Hyperthermia and cisplatin combination therapy promotes caspase-8 accumulation and activation to enhance apoptosis and pyroptosis in cancer cells

Abstract

Background

Hyperthermia can play a synergistic role with chemotherapy in combination therapy. Although the association between caspase activation, apoptosis, and pyroptosis have been published for both cisplatin (CDDP) and hyperthermia therapies independently, the interactions between these molecular pathways in combination therapy are unknown. The present study aimed to investigate the possible interactions between caspase 8 activation, apoptosis, and pyroptosis in combination therapy.

Methods

Cells were treated with CDDP (15 µg/ml), followed by hyperthermia at optimized temperature (42.5 °C) in water-bath. After combination therapy, cell viability was analyzed by CCK-8, and cell death was analyzed by Annexin-V-FITC/PI and caspases activation. Immuno-staining and co-immuno-precipitation were used to examine the interaction between p62 and caspase-8. Pyroptosis was investigated by western blotting and transmission electron microscopy. E3 ligase Cullin 3 was knockdown by siRNA. In addition, caspase-8 activation was modulated by CRISPR-Cas9 gene-editing or pharmacological inhibition.

Results

Combination therapy promoted K63-linked polyubiquitination of caspase-8 and cellular accumulation of caspase-8. In turn, polyubiquitinated caspase-8 interacted with p62 and led to the activation of caspase-3. Knockdown of the E3 ligase Cullin 3 by siRNA reduced caspase-8 polyubiquitination and activation. In addition, combination therapy induced release of the pore-forming N-terminus from gasdermins and promoted pyroptosis along with caspase-8 accumulation and activation. Knockdown of caspase-8 by CRISPR/Cas9 based gene editing reduced the sensitivity of tumor cells to apoptosis and pyroptosis.

Conclusions

Our study presented a novel mechanism in which hyperthermia synergized with chemotherapy in promoting apoptosis and pyroptosis in a caspase-8 dependent manner.

Keywords:

• Hyperthermia
• Caspase-8
• p62
• Ubiquitination
• Pyroptosis
• Cisplatin

1. Introduction

Hyperthermia is a form of physical therapy, which is usually combined with radiotherapy, chemotherapy or other programs to change the physiological state of tumors and improve the efficacy of radiotherapy and chemotherapy [1]. The term hyperthermia refers to the utilization of various physical factors (such as radio frequency, microwave, ultrasound, and laser) to elevate the temperature of tumor tissue and/or the entire body. This approach employs high temperature for tumor eradication along with its associated secondary effects in cancer treatment. Hyperthermia, combined with radiotherapy, has been successfully applied in the treatment of tumors, such as breast cancer [2] and cervical cancer [3]. In addition, hyperthermia and chemotherapy can synergistically enhance the sensitivity of tumor to chemotherapy and improve the postoperative long-term survival rate of tumor patients [4–7].

Apoptosis is a well characterized mechanism of programmed cell death (PCD) that is defined by the activation of a family of cysteine proteases known as caspases [8]. Caspase activation occurs through extrinsic and intrinsic signaling pathways [9–10]. In addition, apoptosis plays a key role in maintaining normal tissue homeostasis and preventing disease [11–14].

Protein ubiquitination is sequentially mediated by three enzymes [15–16]. E3 ubiquitin ligases are the most important because they determine the specificity and diversity of substrates [17]. Cullin3 (CUL3) is a member of the cullin ubiquitin ligase family, and the CUL3 E3 ligase complex is involved in ubiquitination of many proteins [18]. Ubiquitin is a small protein containing seven lysine sites that can be ubiquitinated. Among these ubiquitin linkages, the K48 and K63 linkages are the most abundant, accounting for approximately 80% of the total linkages in mammalian cells [19–24]. It has been reported that CUL3 interacts with death-inducing signaling complex, which promotes the ubiquitination of caspase-8 with K63-linked polyubiquitination [15]. Ubiquitinated casepase-8 can interact with p62 through its ubiquitin associated domain [15].

Pyroptosis was defined as gasdermin-mediated PCD [25]. Gasdermins are cleaved when cells are stimulated under certain conditions, releasing its N-terminal pore-forming domain. The released N-terminal domain binds to membrane lipids and perforates the cell membrane, resulting in loss of cell osmotic pressure and cell membrane rupture [26–28]. It has been reported that apoptosis and pyroptosis are intricately interconnected [29–36].

Multiple mechanisms of action for combination therapy have been identified. For example, the association between caspase activation, apoptosis, and pyroptosis with both CDDP and hyperthermia therapies have been published independently, while the links between these cell death pathways during combination therapy remain unknown. In this study, we found that hyperthermia in combination with CDDP chemotherapy promoted caspase-8 accumulation and activation, which in turn initiated both apoptosis and pyroptosis, independent of the intrinsic apoptosis pathway. Our results shed new insight into the synergizing effect of hyperthermia and chemotherapy combination.

2. Materials and methods

2.1. Cell culture

The HepG2 (Procell), RAW264.7 (ATCC) cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Basal Media, L110KJ). Culture media were supplemented with 10% fetal bovine serum (FBS, ExCell Bio, FSP500), penicillin (100 U/ml) and streptomycin (100 µg/ml) (Sangon Biotech, E607011-0500). All the cells were cultured in a 37 °C incubator with a humidified 5% CO₂ atmosphere.

2.2. Antibodies and reagents

The following antibodies and reagents used in the study were: CUL3 (rabbit; Cell Signaling Technology; 10450s), K48-linked ubiquitin (rabbit; Cell Signaling Technology; 8081s), Caspase-3 (rabbit; Cell Signaling Technology; 9662s), Gasdermin E (rabbit; Cell Signaling Technology; 19453s), Caspase-8 (rabbit; R&D Systems; AF1650), K63-linked ubiquitin (rabbit; Invitrogen; MA5-32573), SQSTM1/p62 (rabbit; Santa cruz, NBP1-48320), SQSTM1 (mouse; Abnova; H00008878-M01), Goat anti-mouse IgG(H + L)-HRP (Apexbio; K1221), Goat anti-rabbit IgG(H + L)-HRP (Apexbio; K1223), GAPDH (mouse; Proteintech; HRP-60004), Actin antibody (mouse; Proteintech; HRP-60008), Tubulin antibody (mouse; ORIGENE; TA503129), GSDMDC1(rabbit; Novus; NBP2-33422), LC3 antibody (rabbit; MBL; M186-3), MG132 (A2585), Z-VAD-FMK (A1902) were purchased from APExBio; CDDP(S1166), Rapamycin (S1039), BafA1(S8865) were purchased from Selleck.

2.3. Cell hyperthermia and chemotherapy

Cells (HepG2, RAW264.7) were treated with CDDP (15 µg/mL) overnight, then heated in a water bath at 42.5 °C for 1h in the presence of CDDP. The cells were harvested or fixed 4 h later for follow-up examination. CDDP chemotherapy or hyperthermia was performed as controls. CDDP concentration and hyperthermia temperature and duration were pre-optimized (Fresh purified water was replenished for each heat treatment in the water bath during this study).

2.4. Western blotting

Cells was collected and lysed in lysis buffer (1% triton X-100, 20 mM Hepes, 150 mM NaCl, 12.5 mM β-glycerol phosphate disodium salt, 1.5 mM MgCl₂, 2 mM EGTA). The supernatant was collected and protein concentration was assayed by Bradford method. Twenty-five µg protein from each sample was separated by SDS-PAGE and transferred onto PVDF membranes (Millipore, IPVH00010). Membranes were visualized by ECL kit (BOSTER, AR1174).

2.5. Co-IP (ubiquitination)

Adherent cells were grown in 100 mm plates, lifted off the dish by scrapping. The cells were centrifuged and pellet was resuspended in 300 µL CO-IP buffer (pH7.4 lysis buffer, NaF Aladdin S111591 10 mM, Na3VO4 Aldrich 450243-50 G 1 mM, PMSF Aladdin P105539 1 mM, PI tablet Roche 05892970001 20 µM, NEM Aladdin E100552 10 mM) on ice for 30 min. To the cleared cell lysates, 1.0 µg mouse-anti-Caspase-8 or mouse-anti-p62 was added. Immunocomplexes were allowed to form by incubation at 4 °C for 2h. Thirty µL pre-cleared protein A/G magnetic Beads (Beyotime, P2108) were added to each immunocomplexes and incubated at 4 °C overnight. The protein A/G magnetic beads were collected using manual magnetic separator and washed. The captured immunocomplexes were boiled at 95 °C for 10 min and analyzed by Western blotting with 8% SDS-PAGE.

2.6. Immunofluorescence

Cells were grown on coverslips. After treatment, cells were fixed for 30 min in 4% paraformaldehyde at room temperature (RT), then permeabilized with digitonin (100 µg/ml) (Sigma, D141) for 20 min, and blocked with 1.5% BSA for 30 min at RT. Cells were incubated with diluted primary antibodies (1:1000 in blocking buffer) at 4 °C overnight. Afterward, cells were incubated with secondary antibodies (1:400 in PBS) for 3h at RT. Cell nucleus was counterstained with 1 µg/ml DAPI (Thermo, 62248) for 15 min at RT. The coverslips were mounted on glass slides and sealed with anti-fluorescence quenching reagent. The cells were examined using a Leica (TCS SP8) confocal microscopy with a 63× oil objective.

2.7. Cell apoptosis analyses

Cells were stained with the Annexin V-FITC Apoptosis Detection Kit I (BD Biosciences, 556547) according to manufacturer’s instructions and the cells were analyzed with flow cytometry (BD FACSCalibur, USA) immediately.

2.8. Colony-formation assay

After treatment with various therapies (see 2.3. Cell hyperthermia and chemotherapy), the cells were seeded in 6-well plates (500 cells/well) and allowed to grow for 2 weeks. Then the cells were fixed with methanol for 30 min, add stained with 0.5% crystal violet at RT. After washing with PBS, the plates were photographed to observe and count the colonies.

2.9. Cell viability assay

Cell viability was measured according to the instructions of CCK-8 Kit (APExBio, K1018).

2.10. LDH release assay

LDH released into the cell culture supernatant was measure using LDH cytotoxicity assay Kit (Beyotime, C0016).

2.11. CRISPR/Cas9 knockout caspase-8 in HepG2 cells

Generation of knockout cell lines by the CRISPR/Cas9 technology was performed as described in another of manuscript [37]. Briefly, dual gRNAs were cloned into pGL3 plasmid downstream of U6 promoter. The plasmids pGL3-gRNA and pST1374-Cas9 were co-transfected in a ratio of 1:3 into cells by Lipofactamine 3000. Cells were used for further studies 36 h after transfection.

2.12. RT-PCR

Total RNA was extracted from cultured cells using RNA-easy Isolation Reagent (Vazyme, R701-02). 1 µg of total RNA from each sample was subjected to reverse transcription using the HiScript® II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme, R223) to synthesize cDNA. Real-time PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711) on a Fluorescent Quantitative PCR Detection system (BIOER, Quant Gene 9600) following the manufacturer’s instructions. All genes were assayed in triplicate to ensure reproducibility. The primers used in this study were as follows:

Table

Gene	Primer sequence (5′-3′)
GAPDH	Fwd AAGCCTGCCGGTGACTAAC Rev GTTAAAAGCAGCCCTGGTGAC
IL-1β	Fwd GAACTCAACTGTGAAATGCC Rev GTCCGTCAACTTCAAAGAAC
IL-18	Fwd AGAGGTATGGCTGTAACTAT Rev GACACTTCTCTGAAAGAATATG
TNFα	Fwd AGGCGGTGCTTGTTCCTCA Rev CCGTCAGTCTAGTAGAAGAGCTTG

2.13. Caspases activity assay

Caspase-8 and caspase-3 activity were assayed with the Caspase-8 Fluorometric Assay Kit (APExBio, K2012) and Caspase-3 Fluorometric Assay Kit (APExBio, K2007) in cell lysates.

2.14. Scanning electron microscope (SEM)

Cells were seeded at 8.5 × 10⁴ cells/mL in 12-well plates. After various treatments to the predetermined time, the cells were rinsed gently with PBS, fixed with 2-3 ml electron microscope fixative buffer (Servicebio, G1102) at RT in the dark. The morphological changes of cells undergoing pyroptosis were observed and imaged under SEM (SU8100) at 3.0 kV.

2.15. siRNAs

The siRNAs used in this study were as follows:

Table

Name	Sequences (5′-3′)	Orien tation
siHuman-CUL3-346(A)	GGUGAUGAUUAGAGACAUACU UAUGUCUCUAAUCAUCACCAU	Sense Anti-sense
siHuman-CUL3-443(B)	GAGAUCAAGUUGUACGUUAUU UAACGUACAACUUGAUCUCUU	Sense Anti-sense
siHuman-CUL3-2077(C)	GAAAGUAGACGACGACAGAAA UCUGUCGUCGUCUACUUUCUG	Sense Anti-sense
siRNA (NTC)	UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT	Sense Anti-sense

All siRNAs were synthesized by IBSBIO (Shanghai). SiHuman-CUL3-443(B) was used in the experiments if there is no specification [15].

2.16. Statistical analyses

Densitometry of immunoblots was quantified with the imageJ software. The number of punctate foci in immunofluorescence images was counted manually using the photoshop 2020 software. Data are expressed as mean ± standard deviation (SD). Statistical analyses were performed using ANOVAs. Two-tailed Student’s t-test was employed to assess differences between two groups. p ≤ 0.05 was considered statistically significant.

3. Results

3.1. Hyperthermia synergized with chemotherapy in promoting caspase-8 accumulation in cancer cells

We found CDDP alone induced caspase-8 accumulation and activation, while combination therapy further enhanced this effect in cancer cells without extrinsic apoptosis stimulation (Figure 1A). Full-length caspase-8 is 55/53 kDa (the procaspase). The 43/41 kDa (the cleaved caspases) caspase-8 is the large subunit of processed caspase-8 and the 22/20 kDa caspase-8 is the small subunit. The optimized conditions for inducing caspase-8 accumulation in cancer cells was identified as heating at 42.5 °C for 1h (Figure 1B) in the presence of 15 µg/mL CDDP (Figure 1C). Hyperthermia treatment alone induced caspase-8 accumulation but in a delayed manner (Figure 1D). These results indicate that hyperthermia synergized with chemotherapy in promoting caspase-8 accumulation without extrinsic apoptosis stimulation in cancer cells.

Figure 1. Hyperthermia synergized with chemotherapy in promoting caspase-8 accumulation in cancer cells. (A) HepG2 cells were heated at 43 °C in water-bath for indicated times in the absence or presence of CDDP. (B) HepG2 cells were heated at indicated temperatures for 1 h. (C) HepG2 cells were treated with CDDP at different concentrations in combination with hyperthermia at 42.5 °C. (D) HepG2 cells were heated at 42.5 °C for 1 h, then cultured for various times. The densitometry ratio of Western blots of caspase-8 to GAPDH was quantified (bottom panels). Data are expressed as mean ± standard deviation (SD), three independent experiments. * p < 0.05, **p < 0.01,***p < 0.001, ****p < 0.0001 by t-test. Ns: not significant, compared to control.

3.2. Combination therapy promoted apoptosis of cancer cells in correlation with caspase-8 activation

Next, caspase-8 and caspase-3 enzymatic activity in treated cancer cells were determined by substrate cleavage assay (Z-DEVD-AFC and Z-IETD-AFC respectively). In addition, caspase-8 and caspase-3 activation were determined by Western blotting. As shown in Figure 2A and B, combination therapy significantly increased the enzymatic activity and activation of caspase-8. Meanwhile, the enzymatic activity and activation of caspase-3 correlated with that of caspase-8 (Figure 2A and B). In the presence of the pan-caspase in­hibitor zVAD-fmk, the enzymatic activities of both caspase-8 and caspase-3 (Figure 2C), as well as the activation of both casepase-8 and caspase-3 (Figure 2B) were reduced. We found that combination therapy significantly increased early and late apoptosis (Figure 2D and E), as detected by Annexin V-FITC/PI. Consistently, combination therapy significantly reduced cell viability (Figure 2F). Together, these results indicate combination therapy promoted apoptosis of cancer cells in correlation with caspase-8 activation.

Figure 2. Combination therapy promoted apoptosis of cancer cells in correlation with caspase-8 activation. (A) HepG2 cells were heated at 42.5 °C for 1h in the presence of CDDP (15 µg/mL). Cells were harvested 16 h later and cell lysates were used for assay of enzymatic activities of caspase-8 and caspase-3. (B and C) Analysis of caspase-8 and caspase-3 activation (B) and enzymatic activities (C) in the presence of pan-caspase inhibitor. (D) Cells were treated as in (A), stained with Annexin V-FITC and PI, and analyzed by flow cytometry. (E) Quantification of apoptosis in (D). (F) Cells were treated as in (A), cell viability was measured by CCK-8 assay. Data are expressed as mean ± standard deviation (SD), three independent experiments. **p < 0.01, ***p < 0.001, ****p < 0.0001 by t-test.

3.3. Knockout of caspase-8 decreased the sensitivity of cancer cells to combination therapy

CRISPR/Cas9 mediated gene-editing was employed to knockout caspase-8 expression in HepG2 cells. Cas9 and gRNA encoding plasmid transfected cells were screened and single-cell cloned. PCR analysis revealed that precise genomic deletion of a fragment of caspase-8 gene occurred in cloned cells (Figure 3A). In addition, western blotting analysis of caspase-8 protein expression confirmed the successful gene-editing of caspase-8 (Figure 3B). Knockout of caspase-8 elevated cancer cell proliferation (Figure 3C and D). Moreover, knockout of caspase-8 rendered cancer cells resistance to combination therapy, as shown by CCK-8 assay (Figure 3C) and clone formation assay (Figure 3D). These results indicate that caspase-8 is at least partially implicated in apoptosis activation in combination therapy treated cancer cells.

Figure 3. Knockout of caspase-8 decreased the sensitivity of cancer cells to combination therapy. (A) Caspase-8 gene was edited by CRISPR/Cas9 in HepG2 cells. Targeted PCR of genomic DNA of two cloned caspase-8 knockout cells (Cas9-C8) showed deletion of a segment of caspase-8 gene. (B) Western blotting analysis of caspase-8 protein expression in the two cloned Cas9-C8 cells in (A). (C) WT and Cas9-C8 cells were treated with CDDP (15 µg/mL) and heated at 42.5 °C for 1 h. Cell viability was measured by CCK-8 assay. (D) Cells were treated as in (C) and clone formation assay was performed. Cells were fixed and stained with crystal violet and clone formation rate was calculated (right panel). Data are expressed as mean ± standard deviation (SD), three independent experiments. * p < 0.05, ****p < 0.0001 by t-test.

3.4. Combination therapy promoted K63-linked ubiquitination of caspase-8 and enhanced the interaction between caspase-8 and p62

Caspase-8 has been implicated in apoptosis via interacting with p62 through its ubiquitin associated domain [15]. To investigate how caspase-8 initiated apoptosis under com­bination therapy, we examined caspase-8 ubiquitination. Caspase-8 was immunoprecipitated from cell lysates and analyzed for K48 and K63-linked polyubiquitination by Western blotting. In cells treated with combination therapy, K63-linked polyubiquitination of caspase-8 increased while K48-linked polyubiquitination of caspase-8 decreased (Figure 4A). Inhi­bition of proteosome degradation with MG132 did not increase the levels of total caspase-8 or K63-linked polyubiquitination of caspase-8 (Figure 4B), indicating caspase-8 accumulation promoted by combination therapy was not due to inhibition of proteosome activity, but probably due to inhibition of an alternative protein degradation pathway: autophagy degradation (Figure 4H). Modification of autophagy in the presence of the lysosome inhibitor BafA1 or mTORC1 inhibitor rapamycin could regulate the degradation and activation of caspase-8 (Figure 4H).

Figure 4. Combination therapy increased K63-linked polyubiquitination of caspase-8 and enhanced its interaction with p62. (A) HepG2 cells were treated with combination therapy for 1 h and cultured for another 3 h. Cell lysates were used for immunoprecipitation with antibodies specific to caspase-8 and immunoblotting were performed to analyze ubiquitination. (B) Cells were treated as in (A) in the presence of 5 µM MG132 for 4 h. (C and D) Cells were transfected with siRNAs targeting CUL3 (50 nM) for 48 h. Cell lysates were subjected to immunoblotting (C) and immunoprecipitation (D). NTC, negative siRNA control. (E) The colocalization of p62 and caspase-8 proteins was examined by immunofluorescence staining and visualized under Confocal microscopy (DAPI, cell nuclei). Scale bar, 10 μm. (F) Cells were treated with combination therapy, and cell lysates were analyzed for CUL3 expression by western blotting. (G) Co-IP of caspase-8 by p62 in cells lysates. (H) Cells were treated as in (A) in the presence of 100 nM BafA1 for 10 h or 500 nM Rapamycin for 8 h, and then analyzed by immunoblotting to evaluated caspase-8 and autophagy proteins. Data are presentative of three independent experiments.

Cullin 3 (CUL3) is an E3 ligase of the Cullin-RING family involved in K63-linked polyubiquitination of caspase-8 [15,19,38]. We found CUL3 expression increased in cancer cells treated with combination therapy (Figure 4F), in agreement with increased K63-linked polyubiquitination of caspase-8 (Figure 4A). siRNA gene silencing of CUL3 inhibited caspase-8 (55/53 kDa) accumulation/activation (Figure 4C) and K63-linked polyubiquitination of caspase-8 induced by combination therapy (Figure 4D).

As caspase-8 might be degraded through autophagy as inferred from the above and p62 has a ubiquitin binding domain, we investigated the interaction between caspase-8 and p62. Confocal microscopy study indicated that combination therapy resulted in the highest colocalization of caspase-8 and p62 in cells (Figure 4E). We performed Co-immunoprecipitation (Co-IP) with p62 specific antibodies and found that combination therapy enhanced the interaction between p62 and caspase-8 (Figure 4G). Together, these results indicate combination therapy increased K63-linked polyubiquitination of caspase-8, which in turn enhances its binding to p62 and cell apoptosis.

3.5. Hyperthermia synergized with chemotherapy to promote pyroptosis of cancer cells

In addition to mediate the caspase-8/p62/caspase-3 death axis in cells treated with combination therapy, activated caspase-8 may also participate in the cleavage of gasdermins to induce pyroptosis [26,33]. We found that hyperthermia synergized with CDDP in inducing the cleavage of gasdermins, especially GSDME. The extent of gasdermin N-terminus releasing correlated with caspase-8 accumulation and activation (Figure 5A). Inhibition of caspase activity with zVAD-fmk reduced the cleavage of GSDME in cells treated with combination therapy, which correlated with reduced caspase-8 accumulation and activation (Figure 5B). In addition, knockout of casepase-8 expression by CRISPR/Cas9 reduced the cleavage of GSDME N-terminus (Figure 5C). Consistently, SEM examination revealed severe pyroptosis in cells treated with combination therapy, as shown by pores formed on cell membranes (Figure 5D). Pyroptosis has been reported to trigger the release of pro-cytokines such as IL-18 and IL-1β and cytoplasmic contents, such as lactate dehydrogenase (LDH). Indeed, we found combination therapy led to increased mRNA expression of inflammatory cytokines such as IL-1β, IL-18 and TNFα in both hepatocellular carcinoma cell line HepG2 cells and mouse monocyte cell line RAW 264.7 cells (Figure 5E). In addition, combination therapy led to increased release of LDH in wild type (WT) HepG2 cells and WT RAW264.7 cells but not in caspase-8 knockout HepG2 cells (Figure 5F). Together, these results indicate that combination therapy promotes pyroptois in a caspase-8 dependent manner.

Figure 5. Hyperthermia synergized with chemotherapy to promote caspase-8 dependent pyroptosis of cancer cells. (A) HepG2 cells were treated as indicated and cell lysates were analyzed for caspases and gasdermins by Western blotting with indicated antibodies. (B) HepG2 cells were pretreated with 40 µM pan-caspase inhibitor zVAD-fmk for 2 h and then treated with various therapies. Caspases and gasdermins were analyzed by Western blotting with antibodies as indicated. (C) WT and Caspase-8 knockout HepG2 cells were treated with various therapies and assessed as in (B). (D) HepG2 cells were treated with various therapies and pyroptosis was examined by scanning electron microscopy (SEM). Arrows indicate pores on cell membranes. Scale bar, 20 μm. (E) mRNA expression of inflammatory cytokines IL-1β, IL-18 and TNFα in HepG2 cells and RAW264.7 cells. (F) Measurement of LDH release in WT and Caspase-8 knockout HepG2 cells, and RAW264.7 cells. Data are expressed as mean ± standard deviation (SD), three independent experiments. * p < 0.05, **p < 0.01,***p < 0.001, ****p < 0.0001 compared to control; t-test.

4. Discussion

Apoptosis is important to sustain tissue homeostasis and protect against various diseases, including cancer. Caspases are a family of cysteine proteases, known as the central executioners of apoptosis [39]. In this study, we found that hyperthermia and CDDP combination therapy led to accumulation of and activation of caspase-8. CDDP treatment was a precondition for caspase-8 accumulation and activation after hyperthermia in our experiment setting. We conjectured that CDDP treatment ‘primed’ cells to accumulate caspase-8 after hyperthermia, for example, translocating caspase-8 to proximity of the E3 ligase CUL3 so that it could be ubiquitinated in a fast fashion (in merely a few hours). Nevertheless, prolonged CDDP treatment slightly increased caspase-8 accumulation, and hyperthermia alone could lead to caspase-8 accumulation when cells were analyzed 16 h after the treatment (data not shown). These observations emphasize the synergistic effect of CDDP and hyperthermia from caspase-8 accumulation and activation aspect, but we did not exclude other mechanisms of action by combination therapy.

Further investigation found combination therapy resulted in elevated K63 linked polyubiquitination of caspase-8. K63-linked polyubiquitin regulates protein function, subcellular localization, protein-protein interactions, or autophagy degradation [40–41]. Previously, it has been reported that CUL3 is a E3 ligase that conjugates K63-linked polyubiquitin to caspase-8 when death receptor ligation occurred. Although the upstream signal leading CUL3 to polyubiquitinate caspase-8 is unknown, we found that combination therapy resulted in elevated levels of CUL3 in cells (Figure 4F). CUL3 overexpression promotes ubiquitination and activation of caspase-8 [15–16], thereby promoting the apoptosis of tumor cells.

Upon caspase-8 polyubiquitination, the ubiquitin-binding protein p62 could bind to caspase-8 and promote the aggregation of caspase-8 within p62-dependent foci, which might reduce the autophagic degradation of caspase-8 and lead to accumulation and activation of caspase-8, and activation of cell apoptosis [15], i.e., the CUL3/caspase-8/p62/caspase-3 death axis. In agreement with a previous study, we not only found p62 interacted with caspase-8 by Co-IP (Figure 4G), but also found caspase-8 aggregated within p62 foci (Figure 4E) in cancer cells underwent combination therapy. Interestingly, we found that the autophagy inhibitor BA1 reduced the levels of caspase-8 in cell lysates after hyperthermia/combination therapy (Figure 4F). One possible explanation is that hyperthermia/combination therapy promoted autophagy flux thus increased p62 foci formation, which provided a platform for caspase-8 aggregation and activation without extrinsic death signaling, and vice versa.

Pyroptosis is a form of cell death that is triggered by proinflammatory signals and associated with inflammation. Pyroptosis can be activated by the caspase-1 dependent canonical pathway [42–46] and the caspase-4/-5/-11 dependent noncanonical pathway [47]. More recently, caspase-8 has been reported to activate pyroptosis when apoptosis and necroptosis are inhibited [48–49]. Here, we found caspase-8 could mediate both apoptosis and pyroptosis in cells underwent combination therapy. The difference may be reconciled by the two forms of caspase-8 found in cells treated with combination therapy: the inactive/pro-form of caspase-8 could be responsible for pyroptosis, while the active, p62 bounded caspase-8 could be responsible for apoptosis.

In the study of Shelmann et al. [50], it was found that hyperthermia could not activate caspase-8, and only CDDP activated caspase-8. In this study, the results demonstrate that the combined application of hyperthermia and chemotherapy can significantly enhance the effectiveness of chemotherapy through accumulation and activation of caspase-8, probably due to we optimized the procedure of combination therapy, where prior CDDP treatment was followed by hyperthermia. This study is based on in vitro research at the cellular level, primarily focusing on in vitro heating and chemotherapy treatment, whether prior CDDP treatment followed by hyperthermia led to better outcome in the clinics warranted investigation. Furthermore, controlled delivery of CDDP to the site of tumor to effectively ‘prime’ cancer cells for hyperthermia is a challenge. We believe more in-depth research in this aspect in the future will benefit tumor treatment with hyperthermia and chemotherapy combination therapy.

In conclusion, our research uncovered a novel mechanism of inducing cell death by hyperthermia and chemotherapy combination therapy in which hyperthermia synergized with chemotherapy to promote caspase-8 accumulation and activation to accelerate tumor cell apoptosis and pyroptosis (Figure 2D and 5A). Our finding provides further theoretical support for the implementation of hyperthermia and chemotherapy combination therapy for cancer treatment in clinical practice.

Authors’ contribution

B. P. designed the study. G. Z., J. C. and B. P. performed the experiments. Y. P. and Y. W. completed the experimental verification. B. P. and G. Z. analyzed the data, wrote the manuscript. All authors contributed in reviewing and editing the manuscript.

Acknowledgements

We thank all members of the laboratory for their support during research implementation.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

Data are available upon request.

Additional information

Funding

This work was supported by the Program for Talents and Teams of Science and Technology in Universities of Yunnan Province (202105AE160010).