The obesity associated FTO gene polymorphism and the risk of preeclampsia in Iranian women: A case–control study

Figures & data

Table 1. Primer sequences for genotyping FTO rs9939609.

SNP	Primer	Primer sequence	Amplicon size (bp)	Annealing temp. °C
Rs9939609	Forward outer	AGTTCCAGTCATTTTTGACAGC	429	59.5
	Reverse outer	AGCCTCTCTACCATCTTATGTC
	Forward inner	CCTTGCGACTGCTGTGAATATA	194 (A allele)
	Reverse inner	GAGACTATCCAAGTGCATCTCA	278 (T allele)

Table 2. Clinical characteristics and demographic variables in the study participants.

	Study subjects (n = 312)
Characteristics	Case (n = 128)	Control (n = 184)	p-value
Age (years)	31.4 ± 6.8	27.5 ± 5.2	<0.0001
Body mass index (kg/m2)	31.42	28.34	<0.0001
Systolic blood pressure (mmHg)	145.8 ± 21.8	111.3 ± 7.9	<0.0001
Diastolic blood pressure (mmHg)	89 ± 15.3	73 ± 7.3	<0.0001
Gestational age at birth (weeks)	35.8 ± 3.4	38.7 ± 1.2	<0.0001
History of pregnancy loss N (%)	14(11%)	9(5%)	0.04

Figure 1. Electrophoresis pattern for identification of the FTO rs9939609 genotypes. Lanes 1 and 5: AT genotype; lanes 2 and 7: AA genotype; lanes 3 and 6: TT genotype; lane 4: 100 bp DNA ladder; lane 8: NTC (non-template control).

Figure 2. Sequencing result for FTO rs9939609 polymorphism. (a) TT genotype; (b) AT genotype; (c) AA genotype.

Figure 3. Genotypic distribution of rs9939609 in case and healthy subjects, where the red and green bar represents the cases and controls group respectively. AA and TT are the homozygotic genotypes at some location while AT is heterozygotic.

Table 3. Association analysis between FTO SNP (rs9939609) and risk of PE under different genetic models.

Model	Genotype	Cases	Controls	OR (95%CI)	P value	AIC	BIC
Codominant	T/T A/T A/A	64 (50%) 61 (47.7%) 3 (2.3%)	68 (37%) 88 (47.8%) 28 (15.2%)	1.00 0.74 (0.46-1.18) 0.11 (0.03-0.39)	0.0001	410.2	421.4
Dominant	T/T A/T+A/A	64 (50%) 64 (50%)	68 (37%) 116 (63%)	1.00 0.59 (0.37-0.93)	0.022	421.2	428.7
Recessive	T/T+A/T A/A	125 (97.7%) 3 (2.3%)	156 (84.8%) 28 (15.2%)	1.00 0.13 (0.04-0.45)	<0.0001	409.8	417.3
Overdominant	T/T+A/A A/T	67 (52.3%) 61 (47.7%)	96 (52.2%) 88 (47.8%)	1.00 0.99 (0.63-1.56)	0.98	426.4	433.9
Logadditive	-	-	-	0.52 (0.36-0.76)	0.0004	414	421.4

OR: odds ratio; 95%CI: 95% confidence interval; AIC Akaike’s Information criterion; BIC Bayesian Information criterion.

Table 4. Binary logistic regression analysis to determine the effect of age, BMI, gestational age, and rs9939609 on the risk of PE.

Risk factor		Crude OR (95% CI); P value	Adjusted OR (95% CI); P value
Age		(1) (1.046-1.175); P: 0.001	1.018 (0.952-1089); P: 0.6
BMI		1.125 (1059-1195); P: 0.001	1.109 (1.025-1.201); P: 0.01
Gestational age at birth		0.374 (0.272-0.515); P: 0.001	0.359 (0.248-0.518); P: 0.001
FTO (rs9939609)	AA	0.054 (0.007-0.419); P: 0.005	0.046 (0.004-0.469); P: 0.009
	AT	0.488 (0.271-0.879); P: 0.017	0.596 (0.273-1.302); P: 0.194
	TT	1	1