Exogenous IAA enhances low potassium tolerance of sweetpotato by regulating root response strategy

ABSTRACT

Plant roots are sensitive to potassium (K⁺) deficiency signals. Therefore, regulating root growth by exogenous methods is a vital strategy to improve low K⁺ tolerance of sweetpotato. We studied the effects of exogenous indole-3-acetic acid (IAA) on growth, K⁺ absorption, and root characteristics in sweetpotato exposed to low K⁺ treatment (LK). LK significantly inhibited dry mass, K⁺ concentration and accumulation, as well as the root elongation (length) and branching (forks and crossings) in sweetpotato seedlings. However, exogenous IAA increased the length, ratio, and density of lateral roots and promoted absorption and accumulation of K⁺, which effectively alleviated the inhibitory effect of low K⁺. Exogenous IAA also increased the expression levels of auxin synthesis (IbYUC6 and IbTAR2) and transport (IbPIN1, IbPIN3, and IbPIN8) genes in leaves and roots, which promoted the increase of endogenous IAA content. Furthermore, exogenous IAA was more effective on low-K-tolerant variety (XS32) than low-K-sensitive variety (NZ1) under LK stress, depending on their different IAA synthesis and transport strategies. These results indicated that exogenous IAA enhanced root responsiveness of sweetpotato to low K⁺ stress by modulating auxin biosynthesis and transport, thereby improving the tolerance of sweetpotato to low K⁺ stress.

KEYWORDS:

• Exogenous methods
• expression analysis
• lateral root
• nutrition stress
• sweetpotato

Introduction

China is a major producer of sweetpotato (Ipomoea batatas [L.] Lam), with an area of 2.25 million ha and an annual output of 49.2 million tons, accounting for 55.0% of the global lam production (Food and Agriculture Organization FAO 2021). Sweetpotato is a typical ‘potassium (K⁺)-favoring’ crop, and soil K⁺ supply is closely related to the growth, yield and quality of sweet potato. However, in the hilly or high altitudes region in the middle and lower reaches of the Yangtze River, as well as in the red and yellow soil regions in the south of China (the main production areas of edible sweetpotato), soil K⁺ deficiency (low K⁺) is relatively severe, becoming the main factor restricting the improvement of yield and quality of sweetpotato (Wang et al. 2017; Liu et al. 2023). In view of the shortage of potassium mineral resources in China and the lack of breeding for low-K-tolerant sweetpotato varieties, enhancing low K⁺ tolerance of sweetpotato is viable option to alleviate the deficiency of K⁺ in soil production system.

Low K⁺ tolerance is a crucial feature of crop, which refers to the ability of plants to maintain normal growth or achieve higher biomass at low or critical K⁺ levels (Tang et al. 2015). There have been many studies on plant tolerance to low K⁺, among which it is believed that plant roots are most sensitive to K⁺ deficiency signal, and plant K⁺ absorption mainly depends on roots (Kellermeier et al. 2013; Guo et al. 2019). Low K⁺ stress significantly reduced the length, surface area, volume and lateral root number of rice and Arabidopsis thaliana (Ma et al. 2012; Gruber et al. 2013). However, K⁺ efficient genotypes can promote K⁺ absorption by altering root morphology and thus modifying K⁺ acquisition (Zhao et al. 2016) Under K⁺ deficiency stress, the root system of low K⁺ tolerant rice variety has a higher abundance of fine roots (Jordan-Meille et al. 2018). In previous studies, our team also screened out the different K⁺ efficiency genotypes of sweetpotato and conducted physiological studies on low K⁺ tolerance (Tang et al. 2015; Liu et al. 2017b). which provided important research materials. However, there is a lack of in-depth research on how to regulate sweetpotato root growth and configuration to adapt to low K⁺ environment.

Endogenous plant hormones regulate root growth and development, and auxin plays a key role in establishing and elaborating patterns in root meristems (Vanstraelen and Benková 2012). Auxin synthesis-related genes YUCCA and OsCOW1 are involved in regulating the occurrence of lateral roots and advents (Yamamoto et al. 2007; Woo et al. 2007), IAA degrading gene DAO affects auxin homeostasis and thus affects the growth and development of rice roots (Zhao et al. 2013). GNOM1 mutants that regulate PIN1 transport cause abnormal auxin transport, showing decreased numbers of advent and lateral roots (Kitomi et al. 2008). In addition, auxin signal transduction is an important pathway to regulate root growth and development, cell division and differentiation (Zhao et al. 2013; Xun et al. 2020). Since IAA plays an essential role in root elongation, lateral root germination, and root mitosis, the symptoms of K⁺ deficiency may be related to an alteration in IAA metabolism. A study showed that K⁺ deficiency induced ethylene production and promoted the transcription of auxin transporter genes PIN3 and PIN7 in solar cells, thus affecting auxin distribution in plant roots (Muday et al. 2012). Research on cotton found that endogenous free IAA content in the roots was reduced by more than 50% under K⁺ deficiency treatment, which significantly inhibited root length and lateral root formation (shortening of branch area) (Zhang et al. 2009). These results indicate that the development and elongation of lateral roots are affected by low K⁺ stress, resulting in changes in root structure. This plasticity is an important mechanism for plants to adapt to K⁺ deficiency conditions, and this process is closely related to the synthesis and polar transport of auxin.

Our previous studies found that exogenous hormone IAA can improve the photosynthetic capacity and antioxidant enzyme activity of sweetpotato under low potassium, reducing the ultrastructural damage of root tip cells (Liu et al. 2020). However, little attention has been paid to whether exogenous IAA regulates the change of root characteristics under low K⁺ stress and its relationship with IAA synthesis and distribution. It has been reported that when exogenous auxin (10 μmol L⁻¹) was added to tobacco under low K⁺ level, the concentration of endogenous auxin increased in the main and lateral root tips, and the total root length, the number of root tips and the number of forks increased significantly (Song et al. 2015). It provided an important reference for this research.

In this study, we focused on the root structure changes of two sweetpotato varieties with different low-K-tolerance after spraying IAA under low K⁺ stress, and measured the levels of IAA in seedling leaves and roots. In addition, we also examined the expression levels of auxin synthesis and transport genes.

Materials and methods

Plant materials and growth condition

The experiment was conducted in the greenhouse of Xuzhou Institute of Agricultural Sciences in Xuhui District, Jiangsu Province, China (34°27’N, 117°29’ E) in the summer of 2022. We used low potassium (K⁺) tolerant genotype Xushu 32 (XS32) and low K⁺ sensitive genotype Ningzishu 1(NZ1) in hydroponic culture at two different levels of K⁺ concentration. The low-K-tolerance ability of these two sweetpotato varieties has been confirmed in previous experiments (Liu et al. 2017b, 2017a).

The hydroponic system mainly consists of a 38 cm × 28 cm × 14 cm (H) plastic box with nutrient solution and a plastic lid with equidistant holes (7 cm apart). Seedlings with length of 20 ± 0.5 cm, stem diameter of 12 ~ 13 mm, 4 leaves and 3 internodes were cut from the seedling bed and pre-cultivated in clean water for 3 days. Then, each seedling was rolled up in a planting basket with sponge and placed in a hole. Twelve seedlings of the same variety were planted in each box, with with eight boxes planted for each variety. Subsequently, the modified Hoagland nutrient solution (according to Liu et al. 2017b) were added to the water and circulated through a micro water pump.

Experimental design and sampling

The experiment was designed for two varieties (XS32 and NZ1) and four treatments. Two K⁺ levels were set to 0.1 mmol L⁻¹ (LK), and 10 mmol L⁻¹ (control) using K₂SO₄. Each K⁺ level was divided into spraying and non-spraying treatments, and the four treatments were marked as follows: control, control+IAA, LK, LK+IAA. Each treatment is set up with three replication, random block designs. The exogenous IAA (Sigma-Aldrich Chemical Co. St. Louis, MO, U.S.A.) was applied to the leaves at 6:00 pm on the day the nutrient solution was added, and repeated at 8:00 am the next day. The concentration of IAA solution was 200 μmol L⁻¹, and this was based on our previous experiment (Liu et al. 2020).

Plants were sampled on the 1st, 3rd, 6th, and 9th after treatment (the samples taken on day 1 were only used for measuring gene expression), and the test was finished and sampled on the 12th day. Three seedlings were randomly selected for each treatment, divided into roots and shoots, and dried in the oven to determine dry mass. The other three plants were separated into roots and leaves. The roots were first used for scanning and analysis of root configuration, and then the roots and leaves were frozen in liquid nitrogen and stored in a −70°C refrigerator for the determination of IAA content and relative gene expression.

Plant K⁺ content and K⁺ accumulation

The dried samples were digested with H₂SO₄-H₂O₂, and the K⁺ concentration was determined by flame spectrophotometry FP6410 (Shanghai Precision Instrument Co., Ltd., Shanghai, China). K⁺ accumulation was calculated by K⁺ concentration and dry mass.

Root morphology characteristics

Use EPSON V850 PRO Scanner (EPSON(China) Co., Ltd) to scan the roots, and use the WinRHIZO Root Analysis System (Regent Instruments Inc., Quebec, Canada) to analyze the root morphology characteristics, such as root length, forks number and crossings number (Liu et al. 2023). During the course of treatments in hydroponic culture, lateral roots growing on the adventitious roots developed obviously, and the diameter of lateral roots was mostly less than 0.5 mm. Therefore, roots with diameter ≤0.5 mm were defined as lateral roots, and the length, ratio and density of lateral roots were also analyzed and calculated. Lateral root ratio was calculated by lateral root length/total root length × 100%; lateral root density was calculated by lateral root length/total root projected area.

Endogenous IAA content

IAA was quantified by Liquid Chromatograph Mass Spectrometer (LC-MS, AB SCIEX 4600), and the method was referenced and improved by Yong et al. (2017). Weighed 0.5–0.9 g of ground plant tissue, added 3.5 g anhydrous sodium sulfate and ground, made the plant tissue fully dehydrated and evenly dispersed into powder. Then, transferred the powder to a centrifugal tube, added 5 ml petroleum ether, shaken well, and centrifuged for 3 min (3000 r/min). The supernatant was discard, and the remaining residue was extracted with 4 ml, 2 ml, and 2 ml methanol in sequence according to the above method. The three extraction solutions were mixed and concentrated in a 10 mL conical scale tube to 2 mL, filtered through a 0.22 μM microporous membrane, and then 10 μL was taken out for sample analysis. The chromatography was performed on A HALO-C18 column (4.6 × 100 mm, 2.7 μm) with mobile phase A consisting of 0.5% formic acid aqueous solution and mobile phase B consisting of 0.5% formic acid acetonitrile solution. Gradient elution was performed at a flow rate of 0.5 ml min⁻¹. The column temperature was 40°C and the detection wavelength was 272 nm.

Quantitative real-time RT-PCR analysis

The relative expression analysis of the related genes, which were selected according to previous research (Li et al. 2016; Cui et al. 2017; Gao et al. 2022). An RNA extraction kit (DP432, TIANGEN) was used to isolate total RNA from root and leaf. Total RNA was reversed-transcribed into first-strand cDNA using PrimeScript^TM RT Reagent Kit (code No. RR037A, Takara) and oligo-dT. We use SYBR Premium Ex TaqTM (Code: RR420A, Takara) to conduct qRT-PCR through ABI 7300 sequencer according to the manufacturer’s protocol. The relative expression level of all genes was determined according to the 2^−△△CT method (Livak and Schmittgen 2002). ARF was the reference gene. The primers used are listed in Table 1.

Table 1. Effects of exogenous IAA on biomass of sweetpotato under different K⁺ levels.

Variety	Treatment	Shoot dry mass (g/plant)	Root dry mass (g/plant)	Total dry mass (g/plant)
XS32	Control	0.96 ± 0.04 a	0.31 ± 0.01 b	1.27 ± 0.04 b
	Control+IAA	0.99 ± 0.03 a	0.35 ± 0.01 a	1.34 ± 0.03 a
	LK	0.76 ± 0.02 c	0.23 ± 0.02 d	0.99 ± 0.02 d
	LK+IAA	0.87 ± 0.04 b	0.28 ± 0.02 c	1.15 ± 0.03 c
NZ1	Control	1.00 ± 0.04 a	0.29 ± 0.02 a	1.28 ± 0.02 b
	Control+IAA	1.03 ± 0.02 a	0.32 ± 0.02 a	1.34 ± 0.01 a
	LK	0.68 ± 0.03 c	0.18 ±0 .01 b	0.86 ± 0.03 d
	LK+IAA	0.75 ± 0.01 b	0.20 ± 0.02 b	0.95 ± 0.02 c

Data are means ± standard deviation (n = 3), means within the same column followed by different letters (a, b and c, etc.) are significantly different between treatments on the same day (P < 0.05, Duncan’s test). The same label applies to Table 3.

Table 2. Effects of exogenous IAA on K⁺ content and accumulation of sweetpotato under different K⁺ levels.

Variety	Treatment	K^+ content (%)		K^+ accumulation (mg/plant)
		Shoot	Root	Shoot	Root	Total
XS32	Control	3.25 ± 0.23 b	3.36 ± 0.09 b	31.09 ± 1.14 b	10.53 ± 0.19 b	41.62 ± 1.31 b
	Control+IAA	3.70 ± 0.29 a	4.19 ± 0.28 a	36.51 ± 0.93 a	14.67 ± 0.42 a	51.17 ± 1.23 a
	LK	2.45 ± 0.18 c	1.19 ± 0.04 c	18.70 ± 0.37 d	2.70 ± 0.08 d	21.40 ± 0.39 d
	LK+IAA	2.67 ± 0.04 c	1.28 ± 0.09 c	23.31 ± 0.97 c	3.61 ± 0.23 c	26.93 ± 0.82 c
NZ1	Control	3.06 ± 0.08 a	4.79 ± 0.34 a	30.50 ± 1.24 b	13.73 ± 1.00 a	44.23 ± 0.36 b
	Control+IAA	3.27 ± 0.15 a	4.60 ± 0.15 a	33.57 ± 0.50 a	14.57 ± 0.96 a	48.14 ± 0.46 a
	LK	1.83 ± 0.24 b	2.00 ± 0.10 b	12.50 ± 0.46 d	3.53 ± 0.12 b	16.04 ± 0.56 d
	LK+IAA	2.00 ± 0.09 b	2.04 ± 0.11 b	14.93 ± 0.12 c	4.15 ± 0.31 b	19.08 ± 0.41 c

Table 3. Sequence of primers for ARF and related genes used for qRT-PCR.

Gene name	Function classification	Forward primer	Reverse primer
ARF	Reference gene	CTTTGCCAAGAAGGAGATGC	TCTTGTCCTGACCACCAACA
IbYUC6	IAA synthesis	ACACGCATGGACTATAGGAGAG	GCCACCCCTTTCTCCTTCAA
IbTAR2	IAA synthesis	GTACCGGAAGCTGTGTTTGC	TCCGCCATGCATCAGCTTAA
IbPIN1	Auxin carrier	CCCAGAAGCAAGCAGAGGAA	CACTTGGTTGGAAGCACAGC
IbPIN3	Auxin carrier	TGGCATGATCTTTACGTCGT	GGCGACAAAACGGTTGATCC
IbPIN8	Auxin carrier	TCCCTAGCCGATGTCTACCA	GCAAGCGAGAAGTTTTTGAAGG

Statistical analysis

SPSS 20.0 program (SPSS Inc., Chicago, U.S.A.) was used to statistically process the results. The data was expressed as mean ± standard deviation (n = 3). One-way ANOVA followed by Duncan’s multiple range test (P < 0.05) were used to determine the significant differences between treatments. The figures and tables were created using Microsoft Office 2016 (Beijing, China) and Origin 2021 (OriginLab CO., U.S.A.).

Results

Exogenous IAA enhances biomass production of sweetpotato under low K⁺ stress

Potassium (K⁺) deficiency (LK) negatively affected the dry mass in the shoot and root of two sweetpotato cultivars. Compared with control, the shoot, root, and total dry mass of XS32 (tolerance to LK) under LK stress was decreased by 20.8%, 25.8%, and 22.0%, while that of NZ1 (sensitive to LK) was reduced by 32.0%, 37.9%, and 32.8%, respectively (Table 2). On the other hand, exogenous application of IAA (LK+IAA) significantly increased the dry mass of XS32 under LK stress, and the increase of shoot, root and total dry matter was by 14.5%, 21.7%, and 16.2%, respectively. LK+IAA also significantly increased the shoot (10.3%) and total dry mass (10.5%) in the LK-stressed plant of NZ1, but the increase was less than the XS32, and the effect on root dry mass was not significant. At the control level, exogenous IAA (control+IAA) could also significantly improve the root and total dry mass of XS32, but only the total dry mass of NZ1 was improved significantly.

Exogenous IAA synchronizes K⁺ content and accumulation of sweetpotato under low K⁺ stress

LK stress significantly reduced the K⁺ content and accumulation of both XS32 and NZ1. K⁺ content in the shoot and root of XS32 reduced by 24.6% and 43.5%, respectively, while by 40.2% and 58.2%, respectively, in NZ1 over control plants (Table 3). In addition, the reduction of K⁺ accumulation in the shoot, root and whole plant in XS32 was 39.9%, 74.4%, and 48.6%, respectively, while that in NZ1 was 59.0%, 74.3%, and 63.7%, respectively.

Exogenous application of IAA increased the K⁺ content in the shoot and root of the two varieties under LK stress to some extent but did not reach a significant level. In contrast, compared with LK without exogenous IAA, exogenous IAA restored the decrease of K⁺ accumulation in XS32 shoot, root, and whole plant, increasing by 24.7%, 33.7%, and 25.8%, respectively, while NZ1 showed an increase of 19.4%, 17.6%, and 19.0%, respectively. Under the control condition, the IAA application also significantly increased the K⁺ content and accumulation in both the shoot and root of XS32 compared with that of the control. However, only K⁺ accumulation in the shoot and whole plant was significantly improved by exogenous IAA for NZ1.

Exogenous IAA improves IAA content in shoot and root of sweetpotato under low K⁺ stress

Low K⁺ seriously affected the IAA content in the leaf and root of XS32, which decreased significantly from the 3rd day compared to the control (Figure 1). The difference was that the IAA content in the leaf and root of NZ1 decreased slowly from the 3rd day to the 6th day, but decreased rapidly and significantly from the 9th day. On the 12th day, the IAA content in the leaves and roots of LK-stressed plants of NZ1 significantly reduced by 44.7% and 43.2%, respectively, apparently higher than that of XS3 (20.9% and 20.1%, respectively). The application of IAA improved the IAA content in both stressed and non-stressed plants. The IAA contents were increased significantly in the leaf (10.0%) and root (9.9%) of XS32 when treated with LK+IAA compared to only LK plants on the 12th day. Similarly, exogenous IAA significantly increased the IAA content in the leaf and root of NZ1 under the LK condition, reaching 10.3 and 9.0%, respectively. However, under both LK and LK+IAA treatments, the IAA content in the leaf and root of XS32 was more than 35% higher than that of NZ1.

Figure 1. Effects of exogenous IAA on endogenous IAA content in leaves (a and b) and roots (c and d) of sweetpotato under different K⁺ levels. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Exogenous IAA ameliorates root morphology of sweetpotato under low K⁺ stress

Low K⁺ stress impaired the root morphology of sweetpotato. LK treatment resulted in a significant decrease in root length and forks number of NZ1 except on day 6, as well as crossings number (except on day 3) (Figure 2). In contrast, LK treatment also reduced the root length, forks number, and crossings number of NZ1, but significant differences were detected mainly on day 12. Moreover, the decreases in root length (16.7%), forks number (27.4%), and crossings number (29.9%) of XS32 were lower than that of NZ1 (24.4%, 51.2%, and 39.3%, respectively) on the 12th day. Exogenous IAA application to the LK-stressed plants significantly improved root length, forks number, and crossings number of XS32 from the 9th day compared with only LK treatment, and enhanced by 17.2%, 28.1%, and 38.0% on day 12, respectively. Although exogenous IAA could significantly improve the root length, forks number, and crossings number of NZ1 from the 6th day, only the improvement of forks number was significant by the 12th day (40.1%). In addition, the root length, forks number, and crossings number of NZ1 was significantly lower than that of XS32 under LK treatment.

Figure 2. Effects of exogenous IAA on total root morphology of sweetpotato under different K⁺ levels. (a and b) total root length; (c and d) root forks number; (e and f) root crossings number. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Similarly, LK stress reduced the lateral root length of the two cultivars, which was significant on the 9th and 12th days (Figure 3). And the decrease in XS32 (13.1%) was lower than that of NZ1 (19.9%) on day 12. Furthermore, the lateral root ratio and density of NZ1 also decreased under LK conditions, especially on the 9th day. However, those of XS32 showed a significant increase on the 12th day. By applying IAA, the lateral root length of LK-stressed plants of the two cultivars was significantly increased from day 9 compared to non-spraying, but the increase in NZ1 was not significant on the 12th day. In the LK condition, the application of IAA also significantly increased the ratio and density of XS32 lateral roots on the 9th and 12th day. Although exogenous IAA also increased the lateral root ratio and density of NZ1 under LK from day 6, the effect was insignificant.

Figure 3. Effects of exogenous IAA on lateral root characteristics of sweetpotato under different K⁺ levels. (a and b) lateral root length; (c and d) lateral root ratio; (e and f) lateral root density. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Exogenous IAA promotes expression levels of auxin biosynthesis genes

We analyzed the expression levels of two IAA biosynthesis genes (IbYUC6 and IbTAR2) in the leaves and roots of sweetpotato. Under LK treatment, the relative expression levels of IbYUC6 and IbTAR2 in XS32 leaves decreased significantly compared to the control except for day 1. They were also significantly decreased from day 1 to day 12 in NZ1 leaves (Figure 4). From day 1 to day 12 after applying IAA, the relative expression levels of IbYUC6 and IbTAR2 in XS32 and NZ1 leaves were significantly induced compared to LK with no IAA application. However, their induction levels in XS32 leaves were higher than in NZ1 leaves. For example, on the 12th day, the relative expression levels of IbYUC6 and IbTAR2 under LK+IAA treatment were significantly increased by 4.7 and 2.5 times compared to LK treatment, while in NZ1, they were significantly increased by 2.4 and 1.4 times, respectively.

Figure 4. Effects of exogenous IAA on expression levels of auxin biosynthesis genes of sweetpotato under different K⁺ levels. (a, b, e and f) expression of IbYUC6; (c, d, g and h) expression of IbTAR2. Data are means ± standard deviation (n = 3),different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Under LK stress, the relative expression of IbYUC6 and IbTAR2 in the roots of XS32 and NZ1 decreased to varying degrees compared to the control. The relative expression of IbYUC6 in XS32 roots decreased significantly from the 1st day to the 6th day under LK, but the difference was not significant on day 9 and day 12. However, in the roots of NZ1, the relative expression of IbYUC6 and IbTAR2 decreased significantly, mainly from day 6 to day 12. The relative expression of IbTAR2 in XS32 roots decreased at a lower rate than that of NZ1 on the 6th (30.0% with 68.8%) and 9th days (44.2% with 55.1%), while on the 12th day, it was comparable to the decrease rate of NZ1 (50%). Applying of IAA induced the expression of IbYUC6 and IbTAR2 in the roots of the two cultivars under LK condition. On day 9, IAA strongly induced the expression of IbYUC6 and IbTAR2 in LK-stressed roots, which increased significantly by 89.1% and 1.24-fold in XS32, and by 1.4-fold and 1.8-fold in NZ1, respectively. The expression of IbYUC6 and IbTAR2 were also significantly improved by IAA, but in XS32, the difference was not significant. On the 12th day, the expression levels of IbYUC6 and IbTAR2 in NZ1 roots were also significantly increased under LK+IAA treatment compared to LK treatment, but the difference was insignificant in XS32.

Exogenous IAA induces expression levels of auxin transport genes

On day 1, the relative expression levels of IbPIN1, IbPIN3, and IbPIN8 in LK-stressed leaves of XS32 significantly increased compared to the control (Figure 5). Similarly, the relative expression levels of IbPIN8 in NZ1 leaves were also significantly increased from day 1 to day 3 after LK treatment. However, with the prolongation of LK stress treatment time, the relative expression levels of IbPIN1, IbPIN3, and IbPIN8 in the two varieties decreased significantly (except for IbPIN8 in NZ1 leaves on day 12). When IAA application was subjected to LK-stressed plants, the expression of IbPIN1, IbPIN3, and IbPIN8 was significantly induced, and the increases in XS32 leaves were higher than those in NZ1. At day 12, the relative expression levels of IbPIN1, IbPIN3, and IbPIN8 in XS32 leaves treated by LK+IAA were increased by 5.0-fold, 1.4-fold, and 2.7-fold, while NZ1 showed accretion at 56.6%, 100% and 23.2%, respectively compared to only LK stressed plants.

Figure 5. Effects of exogenous IAA on expression levels of auxin transport genes in leaves of sweetpotato under different K⁺ levels. (a and b) expression of IbPIN1; (c and d) expression of IbPIN3;(e and f) expression of IbPIN8. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

LK treatment induced the expression of IbPIN1 in the roots of XS32 (on the 6th day and 9th day) and NZ1 (on the 6th day), but they were not persistent and long-lasting (Figure 6). On the 12th day, the expression of IbPIN1 in NZ1 decreased significantly by 24.6%, which was also reduced but not significantly in XS32. In contrast, the relative expression of IbPIN3 and IbPIN8 in the roots of the two varieties significantly decreased most of the time under LK treatment. Exogenous IAA promoted the expression of IbPIN1, IbPIN3, and IbPIN8 under LK stress, and the effects differed between the two varieties. On the 9th day, the expression of IbPIN3 in XS32 roots significantly increased by 99.2%, lower than that of NZ1 (increased by 2.44-fold), but the increased relative expression of IbPIN1 (by 46.1%) and IbPIN8 (by 3.2-fold) was significantly higher than that of NZ1 (by 11.3% and 12.3%). On the 12th day, the relative expression of IbPIN3 in XS32 roots significantly increased by 1.2 times under LK+IAA compared to LK, which was higher than that of NZ1 (increased by 52.6%), but the increase in the relative expression of IbPIN8 in XS32 roots (23%) was lower than that of NZ1 (66.7%).

Figure 6. Effects of exogenous IAA on expression levels of auxin transport genes in roots of sweetpotato under different K⁺ levels. (a and b) expression of IbPIN1; (c and d) expression of IbPIN3;(e and f) expression of IbPIN8. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Discussion

Plants often suffer low-K⁺ stress under natural conditions, limiting their growth and development (Wang et al. 2021). Early growth is an important factor in the survival and development of any plant (Murtaza et al. 2021). For sweetpotato, K⁺ deficiency stress affects all stages of its growth and development (Gajanayake et al. 2014; Wang and Wu 2015). The early growth stage (about 30 days after planting) is the period of vigorous growth and sensitive to K⁺ deficiency stress (Liu et al. 2017b). Plants can adapt to low K⁺ stress by changing root morphology, changing K⁺ acquisition, and changing their K⁺ utilization strategies (Schachtman and Shin 2007). Therefore, it is an important strategy to identify exogenous methods to help sweetpotato establish appropriate root morphology to cope with low potassium stress.

Our results demonstrated that LK significantly retarded the growth of sweetpotato seedlings, which can be clearly seen from the biomass of the shoot and root system (Table 2). However, as the low-K-tolerant variety, XS32 showed a lower reduction of dry mass and K⁺ accumulation than that of NZ1 (low-K⁺-sensitive) (Table 3), the reason should be that resistant variety have higher chlorophyll synthesis and gas exchange capacity (Ahmed et al. 2020). Furthermore, the K⁺ content and accumulation in the shoots and roots also decreased significantly, which was consistent with the changes of root length, forks number and crossings number, especially in lateral root length (Figures 2–3). This suggests that low K⁺ suppresses the uptake and transport of potassium mainly by affecting the formation and elongation of roots. This has also been proven in crops such as rice, tobacco, and corn (Jia et al. 2008; Zhang et al. 2009; Zhao et al. 2016). However, XS32 showed a lower decrease in root length, forks number, and crossings number, as well as a significantly higher proportion and density of lateral roots under LK compared to CK. This may be related to its ability to maintain high levels of IAA in roots and leaves under low K⁺ conditions (Figure 1), as root cell division and lateral root formation are closely related to the synthesis and transport of IAA (Ronzan et al. 2019; He et al. 2022). These results suggest that the low K⁺ tolerance of sweetpotato is directly related to root morphology and IAA levels, and exogenous IAA should be predictable for further improving the low K⁺ tolerance of sweetpotato.

Auxin is mainly synthesized in the aboveground portion of plants and redistributed within plants through a complex transportation network (Bhalerao et al. 2002; Tian et al. 2008). Currently, the most studied pathway for auxin biosynthesis is the Arabidopsis tryptophan transaminase (TAA)/yucca (YUC) pathway, which has 11 YUC genes and 3 TAA/TAR genes (Kriechbaumer and Poulet 2017). Our data show that exogenous IAA enhanced the expression levels of IbYUC6 and IbTAR2 in leaves under LK stress (Figure 4), this indicates that exogenous IAA promotes the synthesis of endogenous IAA in sweetpotato in response to low K⁺ stress. Furthermore, the expression levels of IbYUC6 and IbTAR2 in LK-stressed roots were also improved by exogenous IAA, but much lower than that in leaves (except on the 9th day). However, the induction effect of exogenous auxin on IbYUC6 and IbTAR2 in XS32 leaves is higher than that of NZ1, but lower than that of NZ1 in roots. This is similar to our previous findings that the IAA synthesis in XS32 mainly in the leaves, while that of NZ1 primarily in the roots (Liu et al. 2023). Despite this, the actual IAA content in NZ1 leaves and roots is still lower than XS32 (Figure 1). We also found that exogenous IAA significantly improves the total root length, forks number, and crossing number of NZ1 in the mid-term (6th and 9th days), while XS32 has a more significant effect in the later stage (9th and 12th days) (Figure 2). These results suggest that the endogenous IAA of XS32 May be synthesized more in the leaves by the induction of exogenous IAA, and their transport to the root takes time. The endogenous IAA in NZ1 May be synthesized more in roots, but this process is restricted with the extension of stress time.

IAA is synthesized mainly in the leaves of sweet potatoes, but is transported and accumulated in the roots by polar transport (via IbPIN1, IbPIN3, and IbAUX1) (Liu et al. 2023). We demonstrated that the relative expression of IbPIN1, IbPIN3 and IbPIN8 in LK-stressed leaves and roots of the two cultivars were also strengthened by exogenous IAA (Figure 5-6). In most of the time, the increased relative expression in XS32 was higher than that in NZ1. These results indicated that exogenous IAA could not only promote IAA transport from leaves to roots, but also promote IAA transport to root tips. The transportation and distribution of these IAA promoted the growth of lateral roots, resulted in a significant increase in lateral root length, projected area and volume (Figure 3). Study showed that when exogenous auxin (10 μmol L⁻¹) was added to tobacco under low potassium level, the concentration of endogenous auxin increased in the main and lateral root tips, and the total root length, the number of root tips and the number of branches increased significantly, which was consistent with our results (Guo et al. 2019). Applying NAA to low potassium treated plants can increase the formation and elongation of primary lateral roots to a level similar to that of the control, as well as the expression level of PIN genes (Song et al. 2015). These results are similar to the findings of this study. Research has shown that under stress conditions, plant growth and defense responses are coordinated by several plant hormones such as ABA, CTK, GA, and IAA (Xie et al. 2020). Our results suggest that auxin synthesis and transport may be the key factors in regulating sweetpotato root growth in response to low potassium stress. There may be more pathways involved in this process, including but not limited to ABA, GA, CTK, BR, SA, etc., which requires further exploration.

Conclusion

The results of this study showed that exogenous IAA alleviated the inhibition of dry mass, K⁺ content and accumulation, and root growth of sweetpotato under low K⁺ stress condition. Exogenous IAA promoted the synthesis of IAA in leaves and the transport of IAA from leaves to roots, which increased the length, ratio, and density of lateral roots and thus improved the absorption of K⁺ and biomass formation under low K⁺ conditions. Exogenous IAA had a better effect on the low-K⁺-tolerant sweetpotato variety.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This study was financially supported by the National Natural Science Foundation of China (32001482), and the China Agriculture Research System of MOR and MARA (CARS-10, sweetpotato).