Exosomal miR-133a-3p promotes the growth and metastasis of lung cancer cells following incomplete microwave ablation

Abstract

Purpose

Exosomal miRNAs play key roles in various biological processes such as cell proliferation, angiogenesis, migration and invasion. We explored whether exosomal miRNAs can promote local recurrence (LR) of lung tumors following incomplete microwave ablation (MWA) therapy.

Methods

Exosomal miRNA profiles before and after incomplete MWA in lung cancer (LC) patients with LR (n = 3) were sequenced and compared. The differentially expressed miRNAs of interest were validated in clinical samples (n = 10) and MWA-treated cells using RT-qPCR analysis. Target genes of the miRNAs were predicted and validated. The biological functions of miRNAs in proliferation, angiogenesis and metastasis of A549 cells were evaluated in vitro and in vivo.

Results

A total of 270 miRNAs (243 upregulated and 27 downregulated) were differentially expressed after incomplete MWA in patients with local recurrence. Upregulation of miR-133a-3p after MWA was validated in the cells and clinical samples. Cell functional experiments suggested that miR-133a-3p overexpression derived from serum exosomes increased cell viability, migration and invasion ability, tube formation activity and proliferation of A549 cells. Sirtuin 1 (SIRT1) was identified as a target gene for miR-133a-3p. Moreover, miR-133a-3p delivered by exosomes significantly promoted tumor growth, paralleled by reduced SIRT1 expression in a subcutaneous tumorigenesis animal model and increased the number of lung nodules by tail vein metastasis in vivo.

Conclusion

Exosomal miR-133a-3p overexpression promoted tumor growth and metastasis following MWA and could be a promising biomarker for LC recurrence after incomplete MWA.

Keywords:

• Lung cancer
• microwave ablation
• exosomal miRNA
• migrative and invasive ability
• tube formation activity
• subcutaneous tumorigenesis animal model

Introduction

LC is a common malignancy in males and females, characterized by high morbidity and mortality. In recent years, its incidence and the number of LC-related deaths has increased globally, with approximately 2 million individuals diagnosed with and 1.76 million deaths caused by LCs in 2021 [1]. Despite improvements in the five-year survival rate of LC from 15.6% in 2011 to 19.4% in 2019 [2], the treatment of LCs remains a challenge.

Image-guided thermal ablation is a newly developed treatment option for cancers, in recent decades. This technology is aimed at inducing necrosis of tumor tissues using a high temperature, such as radiofrequency (RFA) and microwave ablation (MWA). Studies have shown that ablation therapy is a safe and effective alternative for inoperable primary and metastatic tumors [3–5]. MWA is superior to RFA because of its higher temperature and shorter treatment time [6] and has been widely applied for the treatment of lung tumors and metastases [7–10]. However, the insufficient tumor ablation and high LR rate remain challenges of MWA therapy. Healey et al. reported a lung tumor recurrence rate following MWA of more than 30% over a two-year follow-up period [11]. Thus, suppressing the LR of LC following MWA is imperative.

Exosomes are extracellular vesicles present in various bodily fluids. Exosomes carrying nucleic acids, such as miRNAs, are released from cancer, immune or mesenchymal cells and envelop the integrated content of donor cells [12]. miRNA-carrying exosomes play a crucial role in cell proliferation, angiogenesis, migration and invasion-related biological processes [13,14]. Exosomal miRNAs serve as noninvasive biomarkers for the diagnosis and treatment of LC [15,16]. Whether exosomal miRNAs are involved in the enhanced tumor growth, invasion and metastasis of residual LC is unclear.

Therefore, we performed exosomal miRNA profiling before and after incomplete MWA in LC patients. Differentially expressed (DE) miRNAs were screened and validated in clinical samples and cell models. The relevance of exosomal miRNAs of interest in local tumor recurrence following ablation was explored. This study may provide a new perspective for understanding the mechanism underlying LR of lung tumors following MWA. Our findings may shed light on the improvement in outcomes in LC patients following MWA.

Materials and methods

Subjects

Ten patients with LC were recruited from Shandong Provincial Hospital between June 2017 and July 2020. Basic patient information is provided in Supplemental Table 1. LC was diagnosed based on pathological examination and clinical evidence. All patients underwent MWA, followed by LR. Blood samples were collected before and after ablation. This study was approved by the Ethics Committee of Shandong Provincial Hospital and conducted in accordance with the guidelines of the Declaration of Helsinki. Informed consent was obtained from all patients.

Exosome isolation

Exosomes were extracted from blood samples by ultracentrifugation. Briefly, whole blood samples were centrifuged at 2000 g for 15 min and 10,000 g for 30 min, followed by two cycles of 120,000 g centrifugation for 70 min. The precipitate was then collected and purified. Finally, the exosome-containing pellets were resuspended in phosphate buffer saline (PBS) and stored at −80 °C. Exosomes were identified by electron micrograph analysis and western blot.

Small RNA sequencing

Total RNAs was isolated from three paired exosome samples before and after ablation treatment using the TRIzol protocol. RNA was fractionated, and fragments of 18–40 nt were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). RNA fragments were then ligated with 3′ and 5′ adaptors, and the ligation products were reverse transcribed, followed by PCR amplification. The quality and quantity of the small RNA libraries were assessed using an Agilent 2100 Bioanalyzer and ABI StepOnePlus Real-Time PCR System, respectively. Small RNA sequencing was performed using the Illumina HiSeq platform. The raw data were filtered by removing reads with low quality, and the clean reads were mapped to miRBase, non-coding RNA in the GenBank and Rfam databases. The differentially expressed miRNAs were analyzed by PossionDis algorithm with a cutoff value of |log2(Fold Change)| > 1 and p value <.05.

Cell culture

Human LC A549 cells and human umbilical vein endothelial cells (HUVEC) were applied, (Cell Bank of the Chinese Academy of Sciences, Shanghai, China). A549 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37 °C under 5% CO₂ incubator overnight. HUVEC were maintained in PriCells Medium supplemented with 10% FBS, 1% penicillin-streptomycin and PriCells Supplement.

Incomplete MWA treatment in vitro

To mimic incomplete MWA treatment in vitro, A549 cells were routinely cultured overnight and then maintained at 45 °C, 47 °C and 50 °C for 10 min. Cell viability and migration ability of cells after treatment at 45 °C and 47 °C for 10 min were detected using CCK8 and transwell assays, respectively.

CCK8 assay

Cell viability was evaluated using the Cell Counting Kit-8 (HY K0301, MCE, USA), according to the manufacturer’s protocol. Cells in logarithmic growth phase of different treatment groups were digested with trypsin and then suspended in complete medium. Cells (2000 cells/well) were plated in 96-well plates and cultured for 24, 48, 72 and 96 h. For culture termination, 10 μL CCK-8 solution (5 mg/mL) was added to each well for 4 h. Optical density (OD) of cell culture was measured at 450 nm using a Tecan F50 microplate reader (Tecan, Mannedorf, Switzerland).

RT-qPCR analysis

The expression levels of DE miRNAs in clinical samples were detected by RT-qPCR. Serum exosomes were extracted from 10 patients before and after the ablation treatment. Total RNA from 10 paired exosome samples was extracted using TRIzol reagent (Beijing ComWin Biotech Co., Ltd., Beijing, China). The RT reaction was performed with 1 µg RNA as a template, according to the recommended procedures of the HiFiScript cDNA kit (Ruibo Biotechnology Co., Ltd., Guangdong, China). The expression of miRNAs was amplified using real-time PCR analysis. PCR was performed as follows:95 °C for 10 min, followed by 40 cycles of 95 °C for 2 s, 60 °C for 20 s and 70 °C for 10 s. Specific primers for miR-133a-3p, miR-3605-3p, miR-455-3p, miR-584-5p and miR-629-3p were synthesized by Beijing Genomics Institute (Beijing, China) (Table 1). Finally, the expression of target miRNAs was quantified using 2-ΔΔCt method with U6 as the internal reference.

Table 1. The primer sequences for RT-qPCR analysis.

Target	Primer for RT	Forward	Reverse
hsa-miR-133a-3p	5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGCTG3′	5′GCGTTTGGTCCCCTTCAAC3′	AGTGCAGGGTCCGAGGTATT
hsa-miR-3605-3p	5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTAGAG3′	5′CGCCTCCGTGTTACCTGTC3′	AGTGCAGGGTCCGAGGTATT
hsa-miR-455-3p	5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTGTAT3′	5′CGGCAGTCCATGGGCAT3′	AGTGCAGGGTCCGAGGTATT
hsa-miR-584-5p	5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCAGT3′	5′GCGTTATGGTTTGCCTGGG3′	AGTGCAGGGTCCGAGGTATT
hsa-miR-629-3p	5′GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCTGGG3′	5′GCGGTTCTCCCAACGTAAG3′	AGTGCAGGGTCCGAGGTATT
U6	5′CGCTTCACGAATTTGCGTGTCAT3′	5′CTCGCTTCGGCAGCACATA3′	5′CGCTTCACGAATTTGCGTG3′

Cell transfection

miR133a-3p, miR445-3p, miR584-5p, miR629-3p and miR3605-3p sequences were synthesized and inserted into the PCDH-CMV-MCS-EF1-copGFP-T2A-puro (pCDH) lentiviral vector [17]. The recombinant vectors were transfected into A549 cells using Lipofectamine 2000 (Invitrogen, USA), according to the manufacturer’s protocol. A549 cells transfected with the pCDH-miRNA negative control vector was used as negative control (NC).

Exosome labeling and co-incubation

Exosomes were isolated from the A549 cell supernatant by ultracentrifugation and labeled using the PKH67 kit (Sigma-Aldrich) according to the manufacturer’s instructions. Labeled exosomes were co-cultured with A549 cells for 4, 8 and 16 h. After co-incubation, cells were fixed with paraformaldehyde for 15 min and permeabilized with 0.5% Triton X-100. Subsequently, cells were stained with DAPI and observed under a fluorescence microscope.

Cell scratch assay

Cells were incubated in 24-well plates at 2.5 × 10⁵ cells/well for 24 h. When cells grew to 100% confluence, they were scratched with 100 µL pipettor tips. After the scratched cells were washed three times with PBS, they were incubated in serum-free medium at 37 °C under 5% CO₂. The wound healing area was observed at 24 h and 48 h post-incubation. ImageJ software was used for quantitative analysis.

Transwell assay

The migratory and invasive abilities of the cells were assessed using a transwell kit (3422 Corning, NY, USA). After treatment, the cell suspension (5 × 10⁵ cells/mL) was seeded in the upper chambers of 24-well transwell plates coated with Matrigel. The lower-chambers were filled with complete medium containing 30% FBS. Cells were maintained at 37 °C for 24 h. Afterwards, the non-migratory or noninvasive cells were wiped out, and remaining cells were stained with 0.1% crystal violet for 5 min. Migrating and invasive cells were captured using a CKX-51 microscope (Olympus, Tokyo, Japan) and counted using ImageJ software.

Tube formation assay

A549 cells transfected with pCDH-miRNA NC or pCDH-miR133a-3p vectors were cultured in a complete medium. When grown to 50–60% confluence, cells were further maintained in serum-free medium for 48 h, followed by exosome extraction. Similarly, exosomes (MWA-Exo) were isolated from A549 cells subjected to MWA treatment. HUVECs were grown with complete adherence in six-well plates and then co-cultured with miRNA-NC-Exo, miR-133a-3p-OE-Exo and MWA-Exo for 48 h. Next, HUVECs were digested and the cell suspension (2 × 10⁵ cells/well) was incubated in a Matrigel-coated 24-well plate for 24 h at 37 °C. Tube formation in the different groups was observed under a microscope.

EdU (5-ethynyl-2′-deoxyuridine) assay

Cell proliferation following treatment was evaluated using the kFluor488Click-iT EdU kit (Jiangsu KGI Biotechnology Co., Ltd., Jiangsu, China). In brief, A549 cells were seeded in 12-well plates and incubated with 250 μL of 2 × EdU working solution for 24 h at 37 °C. After fixation and permeation, the cells were incubated with 500 μL of the Click-iT reaction mixture for 30 min in the dark. Subsequently, the cells were washed and retained in 500 μL of Hoechst33342 working solution for 15 min at room temperature. Finally, cell proliferation images were captured using a fluorescence microscope.

MiR-133a-3p target gene prediction and dual-luciferase report assay

Target interactions between miR-133a-3p and SIRT1 were predicted using miRWalk 2.0, combined with microt4, miRanda, mirbridge, miRDB, miRMap, miRNAMap, Pictar2, PITA, RNA22, RNAhybrid and Targetscan. SIRT1 3′ UTR fragments containing the miR-133a-3p binding sequence (WT) or the mutant sequence were amplified and cloned into the psicheck2 vector. The recombinant vectors with miR-133a-3p mimics or negative control (NC mimics) were co-transfected into HEK293T cells using Lipofectamine 2000. Luciferase activity was detected using the Dual-Luciferase Reporter Assay System (E1910).

Prediction of the target genes of miR-133a-3p

The target genes of miR-133a-3p were predicted using the miRWalk, Microt4, miRanda, mirbridge, miRDB, miRMap, miRNAMap, Pictar2, PITA, RNA22, RNAhybrid and TargetScan online tools. Target genes retrieved from seven or more databases were collected. TSGene is a literature-based web resource for tumor suppressor genes (TSGs) [18], which records information on 1217 human TSGs (including 1018 genes and 199 lncRNAs). TSGs in solid tumor tissues were predicted using TSGene v2.0. Candidate target genes of miR-133a-3p were screened by overlapping them with TSGs.

Western blot assay

A549 cells were transfected with mimics-NC and PCDH-miR-133-3p for 72 h, and cell proteins were isolated using lysis buffer. Protein samples (20 µg) were separated by 10% SDS-PAGE and transferred onto PVDF membranes. After membranes were blocked with 5% skim milk, immune blots were developed using primary antibodies against Septin 4 (1:1000, Abclonal), SIRT1 (1:1000, CST) and GAPDH (1:5000, Proteintech) and secondary HRP goat anti-rabbit/mouse IgG antibodies (1:5000, Abclonal). The target proteins were visualized using an ECL system.

Subcutaneous tumorigenesis animal model

Animal experiments were performed in accordance with the guidelines of Animal Care and Use. Twenty female nude mice aged six to eight weeks were subjected to subcutaneous tumorigenesis animal model construction by injecting A549 cells (1 × 10⁷/mL, 100 µL/mouse) into the right hind legs. When tumor volume grew to 80–100 mm³, mice were randomly assigned to four groups (n = 5 per group): control, MWA, MWA + Exo-nc and MWA + Exo-miR-133a-3p groups. Animals in the MWA, MWA + Exo-nc and MWA + Exo-miR-133a-3p groups were treated with MWA (10 W, 2 min/mouse) with the implementation of MTC-3C microwave ablation therapy instrument (Nanjing Vikings Jiuzhou Medical Device Research and Development Center, Nanjing, China). In addition, the MWA + Exo-nc and MWA + Exo-miR-133a-3p groups were intravenously injected with negative control exosomes and miR-133a-3p-exosomes (100 µL/mouse) via tail veins after MWA therapy. The control group was injected with the same dose of PBS. All animals were treated once every alternate day for 20 consecutive days. During the treatment period, the body weight and tumor volume of the mice were recorded once a week. Finally, all mice were sacrificed, and the tumor was isolated.

Tail vein metastasis assay

Fifteen female nude mice (age: six to eight weeks) were used to construct a tumor metastasis model. Each animal was injected with 100 µL of A549 cells (5 × 10⁶ cells/mL) via the tail vein. After two weeks, all mice were randomly divided into three groups (n = 5 per group) and treated with PBS (control group), exosomes with miR-133a-3p overexpression (Exo-miR-133a-3p group) and negative control (Exo-nc group) via tail vein injection at 1 µg/g every two days for 20 days. The body weights of the mice were recorded once a week after inoculation. After eight weeks, the mice were sacrificed and the number of lung nodules was determined. Briefly, after the mice were sacrificed, the lung tissues were fixed in Bouin fixative solution (saturated picric acid: formaldehyde: acetic acid ice = 70 :  25 :  5) for 24 h and then soaked in anhydrous ethanol for decolorization. The number of pulmonary metastatic nodules was counted under the anatomical microscope for classification. The formula is as follows: The total number of metastatic nodules on the lung surface = I × 1 + II × 2 + III × 3 + IV × 4(according to the diameter, pulmonary nodules can be divided into FOUR grades: I < 0. 5 mm, 0. 5 mm ≤ II < 1.0 mm, 1.0 mm ≤ III ≤2.0 mm and IV > 2.0 mm).

Statistical analysis

Continuous data are presented as mean ± standard deviation (SD). Differences between groups were compared using the non-paired t-test, and the multi-group comparison was achieved using one-way ANOVA followed by Tukey’s test. All statistical analyses were performed using GraphPad Prism 8.0. Statistical significance was set at p < .05.

Results

Exosome identification

Serum exosomes were isolated from blood samples of three patients before and after ablation therapy. Electron microscopy revealed that the isolated exosomes had a cup-shaped structure (Figure 1(A)). The size of the spherical vesicles ranged from 30 to 200 nm in diameter with a peak at 144.4 nm (Figure 1(B)). Exosome marker proteins such as CB81, CD63 and HSP70 were detected using western blot analysis. Results showed that the exosome samples showed positive expression of CB81, CD63 and HSP70 (Figure 1(C)). These results indicated that the isolated vesicles were consistent with the characteristics of exosomes. Thus, exosomes were successfully isolated.

Figure 1. Characteristics of isolated exosomes. Serum exosomes were isolated from LC patients with recurrence before and after microwave ablation (MWA). (A) Electron micrograph observation. (B) Size distribution of the exosomes. (C) Western blot for exosome markers of CD81, CD63 and HSP70. The isolated vesicles were consistent with the characteristics of exosomes, indicating that exosomes were successfully isolated.

MiRNA signatures in serum exosomes of LC patients before and after ablation

To decipher the expression profiles of miRNAs in the serum exosomes of patients with LR following MWA, miRNA-seq was performed. The expression levels of miRNAs in LC patients before ablation were compared with those after ablation (Figure 2(A)). A total of 270 proteins exhibited significantly altered expression profiles after ablation compared to those before ablation, among which 243 were upregulated and 27 were downregulated by ablation, providing a relative distinction of samples before and after ablation (Figure 2(B)). The differential expression of the five miRNAs of interest was validated in 10 paired serum exosome samples from LC patients before and after ablation by RT-qPCR analysis. As depicted in Figure 2(C), miR-133a-3p was significantly overexpressed, whereas miR-3605-3p and miR-455-3p were de-expressed after ablation (p < .05), which was consistent with the miRNA-seq results. In contrast, a reverse expression pattern was observed for miR-629-3p and miR-584-5p. A549 cells were transfected with pCDH-miRNAs for 24, 48, 72 and 96 h. The role of the five miRNAs in cell viability was measured by CCK8 assay. The results suggested that compared with that with negative controls, cell viability was obviously elevated after transfection with pCDH-miR-133a-3p and pCDH-miR-3605-3p (p < .05), while no significant changes were observed in cell viability after overexpression of miR-455-3p, miR-584-5p and miR-629-3p (p > .05, Figure 2(D)). As mentioned above, miR-133a-3p was screened for further analyses.

Figure 2. Identification of differentially expressed (DE) miRNAs and verification. (A) Volcano plot of DE miRNAs in exosomes after ablation compared with that before ablation by small RNA sequencing. (B) Heat map of DE miRNAs. (C) RT-qPCR analysis of five miRNAs in clinical exosome samples before and after ablation. *p<.05. (D) CCK8 assay for A549 cell viability after transfection with pCDH-miR-133a-3p, miR-455-3p, miR-584-5p, miR-629-3p,miR-3605-3p or miRNA NC vectors. Then, miR-133a-3p was screened for further analyses.

Decreased survival rate and enhanced migration of LC cells after MWA treatment in vitro

To determine the treatment temperature and duration of MWA in vitro, A549 cells were maintained at 45 °C, 47 °C and 50 °C for 10 min. After treatment, the light microscope assay showed that compared with controls, the cells were almost dead in the 50 °C treatment group, and the cell survival rates in 45 °C and 47 °C treatment groups were approximately 60% and 30%, respectively (Figure 3(A)). Then, survival cells after treatment of 45 °C and 47 °C for 10 min were collected for CCK8 and migration test. The results suggested that the cell viability in the 45 °C treatment group was comparable to that of the controls, whereas cell viability was remarkably reduced at 47 °C (p < .05, Figure 3(B)). Cell migration ability was elevated when treated at 45 °C (p < .05, Figure 3(C)). Therefore, cell ablation in vitro was performed at 45 °C for 10 min in the following studies.

Figure 3. The condition of microwave ablation (MWA) in A549 cell determination in vitro. To simulate MWA in vitro, A549 cells were treated with temperature gradients (45 °C, 47 °C and 50 °C) for 10 min. (A) Light microscopy assay for cell observation (bar = 100 µm, magnification × 100). The cells were almost dead in the 50 °C treatment group. So, survival cells after treatment of 45 °C and 47 °C for 10 min were collected for CCK8 and migration test. (B) CCK8 assay for cell viability after treatment at 45 °C and 47 °C for 10 min. (C) Transwell assay for detection of cell migration ability at 45 °C and 47 °C. Untreated cells were used as controls. Bar = 50 µm, magnification, 200×. *p<.05. The cell viability in the 45 °C treatment group was comparable to that of the controls. Therefore, cell ablation in vitro was performed at 45 °C for 10 min in the following studies.

Exosomal miR-133a-3p overexpression increased the growth and metastasis of A549 cells

Exosomes were extracted from A549 cell culture-conditioned supernatant transfected with pCDH-miR-133a-3p and negative control. The expression of miR-133a-3p was remarkably increased in the miR-133a-3p-OE-Exo group, indicating high transfection efficiency (Figure 4(A)). Then, PKH26 labeled exosomes were co-cultured with A549 cells and internalization was observed at 0, 4, 8 and 16 h post co-incubation. Cell supernatant-derived exosomes were internalized by recipient A549 in a time-dependent manner (Figure 4(B)). To explore the effect of exosomal miR-133a-3p on the function of A549 cells, exosomes were isolated from A549 cells transfected with pCDH-miR-133a-3p (miR-133a-3p-OE-exo), pCDH-mRNA-NC (miRNA-NC-exo) or MWA-treated cells (MWA-exo), followed by co-incubation with A549 cells. In the control group (CON), 100 µL of PBS was added to the A549 cell culture. The CCK8 assay showed that cell viability in the miR-133a-3p-OE-exo group was significantly higher than that in the miRNA-NC-exo group (p < .05). A549 cells co-cultured with MWA-exo exhibited cell viability comparable to that of cells incubated with miRNA-NC-exo (p > .05). There was no significant difference in cell viability between the CON and miRNA-NC-exo groups (p > .05; Figure 4(C)). Similarly, migratory and invasive abilities of A549 cells were significantly enhanced after co-incubation with miR-133a-3p-OE-exo and MWA-exo compared to those of the miRNA-NC-exo group (p < .05), as reflected by the increased number of migrating and invading cells in the transwell assay (Figure 4(D)) and enhanced wound healing ability (Figure 4(E)). In addition, miR-133a-3p-OE-exo treatment markedly promoted the tube-forming ability and proliferation of A549 cells, compared to miRNA-NC-exo treatment (p < .05, Figure 4(F,G)). These results suggest that the overexpression of exosomal miR-133a-3p is positively associated with the growth and metastasis of LC cells.

Figure 4. Effect of miR-133a-3p overexpression on proliferation, invasion and migration of A549 cells. A549 cells were transfected with pCDH-miR-133a-3p and the negative control, then, exosomes were isolated from the A549 cell culture supernatant. (A) RT-qPCR analysis of the miR-133a-3p expression in exosomes derived from A549 cell supernatants. miR-133a-3p was highly expressed in the miR-133a-3p-OE-Exo group, indicating high transfection efficiency. (B) PKH26-labeled exosomes were co-incubated with A549 cells for exosome uptake analysis. Cell supernatant-derived exosomes were internalized by recipient A549 in a time-dependent manner (blue in the merge). (C) CCK8 assay for A549 cells coincubated with exosomes from cells overexpressing miR-133a-3p and those subjected to MWA treatment. The cell viability in the miR-133a-3p-OE-exo group was significantly higher than that in the miRNA-NC-exo group (p <.05). (D) Transwell assay for migration and invasion ability. 200×, bar = 50 µm. (E) Cell scratch assay for A549 cell wound repair ability. 40×, bar = 100 µm. Migratory and invasive abilities of A549 cells were significantly enhanced after co-incubation with miR-133a-3p-OE-exo and MWA-exo, as reflected by the increased number of migrating and invading cells in the transwell assay and enhanced wound healing ability. (F) tube formation assay for angiopoiesis. 40×, bar = 100 µm. (G) EdU assay of cell proliferation. Bar = 20 µm. *p < .05. miR-133a-3p-OE-exo treatment markedly promoted the tube-forming ability and proliferation of A549 cells. Above results suggest that the overexpression of exosomal miR-133a-3p is positively associated with the growth and metastasis of LC cells.

SIRT1 was a target for miR-133a-3p

A total of 994 genes were predicted to be regulatory targets for miR-133a-3p, and 983 human TSGs with downregulated expression in various solid tumor tissues were downloaded from the TSGene database. Using Venn analysis, 67 overlaps were identified as candidate targets of miR-133a-3p (Figure 5(A)). SIRT1 and Septin 4 were predicted to be potential targets of miR-133a-3p, and their interactions were determined by western blot and dual-luciferase reporter assays. The protein expression level of SIRT1 was reduced in A549 cells transfected with pCDH-miR-133a-3p compared to that in cells transfected with pCDH-miRNA NC (p < .05; Figure 5(B)). In contrast, Septin 4 displayed elevated expression in cells overexpressing miR-133a-3p (p < .05; Figure 5(C)). The direct interaction between SIRT1 and miR-133a-3p was verified by dual-luciferase reporter assay. The results indicated that luciferase activity in the SIRT1 WT group was significantly reduced after transfection with miR-133a-3p mimics (p < .05, Figure 5(D)). These results indicated that SIRT1 was a direct target of miR-133a-3p.

Figure 5. Gene target of miR-133a-3p. The target genes of miR-133a-3p were predicted using 12 databases (e.g., miRWalk, Microt4 and miRanda). Tumor suppressor genes (TSGs) with downregulated expression in solid tumor tissues were predicted using TSGene v2.0. (A) TSGs as potential targets of miR-133a-3p were predicted by Venn analysis. (B) Western blot for SIRT1 expression in A549 cells overexpressing miR-133a-3p. (C), Western blot for Septin 4 expression in A549 cells overexpressing miR-133a-3p. (D) Dual-luciferase reporter assay for the interaction between miR-133a-3p and SIRT1. *p < .05.

Exosomal miR-133a-3p over expression promoted the growth and metastasis of LC cells in vivo

To explore whether miR-133a-3p overexpression could affect the growth of lung tumors after ablation in vivo, a subcutaneous tumorigenesis model was constructed, followed by ablation treatment, in which exosomes isolated from miR-133a-3p/miRNA-NC-transfected A549 cells were transplanted into the caudal vein of mice. The results indicated that there was no significant difference in body weight among the groups after intervention (p > .05). Notably, MWA significantly inhibited tumor volume and weight in the tumorigenesis model compared to that in the controls (p < .05). Exosomes transfected with miR-133a-3p and miRNA-NC facilitated tumor growth after MWA treatment, especially for exosomes with miR-133a-3p overexpression (all p < .05, Figure 6(A–D)). In addition, the protein expression of SIRT1 in tumor tissues was measured by immunohistochemical staining and quantified using a panoramic slice scanner (PANNORAMIC DESK/MIDI/250/1000, 3DHISTECH, Hungary). SIRT1 expression was significantly elevated after MWA treatment, which was reduced by exosome supplementation, especially for exosomes transfected with miR-133a-3p (all p < .05) (Figure 6(E)). Exosomes derived from A549 cells transfected with miR-133a-3p mimics (Exo-miR-133a-3p) and miRNA-NC (Exo-nc) were injected into nude mice bearing tumors via the tail vein to determine the effect of miR-133a-3p overexpression on tumor metastasis in vivo. The results revealed that the number of lung nodules and lung weight in mice injected with Exo-miR-133a-3p were significantly higher than those in the Exo-NC group (p < .05, Figure 6(F–H)). Exo-miR-133a-3p treatment increased tumor cell infiltration and metastatic lesions compared with the Exo-nc group (Figure 6(I)). These results indicated that exosomal miR-133a-3p overexpression promoted the growth and metastasis of LC cells in vivo by regulating SIRT1 expression.

Figure 6. Effect of miR-133a-3p on LC development in vivo. Nude mice were subjected to subcutaneous tumorigenesis model construction followed by MWA. Exosomes derived from miR-133a-3p/miRNA-NC-transfected A549 cells were then transplanted into the caudal vein of mice. (A) Mice in the MWA + Exo-miR-133a-3p group formed larger tumors compared to the MWA + Exo-nc and MWA groups. (B) No significant differences were observed in mouse body weight among the groups. (C) Comparison of tumor volumes. (D) Comparison of tumor weights. (E) Quantitative analysis of immunohistochemical staining for SIRT1 expression in tumors. (F) Nude mice bearing lung tumors were injected with exosomes isolated from A549 cells transfected with pCDH-miR-133-3p and pCDH-miRNA-nc. Lung size in the Exo-miR-133a-3p group was larger than that in the Exo-nc and control groups. (G) Comparison of lung nodules among the different groups. (H) Comparison of lung weights in the different groups. (I) HE staining for changes in histological lesions. Red arrows represent granulocyte infiltration, and black arrows indicate tumor cells with deformed nuclei and blurry nucleoli. Bar = 50 µm, * p <.05.

Discussion

LC remains the leading cause of cancer-related deaths worldwide, posing a substantial threat to public health and non-negligible burden on basic medical and health services. Tremendous progress has been made in the identification of effective treatment management. MWA, a newly developed noninvasive technique in recent decades, has been widely applied for LC treatment [8]. Although MWA has been determined to be a safe and effective therapeutic strategy for LC, the prognosis remains poor for LR. This study, aimed to explore the potential exosomal miRNAs that play key roles in the LR of lung tumors in patients who underwent MWA.

Exosomes of 30–150 nm in diameter are released from various cell types, including tumor cells [19]. Exosomes play a key role in the interaction between different cells and regulation of various biological processes through the transfer of cytokines miRNAs, etc [20,21]. The miRNA expression profiles of serum exosomes from a recurrent LC mouse model reflected the expression profiles of tumors [22]. Radha et al. indicated that miR-21 and miR-155 were overexpressed in recurrent tumors compared to those in primary tumors, which parallels their upregulation in serum exosomes of an animal model of tumor recurrence [23]. Exosomal miRNA signatures mirrored the pathological profile of the recurrence and metastasis of LC, which could be helpful in understanding the mechanism of LC development and metastasis.

Herein, we examined serum exosomal miRNA alterations before and after MWA in LC patients with LR following ablation therapy. It is postulated that the differential expression of miRNAs confers the recurrence of LC following MWA. Our data showed that miR-133a-3p expression was significantly upregulated in patients after MWA. Consistently, overexpression of miR-133a-3p was also determined in clinical samples and MWA-treated cells. These results revealed that miR-133a-3p may play a key role in tumor development and metastasis following MWA.

Accumulating evidence suggests that exosomal miRNAs have potential as predictive biomarkers of cancer recurrence. Exosomal miR-17-92a was highly expressed in the serum of colorectal cancer patients with recurrence and its overexpression inversely correlated with patient survival [24]. Exosomal miRNAs (such as miR-340-5p, miR-17-5p, miR-130a-3p and miR-93-5p) with differential expression in breast cancer patients with recurrence compared to those without recurrence were closely associated with tumor recurrence by logistic regression analysis [25]. Another study showed that plasma exosomal miR-451a was upregulated in non-small cell LC (NSCLC) patients with recurrence and showed significance in lymph node metastasis and prognosis of patients, which is suggested as a predictive biomarker for the recurrence of NSCLC after curative resection [26]. To our knowledge, this is the first study to explore the differential expression of exosomal miRNAs in LR patients following MWA. These results indicate that miR-133a-3p is a potential predictive biomarker for LR in LC patients following MWA.

The functions of exosomal miRNAs in cell proliferation, angiogenesis and metastasis have been studied in LC. Wu et al. reported that exosomal miR-96 isolated from H1299 cells enhanced cell proliferation by targeting LMO7 [27]. MiR-210-accumulated exosomes promoted angiogenesis by increasing PI3K, AKT and HIF-1A expression in lung adenocarcinoma cells [28]. Moreover, exosomal miR-196a-3p, miR-210-3p and miR-5100 from bone marrow-derived mesenchymal stem cells facilitate the invasion of LC cells by targeting STAT3 signaling [29]. These results revealed the tumor-promoting action of exosomal miRNAs. Consistently, our data showed that overexpression of miR-133a-3p transferred by exosomes promoted the proliferation, angiogenesis, migration and invasion of A549 cells in vitro and in vivo. Recent evidence suggests that miRNAs play a role in promoting the proliferation and migration of tumor cells in response to thermal ablation [30]. Hu et al. reported that radiofrequency ablation was effective for primary LC and lung metastases from liver cancer by normalizing the deregulated expression of tumor suppressor miRNAs and oncomiRNAs before ablation [31]. Xu et al. indicated that miR-133a-3p is downregulated in NSCLC tissues and cell lines, and its overexpression attenuates the malignant behavior of NSCLC [32]. Currently, the mechanism by which miRNAs promote the proliferation and metastasis of LC cells in response to thermal ablation is unclear. As mentioned, we speculated that the elevated expression and tumor-promoting effects of miR-133a-3p in LC recurrence might be induced by heat stress. Furthermore, SIRT1 was determined to be a target of miR-133a-3p by western blot and dual-luciferase reporter assays. SIRT1, a member of the histone deacetylase family, plays diverse roles in different tumors, depending on specific oncogenic pathways [33]. Previous evidence has shown that SIRT1 is a tumor suppressor in NSCLC, and SIRT1 overexpression suppresses NSCLC progression induced by osteopontin [34]. In addition, SIRT1, as tumor suppressor, was downregulated in K-RAS-driven NSCLC. The overexpression of SIRT1 suppressed NSCLC progression [35]. In our study, SIRT1 was retrieved as a tumor suppressor from the TSGene database, which is consistent with the previously mentioned studies. The protein expression of SIRT1 was downregulated in LC cells and in a tumor-bearing rat model after miR-133a-3p overexpression. Thus, we suggest that aberrant expression of miR-133a-3p could have a tumor-promoting effect by inhibiting SIRT1. However, further mechanistic studies are required.

Conclusion

miR-133a-3p was aberrantly overexpressed in serum exosomes of LC patients after MWA, accelerating the growth and metastasis of LC in vitro and in vivo. MiR-133a-3p exerted a tumor-promoting role in LC patients following incomplete MWA by inhibiting SIRT1. MiR-133a-3p could be a promising biomarker for the LR of lung tumors in patients following incomplete MWA. Our results may provide a new perspective for understanding the LR of LC in response to MWA. However, there were five mice in each group for in vivo experiment of this study, which was too small to be convincing. This may be a limitation of our study, and a large number of mice experiments will be needed to confirm our results in the future.

Author contributions

MM carried out the Conception and design of the research. XY and MM wrote the first draft of manuscript. YN, TZ and ZZ participated in the Acquisition of data. XY, MM, FY and GH carried out the Analysis and interpretation of data. All authors read and approved the final manuscript.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

All data generated or analyzed during this study are included in this published article.

Additional information

Funding

This work was supported by the Natural Science Foundation of Shandong Province under granted No. ZR201911040509.