Therapeutic Effects of Lifei Decoction in a Murine Model of COPD Induced by LPS and Cigarette Smoke

Figures & data

Table 1 Primer Sequences for Quantitative Real-Time PCR Analysis

Gene	Forward Primer (5’→3’)	Reverse Primer (5’→3’)
GDF11	CTACCACCGAGACGGTCATAA	CCGAAGGTACACCCACAGTT
GAPDH	AGGTCGGTGTGAACGGATTTG	GGGGTCGTTGATGGCAACA

Figure 1 LD improved the structural damage of lung tissue in COPD mice. (A) The establishment of a mouse model for COPD and the schematic diagram illustrating drug administration. (B) Changes in body weight of mice in each group from 0 to 12 weeks; (C) Body weight of mice in each group at the end of the experiment (n = 10). (D) Using H&E staining to observe lung pathology (n = 3), bar = 50 μm. ((E) The lung injury in mice was quantified. According to the scope and severity of the lung, it was graded on a scale of 0.5–4: 0.5 = minor, 1 = mild, 2 = moderate, 3 = severe, 4 = very severe. Data are presented as mean ± SEM. ***P <0.001 vs Control group; ^###P < 0.001 vs COPD group.

Figure 2 The LD treatment significantly improved inflammation in COPD mice. The numbers of neutrophils, macrophages and lymphocytes in BALF were counted (A). The levels of IL-1β, IL-6, TNF-α and INF-γ in BALF (B) and lung tissue (C) were analyzed by ELISA, respectively. Data are presented as mean ± SEM, n = 6. ***P <0.001 vs Control group; ^# P < 0.05, ^##P < 0.01 and ^###P < 0.001 vs COPD group.

Figure 3 LD decreased the expression of p-NF-κB protein (A), and increased the expression of GDF11 protein (B) and gene (C) in lung tissue of COPD mice. Data are presented as mean ± SEM, n = 3. *P <0.05 and ***P <0.001 vs Control group; ^#P < 0.05, ^##P < 0.01 and ^###P < 0.001 vs COPD group.

Table 2 The Enumeration of Gut Microbiome

Groups	Enterococcus	Enterobacter	Lactobacillus	Bifidobacterium
Control	5.82 ± 0.24	5.27 ± 0.10	10.25 ± 0.27	3.04 ± 0.14
COPD	8.69 ± 0.27***	9.37 ± 0.25***	7.53 ± 0.25***	1.76 ± 0.14***
LD	7.94 ± 0.11^ns	8.06 ± 0.11^#	9.36 ± 0.24^###	2.47 ± 0.10^##
DEX	7.09 ± 0.33^##	7.55 ± 0.24^##	9.06 ± 0.18^###	2.69 ± 0.12^###

Notes: Enterococcus, Enterobacter, Lactobacillus and Bifidobacterium in mouse feces were isolated by selective medium and counted by viable count method. Data are presented as mean ± SEM, n = 6. ***P <0.001 vs Con group; ^#P < 0.05, ^##P < 0.01 and ^###P < 0.001 vs COPD group.

Figure 4 LD partially restored the barrier function of the impaired small intestine in COPD mice. ZO-1 and Occludin-1 protein levels in the small intestine were analyzed by Western blot. Data are presented as mean ± SEM, n = 3. **P <0.01 and ***P <0.001 vs Control group; ^#P < 0.05, ^##P < 0.01 and ^###P < 0.001 vs COPD group.