isolate was grown in a PDA plate for 15 days under conditions as described above. Inoculum was prepared by adding 10 ml of SDW to the plate and scraping the surface of the colony to obtain a suspension of conidia and/or mycelial fragments. Detached leaves were gently washed with neutral soap and tap water, rinsed with tap water, and placed, adaxial surface facing upward, in a humid chamber. Each humid chamber consisted of a clear plastic box (∼ 35 cm × 25 cm × 8.5 cm) filled with approximately 1-cm deep of distilled water, and containing Petri dishes at the bottom covered with a plastic mesh onto which inoculated leaves were placed. Three drops of inoculum (5 µL each) were placed on half of each leaf and three drops of SDW were placed on the other half as control. All six detached leaves inoculated with an isolate were placed in the same humid chamber, which was placed on the laboratory bench (same conditions as above). Inoculated leaves were monitored daily for disease symptoms until 20 days after inoculation (dai). Where lesions developed on more than three of the six leaves inoculated with an isolate, one leaf with lesions was processed as described above to isolate the causal agent. The morphology of the recovered isolate was then compared with that of the original isolate used for inoculation to determine if the Koch’s postulates were fulfilled (Agrios, 1997). Only isolates for which the Koch’s postulates were fulfilled were considered pathogenic and further investigated.

Identification of pathogenic isolates

Morphological and molecular characterisation of the isolates found to be pathogenic on P. foetida s.l. in detached-leaf assays was used for their identification. All isolates were grown on PDA plates and incubated on the laboratory bench (same conditions as above). Unless indicated otherwise, the colony growth diameter (mm) was measured at 9 days after seeding the medium and various characteristics recorded: texture (powdery, cottony, plush), shape (circular, irregular, rhizoid), margin (lobate, rhizoid, entire), elevation, and presence of sectors. Mycelium and conidia (if present) were placed on a microscope glass slide with a drop of lacto-glycerol solution (1:1), covered with a coverslip and examined using a light microscope with a mounted digital camera (Carl Zeiss). Hyphae characteristics such as septa presence or absence, and length, width, shape, and colour of 15 conidia were recorded.

Unless otherwise indicated, the pathogenic isolates were also grown on five additional different culture media with the potential to induce sporulation: (1) V8-PDA (15 g agar, 10 g PDA, 150 ml V8 juice, 3 g CaCO₃, and water to 1 L) (Jacques et al., 2021); (2) 1/10 PDA (15 g agar and potato broth to 1 L (broth obtained by boiling 20 g potato in 1L water and filtering)) (Su et al., 2012); (3) Water agar + CaCO₃ (15 g agar, 3 g CaCO₃ and water to 1 L) (modified from Shahin & Shepard (1979)); (4) Pine broth (25 g of fresh pine needles and 20 g of potatoes boiled in 1 L of water for 10 min before filtering, 20 g of agar and water to 1 L) (modified from Su et al. (2012)); (5) and (6) PDA + pine needles (39 g PDA and water to 1 L with sterile pine needles placed in a triangle configuration on the solidified medium).

Ten ml of SDW was added to a 15-day-old colony of each isolate in a PDA plate (incubation conditions as above) and mycelium was scrapped from the colony surface to obtain a suspension. DNA was extracted from the mycelium using the CTAB2X method (Doyle & Doyle, 1990) and quantified and visualised as described before. DNA was used for PCR-amplification of the ITS using primers ITS1 and ITS4 following the method described above for plant material (White et al., 1990). Additional sequences were also obtained for some isolates: β-tubulin gene sequence (β-Tub2) was PCR-amplified using primers Bt-2a (5' – GGTAACCAAATCGGTGCTGCTTTC – 3') and Bt-2b (5' – ACCCTCAGTGTAGTGACCCTTGGC – 3') (Glass & Donaldson, 1995), and the translation elongation factor gene 1-alpha (TEF1α) was PCR-amplified with primers EF1-728F (5' – CATCGAGAAGTTCGAGAAGG – 3’) and EF1-986R (5' – TACTTGAAGGAACCCTTACC – 3') (Carbone & Kohn, 1999). PCR conditions for primers Bt-2a and Bt-2b were: one initial denaturation cycle at 95°C for 3 min followed by 35 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 50 s and extension at 72°C for 1 min. After the 35 cycles finished a final extension at 72°C for 10 min was performed. PCR conditions for primers EF1-728F and EF1-986R were: one initial denaturation cycle at 95°C for 3 min followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 59°C for 30 s and extension at 72°C for 1 min. After the 35 cycles finished a final extension at 72°C for 10 min was performed. PCR product purification, sequencing, sequence cleaning, editing and phylogenetic analyses were performed as described in the plant molecular sequencing section above.

Results

Records of P. foetida s.l. in Colombia

According to GBIF, there were 422 records of P. foetida s.l. in Colombia in 2022 (GBIF.org, 2023) (Figure 1(A)). Passiflora foetida s.l. has been recorded at altitudes from sea level to above 1500 masl, with the highest number of records located in the Andean, Caribbean, and Pacific regions of Colombia.

Figure 1. A. Records of Passiflora foetida s.l. in Colombia (black cross) from the Global Biodiversity Information System (GBIF.org, 2023) superimposed on elevation in metres above the sea level. B. Location of sites sampled (black dots) as part of this study (note that some of the sites were in proximity of each other and therefore dots cannot be differentiated in a national scale map) (Supplementary Table 1).

Field sampling

Putative P. foetida s.l. plants were sampled at 47 sites in a range of habitats including, sandy coastal land, road borders, crop fields, riverbanks, and mangroves, across six departments of Colombia: Antioquia, Bolívar, Córdoba, Magdalena, Santander, and Sucre (Figure 1(B), Appendix A: Supplementary Figure 1, Supplementary Table 1). These sites were at elevations below 1000 masl and within the three natural regions of Colombia with the highest number of GBIF P. foetida s.l. records. The sampled sites were in municipalities with climate characterised as Tropical Dry Forest (Los Córdobas, Moñitos, San Bernardo del Viento, Santa Marta, Santiago de Tolú, Sincelejo) or Tropical Humid Forest (Arboletes, Carepa, Cartagena, Caucasia, Chigorodó, Cimitarra, Necoclí, Planeta Rica, Puerto Berrío, San Juan de Urabá, Santa Catalina, Santa Fe de Antioquia, Sitionuevo, Turbo) (Institute of Hydrology, Meteorology and Environmental Studies, cited by Ingeniería Sostenible−ISMD, 2013). While the morphology of the putative P. foetida s.l. plants collected was in broad agreement with the characteristics of P. foetida s.l. reported by Morales (2019) (accessions collected in Casanare-Orinoquía, Colombia), there was a lot of variation and consequently identification was ultimately confirmed with sequencing. Two Passiflora species with glabrous leaves (Passiflora sp. A and B) were found during surveys in the Colombian Caribbean region and were sequenced to explore their identity.

Leaves, stems, flower buds or fruits of putative P. foetida s.l. plants with various symptoms associated with possible fungal infection were collected at 31 of the 47 sites (Figure 2, Appendix A: Supplementary Table 1). The most common symptoms on leaves were small whitish or necrotic spots surrounded by chlorosis and larger necrotic lesions with or without associated chlorosis, often at the leaf margin. Dark or light-coloured powdery mycelial growth on fruits was also observed. No disease symptoms caused by biotrophic fungi (e.g. rust fungi) were observed.

Figure 2. Disease symptoms on Passiflora foetida s.l. (confirmed with sequencing) in the field from which fungal isolates found to be pathogenic in subsequent assays were recovered (Table 1). The isolate identification number is included on the bottom left corner of each photograph.

Molecular sequencing of plant samples

DNA was successfully extracted from leaves of the Passiflora sp. (pubescent = putative P. foetida s.l.; or glabrous) found during surveys, and of the cultivated Passiflora species acquired from nurseries. DNA was extracted from material of two different putative P. foetida s.l. plants found at site COT (Appendix A: Supplementary Table 1; samples identified as COT and COT4A in Figures 3 and 4). Amplification of ITS and ncpGS failed for five and six samples of putative P. foetida s.l., respectively, despite several attempts at changing PCR conditions. While amplification of ITS was successful for all other Passiflora species collected or acquired in nurseries, ncpGS amplification could only be achieved for P. quadrangularis, P. tripartita var. mollissima, and Passiflora sp. A with glabrous leaves collected during surveys.

Figure 3. Phylogenetic tree of ITS sequences of Passiflora foetida and other Passiflora species. Accessions in black = sequences retrieved from GenBank. Accessions in red = Passiflora sp. samples with pubescent leaves collected in Colombia as part of this study (site ID between parentheses; Supplementary Table 1). Accessions in green = Passiflora sp. samples with glabrous leaves collected in Colombia as part of this study. Accessions in blue = identified Passiflora species acquired from nurseries in Colombia. The tree was built using the maximum likelihood method. Only bootstrap values above 60% are shown. Adenia gummifera was used as outgroup.

Figure 4. Phylogenetic tree of ncpGS sequences of Passiflora foetida and other Passiflora species. Accessions in black = sequences retrieved from GenBank. Accessions in red = Passiflora sp. samples with pubescent leaves collected in Colombia as part of this study (site ID between parentheses; Supplementary Table 1). Accessions in green = Passiflora sp. sample with glabrous leaves collected in Colombia as part of this study. Accessions in blue = identified Passiflora species acquired from nurseries in Colombia. The tree was built using the maximum likelihood method. Only bootstrap values above 60% are shown. Adenia gummifera was used as outgroup.

ITS

Three well-supported clades were found in the phylogenetic analysis using 76 ITS sequences (Figure 3). All Passiflora sp. accessions with pubescent leaves collected at the sites surveyed grouped into clade I with GenBank sequences of P. foetida (including some identified to variety level) from China, India, Brazil, and the African continent, confirming the identity of the plants we collected. Within clade I, a P. foetida accession from Brazil and P. foetida var. gossypiifolia from India were grouped into a separate branch. A P. foetida accession from the USA did not group with either clade I or II.

Clade II comprised sequences of cultivated Passiflora species and confirmed the identity of the plants we acquired from nurseries. The closely related P. edulis f. edulis and P. edulis f. flavicarpa grouped into a subclade of clade II, while sequences of each of P. quadrangularis, P. ligularis and P. tripartira var. mollissima grouped into different subclades, each supported by bootstrap values of 95, 84 and 91%, respectively. Passiflora species with glabrous leaves found during surveys grouped into a third clade (III). Passiflora sp. A grouped into a subclade with Passiflora biflora Lam., while Passiflora sp. B was closely related to another subclade comprising sequences of Passiflora tricuspis Mast.

ncpGS

The phylogenetic analysis using the ncpGS region was performed with 71 sequences and showed three well-supported clades like those observed in the ITS analysis (Figure 4). Clade I comprised all Passiflora sp. accessions with pubescent leaves collected in Colombia and the six sequences of P. foetida available in GenBank (including some identified to variety level), thus again confirming the identity of the plants we surveyed. Clade I, however, comprised four subclades: One with most of the P. foetida s.l. collected in Colombia and all P. foetida GenBank sequences, and three other subclades with accessions of P. foetida s.l. we collected in the Uraba region of the Department of Antioquia and two municipalities of the Department of Córdoba (San Bernardo del Viento and Planeta Rica) in Colombia.

The accessions of P. quadrangularis and P. tripartita var. mollissima sequenced as part of this study grouped into subclades comprising sequences of the same species within Clade II. The ncpGS sequence of Passiflora sp. A (with glabrous leaves) found during surveys grouped into Clade III with sequences of P. biflora.

Fungal isolation from disease symptoms and pathogenicity tests

A total of 125 isolates were recovered from disease symptoms on P. foetida s.l. material collected at 31 sites (Figure 2, Appendix A: Supplementary Table 1). In pathogenicity tests, only 34 of these isolates caused lesions on at least 1 of the 6 inoculated detached leaves of P. foetida s.l. Twenty-one of these isolates were considered as pathogenic because they caused lesions on more than three leaves and fungi recovered from these lesions shared the same morphological characteristics as that of the isolates used for inoculation, thus confirming fulfilment of the Koch’s postulates (Table 1, Figure 5). Across all tests performed, the leaf area onto which SWD drops were applied did not develop any lesions. For 16 of the 21 pathogenic isolates, lesions in the leaf area where inoculum drops were applied had begun to develop by 7 dai (Table 1). Lesions varied from discrete brown spots with chlorotic border to irregularly shaped spots that in some instances merged, developed mycelium and/or dried out over time (Figure 5).

Figure 5. Examples of disease symptoms (left portion of leaves) that developed on detached leaves of Passiflora foetida s.l. in the pathogenicity tests (A−D: abaxial leaf surface, E−F: adaxial leaf surface). Three drops of inoculum of an isolate were placed on one half of the leaf, while three drops of sterile distilled water were applied on the other half as control. The isolates used for inoculation were CIM1D7 (A), SB5E3 (B), CAU1C2 (C), TOL1C3 (D), COT5B1 (E), and CIM1B2 (F). Photographs were taken at 7 days after inoculation, except for isolate TOL1C3 which was taken at 9 days after inoculation.

Table 1. Fungal isolates recovered from disease symptoms on Passiflora foetida s.l. material collected in the field that were classified as pathogenic based on results from pathogenicity tests (i.e. lesions observed on more than 3 of the 6 detached leaves of P. foetida s.l. inoculated).

No.	Isolate ID code^a	Identification^b	Municipality of collection site	Disease symptom from which the isolate was recovered^c	First appearance of leaf lesions in pathogenicity test (days after inoculation)^d
1	PR1F1	Aspergillus sp.	Planeta Rica	Black powdery growth on fruit	8
2	SUC1A4	Cladosporium sp.	Sincelejo	Small circular brown spot with chlorotic border on leaf	5
3	PR1A1	Cladosporium sp.	Planeta Rica	Chlorotic spots on the upper surface of leaf with mycelial growth on the under surface	12
4	TOL1C3	Cladosporium sp.	Santiago de Tolú	Irregular brown spots without chlorotic border on leaf and dead tissue in the centre of spots	8
5	COT5B1	Colletotrichum sp.	Santa Fe de Antioquia	Large necrotic area from leaf edge and surrounding chlorosis	4
6	SB11A2	Colletotrichum sp.	San Bernardo del Viento	Irregular brown spot with surrounding chlorosis on leaf	15
7	CARE1B3	Corynespora cassiicola	Carepa	Small light brown spot with surrounding chlorosis on leaf	4
8	CIM1D7	Curvularia sp.	Cimitarra	Superficial growth of white mycelium on fruit peduncle	4
9	CHI1D2	Diaporthe sp.	Chigorodó	Irregular brown spot with chlorotic border on leaf	4
10	PB1C3	Diaporthe sp.	Puerto Berrio	Irregular dark brown spots on leaf	6
11	SC2D2	Diaporthe sp.	Santa Catalina	Large irregular necrotic lesions associated with reddish area on leaf	5
12	CAU1C2	Diaporthe sp.	Caucasia	Irregular brown spot, dry in appearance, with a chlorotic edge	6
13	CIM1B2	Epicoccum sorghinum	Cimitarra	Fruits and seeds with white and/or black powdery growth	3
14	FRA1B6	Fusarium sp.	Santa Fe de Antioquia	Circular white spots, with thin centre. Fungal-like structures on upper and under surface of spots	5
15	CHI1C6	Fusarium sp.	Chigorodó	Leaf with burning edges and surrounding chlorosis	5
16	ARB3C3	Fusarium sp.	Arboletes	Leaf with pigment loss and edge curling	8
17	SB5E3	Fusarium sp.	Moñitos	Large necrotic area from leaf edge with fungal-like growth	3
18	COT6B2	Fusarium sp.	Santa Fe de Antioquia	Large necrotic area from leaf edge	4
19	ARB3B4	Lasiodiplodia sp.	Arboletes	Leaf with burning edges and surrounding chlorosis	3
20	COT5B5	Neopestalotiopsis sp.	Santa Fe de Antioquia	Large necrotic area from leaf edge and surrounding chlorosis	4
21	ATL2C4	Phialemoniopsis curvata	Sitionuevo	Leaf with burning edges and surrounding chlorosis	5

^a The portion of the isolate ID number in bold corresponds to the collection site ID code (see Appendix A: Supplementary Table 1).

^b See Appendix B: Supplementary Material – Morphological and molecular characterisation of pathogenic isolates.

^c See Figure 2 for photographs of symptoms.

^d See Figure 5 for examples of disease symptoms that developed during pathogenicity tests.

Identification of pathogenic isolates

The morphological and molecular characterisation of the 21 pathogenic isolates on P. foetida s.l. revealed that they belong to 11 genera: Aspergillus, Cladosporium, Colletotrichum, Corynespora, Curvularia, Diaporthe, Epicoccum, Fusarium, Lasiodiplodia, Neopestalotiopsis and Phialemoniopsis (Table 1, Appendix B: Supplementary Material). A tentative identification at the species level was possible for 3 isolates by combining morphological and molecular data, while the remaining 18 isolates could only be identified at the genus level with the information available as part of this study. Most isolates sporulated in one or more culture media. Sporulation, however, was not observed in any of the media used to grow isolates of the genera Colletotrichum, Corynespora, Diaporthe, Epicoccum, and Lasiodiplodia, and one of the isolates in Cladosporium (PR1A1). Consequently, their identification was only based on molecular sequences and characteristics of colonies growing on PDA.

Discussion

The identification of highly variable target plant species, such as P. foetida s.l. (Vanderplank, 2013), using morphological characters during field surveys of natural enemies can be challenging, especially when reproductive organs are not always present (e.g. McCulloch et al., 2020). To address this challenge during our surveys, we sequenced a representative individual of the putative P. foetida s.l. plants examined at each site and performed phylogenetic analyses to compare our sequences with other relevant GenBank sequences. Both regions sequenced (ITS and ncpGS) confirmed that the plants surveyed were P. foetida s.l. Our results also showed that the P. foetida s.l. accessions grouped in a separate clade to other Passiflora species outside of section Dysosmia, as reported in other studies based on morphological characters or molecular markers (Hopley et al., 2021; Ocampo Pérez & Coppens d’Eeckenbrugge, 2017; Pacheco et al., 2020; Ramaiya et al., 2014; Shrestha et al., 2019; Yockteng & Nadot, 2004).

While there was no variation in ITS sequences amongst all our P. foetida s.l. samples, their ncpGS sequences grouped into different subclades, indicating the presence of genetic variation within P. foetida s.l. in Colombia. Mäder et al. (2010) found genetic variation in ITS between accessions of P. foetida s.l. from four states in Brazil and discussed that such intraspecific variation may indicate that the taxon P. foetida s.l. comprises unrecognised species. Variation in ncpGS sequences and chromosome number amongst four accessions of P. foetida (including three identified to variety level) has also been reported and hybridisation within this taxon was suggested as an explanation (Yockteng & Nadot, 2004). A global, comprehensive investigation of the morphological, chromosome and molecular diversity in P. foetida s.l. is required to unravel the taxonomic imbroglio associated with this taxon. This could be highly relevant for the development of a CBC programme with a promising fungal candidate agent, especially if the P. foetida s.l. complex comprises different taxa and/or genotypes which are susceptible to different genotypes of the fungus, as reported in other weed CBC programmes (Morin, 2020; Pollard et al., 2021).

Our field surveys in the north-west of Colombia did not find any disease symptoms on P. foetida s.l. caused by obligate biotrophic fungi. These types of fungi are generally prioritised for further investigations in weed CBC programmes because they usually have high level of host specificity, wind dispersed spores and the ability to cause severe disease symptoms that reduce vigour of the target weed (Morin et al., 2006). A recent analysis of historical records of effectiveness of 288 species of weed CBC agents released in Australia showed that biotrophic pathogens (primarily rust fungi) and insects that feed on plant sap or root/crown have been the most effective agents in providing control (Cullen et al., 2022). In the literature, there is only one rust fungus, Puccinia scleriae (Pazschke) Arthur, recorded on Passiflora species, but not on P. foetida s.l., in Colombia and elsewhere in warmer regions of Africa, Asia, and the Americas (Farr et al., 2021; Hennen et al., 2005; Salazar-Yepes, 2021). This fungus is heteroecious (alternates between two hosts) with Passiflora species as aecial hosts and Scleria species (Cyperaceae) as telial hosts (Hennen et al., 2005).

The occasional leaf spots of various sizes and sometime associated with chlorosis, as well as necrosis of leaf edges were the main disease symptoms observed on P. foetida s.l. in our field surveys. We did not observe extensive defoliation nor any girdling lesions on stems, which could have a major impact on a vigorous climber like P. foetida s.l. While many fungal isolates were recovered from the diseased material collected, only 21 isolates were considered as pathogenic on P. foetida s.l. in the detached-leaf assays conducted. Based on the literature, several fungi are recorded on P. foetida s.l. worldwide, but until our study none had been reported in Colombia (Farr et al., 2021; Fischer & Rezende, 2008). Many of these fungi have also been found on other Passiflora species (e.g. Alternaria passiflorae J.H. Simmons and Pseudocercospora stahlii (F. Stevens) Deighton) or on a wide range of plant species (e.g. Corynespora cassiicola (Berk. & M. A. Curtis), which we isolated in our surveys). Morphological examinations and sequencing of the 21 isolates found to be pathogenic on P. foetida s.l. in our study revealed that they belong to 11 genera. None of these genera, except Colletotrichum, have ever been used in weed CBC (Morin, 2020). Recent fungal pathogen surveys on P. foetida s.l. in Brazil also recovered isolates of Colletorichum, Curvularia, Fusarium and Neopestalotiopsis species from disease symptoms on leaves (Torres, 2019). Of these, a Colletotrichum isolate (identified as Colletotrichum theobromicola Delacr.) and a Fusarium isolate (identified as Fusarium pseudocircinatum Nirenberd & O’Donnel) were confirmed as pathogenic on an accession of P. foetida s.l. from Australia, but also capable of causing disease symptoms on the two other Passiflora species tested. Both these fungi are known as pathogens of many other plants (Weir et al., 2012; Zakaria, 2023). More taxonomic investigations and multi-locus sequencing of the Diaporthe sp. isolates found to be pathogenic in our detached-leaf assays will be required to identify them to species level (Gomes et al., 2013). A new species of Diaporthe, Diaporthe passifloricola Crous & M.J. Wingf., sp. nov., was recently isolated from leaf spots of P. foetida s.l. in Malaysia and described (Crous et al., 2016). Diaporthe species are known to occur as pathogens, saprobes, or endophytes on a wide range of hosts globally (Gomes et al., 2013). There are no literature records of Aspergillus, Cladosporium, Epicoccum, Lasiodiplodia, and Phialemoniopsis species associated with P. foetida s.l. (Farr et al., 2021).

The disease symptoms observed on leaves of P. foetida s.l. in our multi-year field surveys in north-west Colombia were not severe and did not appear to affect plant growth. By analysing a dataset of weed CBC agents released in New Zealand, Paynter (2024) found that the most important predictor of an agent impact on the target weed following its release in a new range was evidence that it was damaging (completely defoliating or killing plants or reducing populations) in the native range. Even though this study only included arthropod agents, it is reasonable to believe that this predictor would also apply to fungal pathogens. Based on the low severity of the disease symptoms we observed on P. foetida s.l. in the field, we conclude that the pathogenic isolates recovered do not warrant further investigations as potential CBC agents. Nonetheless, surveys in other regions of Colombia could be considered as it is possible that the lower number of P. foetida s.l. records in those regions indicate that the plant is rarer due to severe pressure from natural enemies.

Additional surveys in other parts of P. foetida s.l. native range, especially in South America which is the likely centre of origin of the species, may also identify more damaging fungal pathogens with greater prospects for CBC. A preliminary survey of diseases of P. foetida s.l. performed in north-west Ecuador in 2019, however, only observed disease symptoms like those recorded in our Colombian surveys (C. Barnes, pers. comm.). More comprehensive field surveys across 11 states in eastern Brazil between 2017 and 2019 also did not identify fungi highly pathogenic on P. foetida s.l. (Torres, 2019; R. Barreto, pers. comm.). Providing further resources are available, P. foetida s.l. in Peru and Bolivia should next be surveyed to search for pathogenic fungi with CBC potential.

Acknowledgements

We would like to thank Laura Carolina Álvarez Morales and Alejandra Milena Clavijo Giraldo for their contribution to the field surveys and to the laboratories of Fitotecnia Tropical, Biotecnología Industrial and Biología Celular y Molecular, and the Museo Micológico (MMUNM) for the loan of equipment and reagents.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data that support the findings of this study are available from the corresponding author, [L. Morin], upon reasonable request.

Additional information

Funding

This project was supported with funding from the Gorgon-Barrow Island Net Conservation Benefits Fund, administered by the Government of Western Australia.