PD-1 monoclonal antibodies enhance the cryoablation-induced antitumor immune response: a breast cancer murine model research

Abstract

Background

It has been demonstrated that cryoablation (Cryo) causes specific T-cell immune responses in the body; however, it is not sufficient to prevent tumor recurrence and metastasis. In this report, we evaluated changes in the tumor immune microenvironment (TIME) in distant tumor tissues after Cryo and investigated the immunosuppressive mechanisms that limit the efficacy of Cryo.

Methods

Bilateral mammary tumor models were established in mice, and we first observed the dynamic changes in immune cells and cytokines at different time points after Cryo. Then, we confirmed that the upregulation of PD-1 and PD-L1 signaling in the contralateral tumor tissue was closely related to the immunosuppressive state in the TIME at the later stage after Cryo. Finally, we also evaluated the synergistic antitumor effects of Cryo combined with PD-1 monoclonal antibody (mAb) in the treatment of breast cancer (BC) mouse.

Results

We found that Cryo can stimulate the body’s immune response, but it also induces immunosuppression. The elevated PD-1/PD-L1 expression in distant tumor tissues at the later stage after Cryo was closely related to the immunosuppressive state in the TIME but also created the conditions for Cryo combined with PD-1 mAb for BC mouse treatment. Cryo + PD-1 mAb could improve the immunosuppressive state of tumors and enhance the Cryo-induced immune response, thus exerting a synergistic antitumor effect.

Conclusions

The PD-1/PD-L1 axis plays an important role in suppressing Cryo-induced antitumor immune responses. This study provides a theoretical basis for Cryo combined with PD-1 mAb therapy in clinical BC patients.

Keywords:

• PD-1 monoclonal antibodies
• cryoablation
• breast cancer
• immune response
• immunosuppression

1. Background

According to the report Global Cancer Statistics 2020 published by the International Agency for Research on Cancer of the World Health Organization [1], the number of new cases of female breast cancer (BC) in the whole human population in 2020 was approximately 2.3 million (11.7%), which surpassed lung cancer as the most common type of cancer. With the rapid development of medical technology and the improvement of various medical examination techniques, the detection rate of BC is increasing [2]. Local ablation therapy for BC has the advantages of being minimally invasive, few postoperative complications, rapid patient recovery and high postoperative quality of life and can be repeatedly performed multiple times, making it an additional surgical procedure with curative potential after surgical resection [2,3].

Minimally invasive ablation therapy has begun to show promising results in the treatment of solid malignancies such as liver cancer and BC, and it is a highly respected treatment modality with great clinical application potential, which has developed into a good complement and alternative to surgical resection [2,4]. Compared with surgery, radiotherapy and thermal ablation, cryoablation (Cryo) can preserve tumor antigenic activity to the greatest extent, which can stimulate the antitumor immune response more effectively and even induce the ‘distant effect’, i.e., the reduction or disappearance of distant metastases, which shows that Cryo can combine both local tumor elimination and systemic immune effects, which is extremely important for the treatment of advanced cancer [5,6]. Although there has been great progress in the application of Cryo, the Cryo-induced immune response is not sufficient to prevent tumor recurrence and metastasis, and the underlying mechanisms remain unclear.

The tumor immune microenvironment (TIME) contains a variety of immunosuppressive elements, including immune checkpoint molecules PD-1 (programmed death), PD-L1 (programmed death ligand 1) and CTLA-4 (cytotoxic T lymphocyte-associated antigen) [7,8]. Among them, PD-1 has been the most studied. The level of PD-1 expression is very low when the immune system is at rest, but when it is activated, PD-1 is widely expressed on the membrane surface of many immune cells, including CD4⁺ and CD8⁺ T lymphocytes, and it is thought to be a key indicator of early T lymphocyte depletion in the TIME [9]. PDL-1 is a PD-1 ligand that is frequently expressed on the membrane surface of several tumor cells, including BC [10]. Binding of PD-1⁺ T lymphocytes to their ligand PD-L1 leads to suppression of tumor-specific T lymphocyte activity and induces T-cell depletion, thus allowing tumors to successfully evade the immune system during tumorigenesis and progression [7,9]. It is unknown whether the PD-1/PD-L1 axis regulates Cryo-induced antitumor T-cell immunity responses, although it is actively engaged in inhibiting antitumor immune responses in the TIME.

In our report, we first investigated whether Cryo could activate the body’s antitumor immunity and its dynamics and examined whether the PD-1/PD-L1 axis would be involved in restricting this immune response using a mouse model of bilateral in situ BC. Finally, we also explored whether Cryo combined with PD-1 monoclonal antibody (mAb) could significantly improve the effect of a single treatment and thus exert a synergistic antitumor effect. Our research aims to provide new insights into the mechanisms of immunosuppression that limit the efficacy of Cryo and to investigate the potential of Cryo in cancer treatment when combined with PD-1 mAb.

2. Materials and methods

2.1. Cell line and mice

Procell Life Science & Technology Co., Ltd. graciously contributed 4T1 mouse BC cells for our study. 10% fetal bovine serum was also added to the RPMI 1640 medium, which was used to cultivate the cells. We bought female BALB/c mice from Zhao Yan New Drug Research Center when they were 6–9 weeks old and weighed 19–23 g. (Suzhou, Jiangsu, China). All mice were housed in specific pathogen-free (SPF) animal rooms with constant temperature and humidity (temperature control 20–24 °C, humidity control 40–70%) and an automatically controlled light cycle (12 h/12 h). Our institutional ethics committee approved all animal-related experiments that adhered to institutional standards (approval serial number: K2020070).

2.2. Antibodies and reagents

Thermo Scientific (USA) provided the following antibodies: anti-CD45-PE-Cyanine5, anti-CD8a-PE-Cyanine7, anti-CD4-FITC, anti-Ly-6G/Ly-6C-FITC, anti-CD11b-APC and anti-FOXP3-PE. PE Anti-Mouse CD279 (PD-1) and PE Anti-Mouse CD274 (PD-L1) were purchased from Biolegend (USA). InVivoMab anti-mouse PD-1 (CD279) was purchased from BioXcell (USA). Anti-CD3e, anti-CD4 and anti-CD8α antibodies were purchased from CST (USA).

2.3. Animal models and treatments

We inoculated Balb/C mice with murine-derived 4T1 BC cell suspensions in the bilateral mammary fat pads and started treatment when the mammary tumors in situ reached a volume of approximately 250 mm³. Cryo was performed on the right tumor only, and various immunological analyses were performed on the left unablated tumor tissue. Anesthesia was administered intraperitoneally using 1% pentobarbital sodium. The mice were then fixed on the operating table, and the surgical area was routinely prepared with skin, disinfected and dried. A 2.0 mm diameter cryoprobe was inserted into the central part of the tumor. Treatment was performed at −100 °C for at least 30 s and two freeze-thaw cycles were delivered to ensure complete ablation of the target tumors [11]. To evaluate the effect of the combined treatment, mice were injected with 200 μg PD-1 mAb intraperitoneally every three days for a total of four times from the day after Cryo. PD-1 inhibitors were administered as previously described [12]. Every three days, calipers were used to measure the left tumor’s longest diameter L and vertical diameter W. Tumor size was calculated using the Formula L × W until the mice died or the maximum diameter of the tumor exceeded 2 cm.

2.4. Flow cytometric analysis

Mice were sacrificed by cervical dislocation and the left tumor tissue that had not been ablated was removed for immunological testing. The tissue was divided into 2–4 mm pieces, digested with collagenase and then filtered to create single-cell suspensions. Immune cell subsets were identified and analyzed by the flow cytometer and CytExpert software from Beckman Coulter (USA) after the single-cell suspensions were stained with CD45, CD8, CD4, FoxP3, CD11b and Gr-1.

2.5. Quantitative real-time PCR (qRT–PCR)

RNA was extracted from tumor tissues using TRIzol (Invitrogen, USA). Two μg of total RNA was reverse transcribed to cDNA using SYBR Premix Ex Taq (a reverse transcription kit, Takara, Japan). qRT–PCR was performed on a Light Cycler 480II real-time PCR detection system (Roche, Switzerland) according to the operating instructions of the PrimeScript RT reagent Kit (Takara). Primer sequences for TNF-α, IL-4, PD-1, PD-L1, IL-12α, T-bet, TGF-β, GrzB and IL-6 were designed using Primer Premier 5.0 software (Palo Alto). The primer sequences are shown in Table 1.

Table 1. The list of primers.

GENE	Forward primer	Reverse primer
TNF-α	GGACTAGCCAGGAGGGAGAACAG	GCCAGTGAGTGAAAGGGACAGAAC
IL-4	TACCAGGAGCCATATCCACGGATG	TGTGGTGTTCTTCGTTGCTGTGAG
PD-L1	AAGCCTCAGCACAGCAACTTCAG	TGTAGTCCGCACCACCGTAGC
PD-1	GGTATCCCTGTATTGCTGCTGCTG	CTTCAGAGTGTCGTCCTTGCTTCC
IL-12α	TGCCAGGTGTCTTAGCCAGTCC	GGTTTGGTCCCGTGTGATGTCTTC
Tbet	ATCACTAAGCAAGGACGGCGAATG	TCCACCAAGACCACATCCACAAAC
TGF-β	ACCGCAACAACGCCATCTATGAG	GGCACTGCTTCCCGAATGTCTG
IL-6	TCTGGAGCCCACCAAGAACGATAG	GTCACCAGCATCAGTCCCAAGAAG
GrzB	TCCAGGATTGCTCTAGGACAGGTG	CATGGTGGCAGAAGAGGTGTTCC

2.6. Immunohistochemistry staining (IHC)

The excised tumor tissues were paraffin-embedded. The paraffin tissue blocks were cut into 4-μm sections, dewaxed twice in xylene and dehydrated in gradually decreasing concentrations of alcohol. The sections were antigenically repaired in citric acid buffer at 93 °C for 30 min. After that, the slices were placed in an oven at 37 °C for 30 min while being incubated with 10% serum to lessen nonspecific adsorption. The serum was discarded, and the cells were washed three times with PBS. Anti-CD3e, anti-CD4 and anti-CD8α antibodies were used as the primary antibody and incubated overnight at 4 °C in the refrigerator. After washed with PBS, the secondary antibody labeled with alkaline phosphatase was added and left for 40 min at 37 °C. Then, the sections were stained with diaminobenzidine (DAB) and restained with hematoxylin. Finally, they were dehydrated in gradient alcohol and xylene, sealed with neutral gum.

2.7. Enzyme-linked immunosorbent assay (ELISA)

On Day 3 after the end of the combination therapy, sufficient blood specimens were obtained by removing the mouse eyes, and serum specimens were obtained by high-speed centrifugation. The expression levels of IL-12 and IFN-γ in serum were measured using kits from Abcam (USA). All analyses were performed in triplicate.

2.8. Statistical analysis

The graphs were plotted with GraphPad-Prism 8.3.0 software, and the data were analyzed by SPSS 21.0 software using an unpaired two-tailed t test for comparison between two groups and ordinary one-way ANOVA for comparison between multiple groups, with p < .05 considered statistically significant (*p < .05; **p < .01; ***p < .001; ****p < .0001). Using Image-Pro Plus 6.0 software, the number of positive cells visible under the field of view for IHC sections was counted. The log-rank (Mantel-Cox) test was used for the survival analysis. If not stated otherwise, data are expressed as the mean + SEM.

3. Results

3.1. Cryo produces moderate and transient growth inhibition of distant tumors outside the ablation zone

To assess the antitumor immune response of distant tumors outside the ablation zone after Cryo treatment, we inoculated murine-derived 4T1 BC cell suspensions into the mammary fat pads of Balb/C mice bilaterally. When the tumor length diameter reached approximately 0.8 cm, Cryo was performed on the right mammary tumor, preserving the left side and observing its malignant growth trend (Figure 1(A)). The H&E staining results indicated that the bilateral mammary tumor model was successfully constructed (Figure 1(B)). The left tumor became slightly smaller in size on Day 3 after treatment (Figure 1(C)). However, after a short period of growth inhibition, the left tumor gradually resumed its malignant growth rate at Days 6–12 (Figure 1(C)), suggesting that these two time points may reflect the different immune response states of tumor-infiltrating lymphocytes (TILs) in the tumor tissue.

Figure 1. Cryo produced transient growth inhibition of distant tumors outside the ablation zone. A. The mouse bilateral in situ mammary tumor model was successfully constructed, and the white arrow indicates that the mouse right mammary tumor was treated with Cryo. B. The tumor tissue from the successful model was stained with H&E, and a large number of tumor cells are visible in the field of view. Bars, 50 μm. C. Growth curve of the left unablated tumor. (n = 10).

3.2. Cryo induces effective but transient antitumor immune responses in distant tumors that diminish as tumors resume growth

To assess the progression of Cryo-induced antitumor immune responses in distant tumors outside the ablation zone, we performed immunoassays at early and later time points of distant tumors after Cryo. On Day 3 after Cryo, the percentage of CD45⁺ immune cells in distant tumors was much greater in the Cryo group than in the Non-Cryo group, approximately three times greater. However, the CD45⁺ immune cells started to show a decreasing trend on Day 9 (Figure 2(A,B)). Moreover, a significant increase in the percentage of CD4⁺ and CD8⁺ TILs was observed on Day 3, yet they started to show a decline on Day 9 (Figure 2(C–E)). On Day 3, the percentage of immunosuppressive myeloid-derived suppressor cells (MDSCs) and regulatory T cells (Tregs) in the Cryo group decreased significantly compared with the Non-Cryo group; however, they started to increase significantly on Day 9 (Figure 2(F–I)). These results suggest that Cryo induces an antitumor immune response characterized by increased infiltration of CD4⁺ and CD8⁺ T lymphocytes, but this immune response is suppressed by the TIME, resulting in a diminished immune response at the later stage after Cryo, which results in an effective but transient antitumor immune response to distant tumors outside the ablation zone.

Figure 2. Cryo-induced T-cell infiltration into distant tumors and analysis of their dynamics. Cryo was administered as described in Figure 1, and the left unablated breast tumor tissue was taken and digested to produce a single cell suspension or used for RNA extraction. A, Representative flow cytometric plots (Rfcp) of CD45⁺ immune cells in tumor tissue on Day 3 and Day 9 after Cryo (single cell gate). B, Percentage of CD45⁺ TILs. C, Rfcp of CD4⁺ and CD8⁺ T cells (CD45⁺ gate). D, Percentage of CD8⁺ TILs. E, Percentage of CD4⁺ TILs. F, Rfcp of FoxP3⁺ cells (CD4⁺ gate). G, Percentage of Treg cells. H, Rfcp of MDSCs. I, Percentage of MDSCs. J, Relative mRNA expression levels of the Th1-type cytokine TNF-α. K, Relative mRNA expression levels of the Th2-type cytokine IL-4. All results are representative of three independent experiments with five mice per group.

In addition, we measured the mRNA expression of the Thl-type cytokine TNF-α and the Th2-type cytokine IL-4 in distant tumors on Days 3 and 9 (Figure 2(J,K)). On Day 3, the expression level of TNF-α mRNA increased approximately 3.5-fold compared with the Non-Cryo group; however, on Day 9, the expression level of TNF-α mRNA decreased sharply and approached that of the Non-Cryo group. On Day 3, IL-4 expression was not statistically significant compared with the Non-Cryo group; however, on Day 9, the expression level of IL-4 increased significantly and was approximately three times higher than that of the control group. In conclusion, these results suggest that Cryo can effectively activate Th1-type cytokine-mediated cellular immunity at the early stage after Cryo, but at the late stage of Cryo, it leads to a Th1/Th2 ratio imbalance and drift of Th1-type cytokines to Th2-type cytokines, resulting in immunosuppression and affecting the antitumor effect of the organism.

3.3. The PD-1/PD-L1 axis inhibits the cryo-induced antitumor immune response

High expression of PD-1/PD-L1 in human tumor tissues is closely associated with patient survival and prognosis. We first downloaded the RNA-seq data of tumors from The Cancer Genome Atlas (TCGA) database to compare the mRNA gene expression distribution in tumor tissues of 140 triple-negative breast cancer (TNBC) patients and 113 paired paracancerous normal tissues in the TCGA database (Figure 3(A,B)). The statistical results showed that the expression of the PDCD1 gene (PD-1) and CD274 gene (PD-L1) was significantly higher in the tumor tissues of TNBC patients than in their corresponding normal tissues next to the cancer.

Figure 3. The expression of PD-1/PD-L1 in distant tumor tissues after Cryo treatment. A, The expression distribution of the PDCD1 gene (PD-1) in tumor tissues and corresponding normal tissues adjacent to the tumor. B, The expression distribution of the CD274 gene (PD-L1) in tumor tissues and corresponding normal tissues adjacent to the tumor. C, Paraffin sections of distant tumor tissues from the non-Cryo and Cryo groups were analyzed by IHC for PD-L1 expression. PD-L1 expression was significantly enhanced on Day 9 after Cryo treatment. Bars, 50 μm. D, Representative flow cytometric plots (Rfcp) of PD-1 expression levels on CD8⁺ T cells in distant tumor tissue on Day 3 and Day 9 after Cryo. E, Percentage of PD-1 expression on CD8⁺ T cells. F, Rfcp of PD-1 expression levels on CD4⁺ T cells. G, Percentage of PD-1 expression on CD4⁺ T cells. H, Rfcp of PD-L1 expression levels on CD11b⁺Gr1⁺ cells. I, Percentage of PD-L1 expression on CD11b⁺Gr1⁺ cells. J, Relative expression levels of PD-1 mRNA in distant tumor tissues. K, Relative expression levels of PD-L1 mRNA in distant tumor tissues. All results are representative of three independent experiments with five mice per group.

The results of the previous study showed that Cryo can stimulate the body’s immune response but also induce the development of immunosuppression at the late stage of Cryo. To further investigate whether the PD-1/PD-L1 signaling pathway is related to immunosuppression at the late stage of Cryo, we collected distant BC tissues from the Non-Cryo and Cryo groups on Day 9 after Cryo and analyzed the expression of PD-L1 in tumor tissues by IHC. The results showed that PD-L1 expression was significantly enhanced in the Cryo group on Day 9 after Cryo (Figure 3(C)).

To further confirm the increased level of PD-1/PD-L1 expression in distant tumor tissues after Cryo, we extracted cells from distant mammary tumor tissues by centrifugation after sectioning on Days 3 and 9 after Cryo and detected PD-1 expression on CD8⁺ and CD4⁺ T cells using flow cytometry. The results showed that 25.11% of CD8⁺ TILs expressed PD-1 in the control group of mice, and this percentage increased to 34.37% on Day 3 after Cryo and continued to increase to 43.87% on Day 9 (Figure 3(D,E)). However, PD-1 expression in CD4⁺ TILs was never statistically significant compared to that in the control group on either Day 3 or Day 9 (Figure 3(F,G)). PD-L1 was selectively highly expressed on the surface of tumor cells and MDSCs and further activated the PD-1/PD-L1 downstream pathway by binding to PD-1 on the surface of activated tumor-infiltrating T cells, suppressing T-cell activity and leading to immunosuppression. Further results showed that approximately 74% of CD11b⁺Gr1⁺ cells expressed PD-L1 in the control group mice. The percentage increased to 83% on Day 3 after Cryo and its upregulation continued and reached 95% on Day 9, with statistically significant differences compared to the Control group (Figure 3(H,I)).

Our results also showed no statistically significant difference in the relative mRNA expression levels of both PD-1 and PD-L1 in distant tumor tissues on Day 3 after Cryo treatment (Figure 3(J,K)). Interestingly, both showed a significant increase on Day 9, which was statistically significant compared to the non-Cryo group. Overall, these findings suggest that PD-1 and PD-L1 signaling is upregulated in tumor tissue at the later stage after Cryo, suggesting that this is closely related to the immunosuppressive state in the TIME at the later stage after Cryo but also creates an opportunity for Cryo in combination with PD-1 mAb for BC treatment.

3.4. Cryo and PD-1 mAb combination therapy synergistically inhibits distant tumor growth

PD-1 and PD-L1 expression levels in the TIME are closely correlated with PD-1 mAb blockade therapy. Previous findings have demonstrated that PD-1 and PD-L1 expression levels in distant tumor tissues were significantly increased after Cryo, which provides a therapeutic target for PD-1 mAb blockade therapy. To further confirm whether Cryo combined with PD-1 mAb has a synergistic antitumor effect, we randomly divided Balb/c mice carrying 4T1 into the following groups: Control group; Cryo group; PD-1 mAb group and Cryo + PD-1 mAb group (PD-1 mAb, 200 μg/each mouse) and received the corresponding treatment (Figure 4(A)). Our results showed that both the Cryo group and the PD-1 mAb group produced inhibitory effects on untreated distant tumor growth. In contrast, Cryo and PD-1 mAb administration together significantly delayed the growth of distant tumors in BC mouse models and improved the survival of mice with significant synergistic antitumor effects compared to mice in the Non-Cryo group or single treatment groups (Figure 4(B,C)).

Figure 4. Cryo combined with PD-1 mAb improves tumor immunosuppression and enhances the immune response induced by Cryo. A, Experimental flow chart of the study. B, Plot of distant tumor growth curves for each treatment group (n = 10). C, Survival time profiles of mice in each treatment group (n = 10). D, Representative flow cytometric plots (Rfcp) of CD45⁺ immune cells in distant tumor tissues of each treatment group. E, Percentage of CD45⁺ TILs. F, Rfcp of CD4⁺ and CD8⁺ T cells (CD45⁺ gate). G, Percentage of CD8⁺ TILs. H, Percentage of CD4⁺ TILs. I, Representative flow cytometric plots of MDSCs. J, Percentage of MDSCs. K, Rfcp of FoxP3⁺ cells (CD4⁺ gate). L, Percentage of Treg cells. All results are representative of three independent experiments with five mice per group.

3.5. Cryo combined with PD-1 mAb improves tumor immunosuppression and enhances the cryo-induced immune response

To more appropriately assess the changes in immune responses in the TIME induced by Cryo combined with PD-1 mAb treatment, we performed immunoassays on distant tumors on Day 13 after Cryo, i.e., Day 3 after the end of combined treatment. The results showed that the percentage of CD45⁺, CD8⁺ and CD4⁺ tumor-infiltrating T lymphocytes in the distant tumor tissues was higher in the single treatment groups than in the Non-Cryo group and significantly higher in the Cryo + PD-1 mAb group than in the single treatment groups (Figure 4(D–H)). In addition, the percentage of immunosuppressive MDSCs and Tregs in the distant tumor tissue of the Cryo group increased to a level similar to that of the Non-Cryo group at Day 13, while PD-1 mAb treatment was able to significantly reduce the percentage of MDSCs and Tregs in the TIME of distant tumor tissue, with statistically significant differences, and the Cryo + PD-1 mAb group inhibited MDSC and Treg amplification most significantly (Figure 4(I–L)). This suggests to us that the combination of Cryo with PD-1 inhibitors can significantly improve the immunosuppressive status of TILs and thus inhibit tumor progression among different approaches of treatment.

The expression of CD3, CD4 and CD8 T cells in distant tumor tissues from each therapy group was examined by IHC to further support the findings of the immunoassay by flow cytometry (Figure 5(A–D)). According to the findings, the three types of T cells were considerably more expressed in the tumor tissues of the Cryo group and PD-1 mAb group than in the Non-Cryo group. When compared to the single treatment groups, the Cryo + PD-1 mAb group’s CD3, CD4 and CD8 T cell expression was further elevated, indicating that the combination therapy may improve the ability of the three T cell subsets to infiltrate into the tumor parenchyma. In the distant tumor tissues of the single treatment groups compared to the Non-Cryo group, qRT-PCR analysis revealed that the expression levels of the Thl-type cytokines TNF-α and IL-12α as well as the Thl-type transcription factor T-bet were significantly upregulated, with the combination treatment group having the highest upregulation level (Figure 6(A–C)). The relative mRNA expression level of the Th2-type cytokine TGF-β was upregulated on Day 13 after Cryo treatment; however, it was significantly downregulated in both the PD-1 mAb group and Cryo + PD-1 mAb group (Figure 6(D)). The relative mRNA expression of GrzB in tumor tissues was significantly upregulated in all treatment groups, with the greatest upregulation in the Cryo + PD-1 mAb group (Figure 6(E)). Cytotoxic lymphocytes (CTLs) mediate their cytotoxic effects through two major pathways: Fas/FasL and perforin/GrzB. Our results suggest that apoptosis may be induced through the perforin/GrzB pathway in the combination treatment group. The relative mRNA expression of the Th2-type cytokine IL-6 was not statistically significant in each group (Figure 6(F)).

Figure 5. IHC analysis of TILs in distant tumor tissues after treatment with different methods. A, Representative immunohistochemical sections of CD3, CD4 and CD8 T cells in distant tumor tissues of each group after treatment with different methods. Bars, 50 μm. B-D, The corresponding quantification of CD3, CD4 and CD8 T cells in distant tumor tissues of each group after different treatments. Ten visual fields were randomly selected from each slide for analysis. All results are representative of three independent experiments with five mice per group.

Figure 6. The expression of immune-related cytokines in tumor tissues and serum was measured by qRT–PCR and ELISA, respectively. A-F, The relative mRNA expression levels of TNF-α (A), IL-12α (B), T-bet (C), TGF-β (D), GrzB (E) and IL-6 (F) in tumor tissues of each treatment group. G-H, The expression levels of IL-12 (G) and IFN-γ (H) in the serum of tumor-bearing mice of each treatment group.

We used ELISA to measure the expression of IL-12 and IFN-γ in the serum of tumor-bearing mice after different treatment methods (Figure 6(G,H)). The results of the serum IL-12 assay were consistent with the results of fluorescent quantitative PCR. In the Cryo + PD-1 mAb group compared to the Non-Cryo group, the expression of IL-12 increased about 2.3-fold, and there was also a substantial rise compared to mice in the Cryo or PD-1 mAb groups. Additionally, the outcomes of the IL-12 and serum IFN-γ assays were in agreement. According to the findings, the combination therapy considerably increased the release of IFN-γ and IL-12 in mouse serum.

4. Discussion

In this study, we showed that Cryo increased PD-1 and PDL1 expression in the TIME of distant tumor tissues and produced a transitory immune response in a mouse model of bilateral BC. In addition, Cryo + PD-1 mAb combination therapy significantly improved the immunosuppressive state of tumors and enhanced the Cryo-induced immune response, resulting in slower growth and significantly longer survival of distant tumors in the combined treatment group of mice.

The mechanisms underlying Cryo treatment of malignant tumors include [5,13,14] (i) direct damage: low temperature (the tip temperature can be rapidly reduced to −175 °C) causes cell lysis, protein denaturation or inactivation; (ii) indirect damage: low temperature causes microvascular constriction in tumor tissue, which leads to the formation of thrombi and causes ischemic necrosis of tumor cells; and (iii) immune activation. Following cryoablation, tumor fragments can act as a ‘in situ tumor vaccine’ by promoting T cell proliferation and thereby boosting the body’s anticancer immune response, according to recent basic research [15–17]. However, the immune response that Cryo induces is thought to be insufficient to eliminate solid tumors, and regression of metastatic lesions after Cryo of several cancers has been reported infrequently [18,19], and the underlying processes are still unknown. In the present study, we assessed the intensity of Cryo-elicited antitumor immune responses by establishing a bilateral mammary in situ tumor model in Balb/C mice and examined the percentages of various types of TILs in distant tumors at different time points after Cryo. We observed a significant increase in the percentage of CD4⁺ and CD8⁺ T lymphocytes and a significant decrease in immunosuppressive-like cells MDSC and Treg on Day 3 after Cryo, along with a significant upregulation of the relative mRNA expression level of the Th1-type cytokine TNF-α, suggesting that the organism mainly exhibited antitumor immunity in the early stage after Cryo. However, the percentage of CD4⁺ and CD8⁺ T-lymphocytes and the relative mRNA expression levels of TNF-α began to decrease on Day 9 after Cryo. The percentage of MDSCs and Tregs and the relative expression levels of the Th2-type cytokine IL-4 increased significantly. These findings suggest that Cryo alone produces only a modest suppressive effect on distant tumors and that this immune response is temporary and has minimal impact on the regression of distant malignancies.

PD-1 is expressed on the membrane surface of various immune cells, and PD-L1 is often expressed on the membrane surface of various tumor cells [20,21]. The PD-1/PD-L1 pathway negatively regulates antigen receptor signaling in immune cells such as T cells, suppresses the inflammatory response of the body’s immune system and promotes the development of tumor immune tolerance [22–24]. However, little is known about its role in Cryo. In the TIME, antitumor immune responses induce PD-1/PD-L1 expression, further enhancing tumor immune tolerance [12,25,26]. TILs release Th1-type cytokines such TNF- and IL-12 when they detect tumor-specific antigens provided by tumor cells, which increases the expression of PD-L1 on tumor cells [27,28]. It has also been reported that the increase in both immunosuppressive Treg cells and MDSCs in the TIME is closely associated with the upregulation of PD-1/PD-L1 expression [29,30]. Our results confirmed the upregulation of PD-1 and PD-L1 signals in distant tumor tissues on Day 9 after Cryo, which was closely related to the immunosuppressive state in the TIME at the late stage of Cryo but also created conditions for the combination of Cryo with PD-1 inhibitors for the treatment of BC.

Although PD-1/PD-L1 blockade medicines have made significant strides in the treatment of cancer, the efficacy of these inhibitors is closely related to the preexisting antitumor immune response. Therefore, investigators have developed many combination therapeutic strategies. Sengedorj et al. [31] found that when hyperthermia was combined with radiotherapy, it altered the immunephenotype of BC cells and upregulated immunosuppressive immune checkpoint molecules (ICMs) such as PD-L1, PD-L2 and HVEM. Therefore, the authors concluded that the combination of hyperthermia, radiotherapy and immune checkpoint inhibitors (ICIs) is beneficial for tumor patients. However, this also suggests that we should also check the expression of other ICMs besides PD-1/PD-L1 in future studies. Meng et al. [32] used Cryo to eradicate a metastatic lesion in the left lung of a tumor patient and then combined it with pembrolizumab, discovering that that all other metastatic lesions in the lungs disappeared at the end of treatment. Unfortunately, our study did not examine the effect of the combination treatment regimen on metastatic lesions in the lungs of mice. In mouse liver cancer model experiments, MWA combined with PD-1 inhibitors showed inhibition of distant tumors, i.e., a distant compartment effect; survival time was significantly longer in the combination group than in the single treatment groups; in addition, elevated Th1-type cytokines and elevated numbers of splenic tumor antigen-specific T lymphocytes were observed in peripheral blood. In the re-attack assay, tumorigenesis was reduced, and tumor formation time was prolonged in the combination group [28]. Our results demonstrate that combination treatment significantly slows the growth of distant tumors and improves the survival of tumor-bearing mice. Mice in the combination treatment group had a more sustained antitumor immune response, with a higher proportion of CD8⁺ T and CD4⁺ T cells and a lower proportion of immunosuppressive-like MDSCs and Tregs and elevated expression levels of Th1-type immune-related cytokines and decreased Th2-type immune-related cytokines. This result suggests that Cryo in BC creates opportunities for PD-1 blockade therapy, while PD-1 blockade therapy can further enhance the immune response of TILs activated by Cryo, thus exerting a synergistic antitumor effect.

In addition to blockade therapy with ICIs, various immunotherapies should be combined with Cryo to produce powerful synergistic antitumor effects. Li et al. [33] treated rat xenogeneic glioblastoma with cryo and IL-12 and discovered that the combination significantly increased the number of CDllc + dendritic cells and significantly slowed the growth of the tumor; cytokine INF-γ expression levels were also significantly increased. The five-year recurrence-free survival rate for basal cell carcinoma patients receiving imiquimod (a TLR7/8 agonist) and Cryo was 91% [34]. In a mouse model of prostate cancer, Benzon et al. [11] discovered that the combination of Cryo and CTLA-4 mAb delayed the growth of the untreated distant tumors in mice by 14.8 days and significantly improved survival compared to Cryo alone, suggesting that the combination therapy enhanced the antitumor immunity. Of course, which immunomodulators are more effective in combination with Cryo in the treatment of different types of tumors remains to be further explored.

5. Conclusions

Combining Cryo and the PD-1 mAb has several potential benefits. First of all, Cryo has been widely used in the treatment of tumors [32], allowing researchers to investigate its role in novel combination treatment strategies. Besides, Compared with thermal ablation, Cryo can preserve tumor antigenic activity to the greatest extent, which can stimulate the antitumor immune response more effectively and even induce the ‘distant effect’. Last but not least, clinical trials of PD-1 mAb treatment of BC have yielded promising results [35]. According to a study [36], immune checkpoint blockade therapy is now the most common kind of cancer immunotherapy and is probably going to become a standard therapy for solid tumors, including BC. Therefore, these results and our study support the combination of ICIs with more traditional therapies such as Cryo to achieve optimal clinical outcomes.

Ethical approval

The study was approved by the ethics committee of The Affiliated Suzhou Hospital of Nanjing Medical University.

Author contributions

Substantial contributions to conception and design: Z.-P.Y., X.-W.S., Y.-P.H., J.G. and Y.J.; acquisition of data: Z.-P.Y., X.-W.S., Y.-P.H.; analysis and interpretation of data: Z.-P.Y., Y.-P.H., J.G. and Y.J.; drafting and revision of the article: Z.-P.Y. and Y.J. All authors have read and agreed to the published version of the manuscript.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

Research data can be obtained from the corresponding authors upon reasonable request.

Additional information

Funding

This study was funded by the Suzhou Medical and health application technology innovation project (grant numbers SKJYD2021086), Suzhou Basic Research Application (grant numbers SYSD2020080), Maternal and child health scientific research project of Jiangsu Province (grant numbers FYX202019).