MiR-3646 accelerates inflammatory response of Ang II-induced hVSMCs via CYP2J2/EETs axis in hypertension model

ABSTRACT

Background

Inflammatory response of human vascular smooth muscle cells (hVSMCs) is a driving factor in hypertension progression. It has been reported that miR-3646 was significantly up-regulated in serum samples from patients with coronary artery disease and acute myocardial infarction mice. However, its role and underlying molecular mechanism related to inflammatory response of angiotensin II (Ang II)-induced hVSMCs remain unclear.

Objective

We aimed to explore the potential molecular mechanisms related to inflammatory response of angiotensin II (Ang II)-induced hVSMCs.

Methods

Ang II–induced hypertension model was established after hVSMCs treated with 1 μM Ang II at 24 h. The interaction between microRNA 3646 (miR-3646) and cytochrome P450 2J2 (CYP2J2) was assessed by dual-luciferase reporter gene assay. MTS assay, Lipid Peroxidation MDA Assay Kit, ELISA, Western blot, and qRT-PCR were performed to examine viability, malondialdehyde (MDA) level, inflammatory cytokine levels, and the level of genes and proteins.

Results

Our findings illustrated that miR-3646 was up-regulated but CYP2J2 was down-regulated in Ang II–induced hVSMCs. Mechanically, miR-3646 negatively targeted to CYP2J2 in Ang II–induced hVSMCs. These findings indicated that miR-3646 regulated inflammatory response of Ang II–induced hVSMCs via targeting CYP2J2. Moreover, functional researches showed that CYP2J2 overexpression alleviated inflammatory response of Ang II–induced hVSMCs via epoxyeicosatrienoic acids/peroxisome proliferator-activated receptor-γ (EETs/PPARγ) axis, and miR-3646 aggravated inflammatory response of Ang II–induced hVSMCs via mediating CYP2J2/EETs axis.

Conclusion

MiR-3646 accelerated inflammatory response of Ang II–induced hVSMCs via CYP2J2/EETs axis. Our findings illustrated the specific molecular mechanism of miR-3646 regulating hypertension.

KEYWORDS:

• Hypertension
• inflammatory response
• angiotensin II
• miR-3646
• CYP2J2

Introduction

Hypertension is a worldwide epidemic and global health problem, which is the main risk factor for the development of cardiovascular disease (1). The prevalence of hypertension is increasing gradually, and complications will be caused, which is a serious threat to human health (2). Studies have shown that hypertension is associated with endothelial dysfunction, because endothelial dysfunction may increase systemic vascular resistance and lead to hypertension (3). Ang II is an important mediator of oxidative stress and inflammation, which leads to vascular smooth muscle cell (VSMC) injury through a series of mechanisms (4,5). However, it is unclear whether Ang II accelerates hypertension progression by inducing inflammatory response of VSMCs, and its underlying molecular mechanism remains unclear.

MiRNAs are a class of non-coding RNAs that affect a variety of cellular biological activities and molecular targets (6). As post-regulators of gene expression, miRNAs regulate mRNA translation or degradation by directly binding to target genes, and 2–7 nucleotides of mature miRNAs are considered to recognize the most important region for complementary base pairing in the target gene (7). MiRNAs are involved in various diseases progression, especially in cardiovascular disease. For example, miR-217 serves as a biomarker of vascular aging and cardiovascular risk (8). Jiang et al. reported that miR-1 is closely related to endothelial inflammatory response and atherosclerosis (9). Mohammad Babaee et al. found that miRs-27a and FOXO1 genes are closely associated with inflammatory cytokines and have potential roles in atherosclerosis progression (10). MiR-3646 is a newly discovered miRNA involved in various disease progression. For example, miR-3646 promotes breast cancer progression by regulating tumor cell metastasis (11). Wang et al. showed that miR-3646 promotes lung adenocarcinoma progression by downregulating SORBS1 through JNK signaling pathway (12). Futhermore, miR-3646-RHOH axis accelerates coronary artery disease progression by regulating vascular inflammation and modulating the biological behavior of VSMCs (13). However, the role of miR-3646 in inflammatory response of VSMCs in hypertension model and its underlying molecular mechanism remain unclear.

CYP2J2, a member of the cytochrome P450 enzyme superfamily, is expressed in the vascular endothelium, which is a prominent enzyme regulating endogenous polyunsaturated fatty acid metabolism (14). CYP2J2 is highly expressed in normal hearts and lungs and metabolizes free arachidonic acid into EETs in vivo. CYP2J2/EETS axis can maintain vascular endothelial cell barrier and play an important regulatory role in vascular function. For example, Ophiopogon D inhibits the apoptosis of vascular endothelial cells induced by Ang II via upregulating CYP2J2/EETs (15). Moreover, Huang et al. showed that Ophiopogon D attenuates Ang II–induced inflammation through the activation of CYP2J2 and the increase of EETs (16). However, the role of CYP2J2/EETs axis Ang II–induced inflammatory response of VSMCs in hypertension model and its potential molecular mechanism remain unclear.

Summary, we hypothesized that miR-3646 mediates the CYP2J2/EETs axis to aggravate the inflammatory response of VSMC in hypertension models. We aimed to clarify the potential mechanism of miR-3646/CYP2J2/EETs axis in hypertension progression. Our research provided a new direction for hypertension treatment.

Materials and methods

Specimen

The ethics committee of Xiangya Hospital, Central South University approved our study (KY-EC-2022-011). After obtaining the informed consent of the patients and signing the written documents, the peripheral blood of patients with hypertension was collected as samples (n = 30). The peripheral blood of age-matched non-hypertensive healthy people was collected as control (n = 30). Details of patient information and control population information can be found in Table 1.

Table 1. Clinical characteristics of HTN patients with high and miR-3646 risk scores.

	Case (n)	miR-3646		p
		Normal	HTN
Gender
Male	35	17	18	0.7934
Female	25	13	12
Age (years)
<Mean	25	14	11	0.4321
≥Mean	35	16	19
Stage
I	16	13	3	0.0115
II	18	8	10
III	26	9	17

Cell culture and treatment

Procell Life Science and Technology Co. Ltd (Wuhan, China) provided hVSMCs. One percent penicillin–streptomycin solution (P/S) and 10% fetal bovine serum (FBS) were added to Dulbecco’s modified eagle medium (DEME, Gibco, New York) for cell culture. Cells were incubated within the humid incubator under 37°C and 5% CO₂ conditions. For cell treatment, Ang II–induced hypertension was established after hVSMCs treated with 1 μM Ang II (Invitrogen, California, USA) at 0, 3, 6, 12, 24, and 48 h. The viability of 24 h hVSMCs was about 60%, which is suitable for follow-up functional research. Therefore, Ang II–induced hypertension model was established after hVSMCs treated with 1 μM Ang II for 24 h.

Cell transfection

GeneChem (Shanghai, China) synthesized sh-CYP2J2 (AUAUUUCUUCACAAACAGCUG) (sh-NC, CACUGAU-UUCAAAUGGUGCUAUU), miR-3646 mimics (CGCGT-ACCA AAAGTAATAATG) (NC mimics, GTGTAACACG-TCTATACG CCCA) and miR-3646 inhibitor (CTCAACTGGTGTCGTGGAGTCG) (inhibitor NC, CTCGCTTCG-GCAGCACA). Whole sequences of CYP2J2 were generated by PCR and inserted into pcDNA3.1 vector (GenePharma, Shanghai, China) for CYP2J2 overexpression. Lipofecta-mine™ 3000 Transfection Reagent (Invitrogen, California, USA) was used to transfect these segments (50 nM) into hVSMCs.

MDA detection

MDA level was detected by Lipid Peroxidation MDA Assay Kit (Biosharp, Beijing, China), according to previous reports (17).

qRT-PCR

TRIzol reagent (Invitrogen, California, USA) was used to extract total RNA of hVSMCs or blood sample. PrimeScript RT Reagent Kit (Invitrogen, California, USA) was used for reverse transcription of 1 μ g total RNA into complementary DNA (cDNA). MiRNAs were collected by mirVana microRNA Isolation kits (Invitrogen, California, USA), and miR-3646 level was detected by using the TaqMan microRNA assay kit (Invitrogen, California, USA), U6 RNA served as endogenous control. Subsequently, CYP2J2 mRNA level was measured on the 7500 real-time PCR system using SYBR Premix Ex Taq. GAPDH was used as an endogenous control for data analysis. The expression change of RNAs was calculated by the 2^−ΔΔCT method. The primers used in this study are shown in Table 2.

Table 2. Primer sequences.

Primer name	Primer sequences
F- miR-3646	5′-GTGCAGGGTCCGAGGT-3-3′
R- miR-3646	5′-GCAAAATGAAATGAGCCCAG‐3′
F- CYP2J2	5′-GGAGAGCAAAGAAGGTTCAC-3′
R- CYP2J2	5′-TGACAGCATTGGTGTAGGGC‐3′
F-GAPDH	5′-CTGACTTCAACAGCGACACC-3′
R-GAPDH	5′-GTGGTCCAGGGGTCTTACTC-3′
F-U6	5′-CTCGCTTCGGCAGCACA-3′
R-U6	5′-AACGCTTCACGAATTTGCGT-3′

11,12-DHET detection

EETs is unstable and can be hydrolyzed into corresponding stable metabolite 11,12-dihydroxyeicosatrienoic acid (11,12-DHET) by soluble epoxide hydrolase (sEHs). Moreover, EETs can be hydrolyzed to DHETs by acid treatment; thus, DHET in acidified urine represents total DHETs. The difference between total 11,12-DHET and 11,12-DHET before acidification will be 14,15-EET levels. Enzyme-linked immunosorbent assay (ELISA) kit (Detroit R&D Inc., Detroit, MI, US0041) was performed to detect the concentration of 11,12-DHET to evaluate the EET level in vitro, based on previous reports (18,19).

Western blot

hVSMCs or blood sample lysates were prepared using RIPA lysis buffer (Thermo Fisher Science, Waltham, MA, USA). After separation with 10% SDS-PAGE gel, the protein was transferred to PVDF membrane (Thermo Fisher Science, Waltham, MA, USA). The PVDF membrane was sealed with bovine serum albumin and 5% skim milk powder. Nest, PVDF membrane and specific antibodies were incubated overnight at 4°C, and GAPDH (ab8245, 1:2000) was used as endogenous control. Specially, LaminB1 (ab16048, 1:2000) served as an internal reference for nuclear proteins. All antibodies were purchased from Abcam (Cambridge, UK), including CYP2J2 (ab151996, 1:2000), PPARγ (ab178860, 1:1000) and NF-kB p65 (ab32536, 1:5000) proteins. The second day, after incubation with goat anti-rabbit Ig G H&L antibody (ab150077, 1:2000), the bands were detected using a gel imaging system (Bio-RAD, USA, California) and protein quantitative analysis was performed using ImageJ software.

ELISA

To evaluate the status regarding the inflammatory response, the levels of pro-inflammatory cytokines, including IL-1β, IL-6, and TNF-α, in both hVSMCs or blood sample were examined by ELISA. The serum and cell lysate were examined using ELISA kits for IL-1β (cat. no. 557953), IL-6 (cat. no. 555220), and TNF-α (cat. no. 555212; all from BD Biosciences) according to the manufacturer’s protocols. The absorbance value at 450 nm was detected with a microplate reader (Bio-Rad Laboratories, Inc.).

MTS assay

MTS reagent (Saint-Bio, Shanghai, China) for hVSMCs cell viability detection. The MTS reagent was dissolved at room temperature or 37°C, and 10 μL of MTS reagent was added to 96-well culture plates, with 1 × 10⁵ cells per well. The 96-well culture plate was put back into the incubator and incubated at 37°C for 1 h. The OD value at 490 nm was determined by a microplate reader.

Dual-luciferase reporter assay

The potential binding sites of miR-3646, CYP2J2, PPARγ and p65 were predicted using Starbase bioinformatics software. Plasmid construction and luciferase activity assay were performed, as previously reported (20).

Statistical analysis

The mean ± standard deviation (SD) represents data from three independent experiments. Student t-test for two groups and Tukey’s multiple comparison test for multi-group comparison. When P < .05, the difference is statistically significant.

Results

MiR-3646 was up-regulated but CYP2J2 was down-regulated in Ang II-induced hVSMCs

qRT-PCR was performed to detect the level of related genes in the blood of patients with hypertension. Results indicated that compared with the control, miR-3646 was upregulated, but CYP2J2 was down-regulated in blood of hypertensive patients (Figure 1a). Subsequently, Ang II–induced hypertension was established after hVSMCs treated with 1 μM Ang II at 0, 3, 6, 12, 24, and 48 h. MTS assay analysis furtherly showed that with the extension of time, Ang II–induced hVSMCs viability gradually decrease (Figure 1b). The viability of 24 h hVSMCs was about 60%, which was suitable for follow-up functional research. Therefore, Ang II–induced hypertension model was established after hVSMCs treated with 1 μM Ang II for 24 h. Further analysis revealed that MDA level was up-regulated in Ang II–induced hVSMCs (Figure 1c). Similarly, ELISA analysis showed IL-1β, IL-6, and TNF-α levels were increased in Ang II–induced hVSMCs (Figure 1d). These findings showed that Ang II–induced hypertension model was successfully established. Moreover, Analysis indicated that miR-3646 was increased but CYP2J2 was decreased in Ang II–induced hVSMCs (Figure 1e,f).

Figure 1. miR-3646 was up-regulated but CYP2J2 was down-regulated in Ang II–induced hVSMCs. (a) qRT-PCR detected miR-3646 and CYP2J2 levels in blood of hypertensive patients (HTN, n = 30). Blood from healthy patients (Normal, n = 30) served as the negative control. Ang II–induced hypertension (Model group) was established after hVSMCs treated with 1 μM Ang II at 0, 3, 6, 12, 24 and 48 h. (b) MTS assay detected Ang II–induced hVSMCs viability. (c) Lipid Peroxidation MDA Assay Kit detected MDA level in Ang II–induced hVSMCs. (d) ELISA detected IL-1β, IL-6 and TNF-α levels in the supernatant of Ang II–induced hVSMCs. (e) qRT-PCR detected miR-3646 and CYP2J2 levels in Ang II–induced hVSMCs. (f) Western blot measured CYP2J2 protein level in Ang II–induced hVSMCs. *p < .05, ** p < .01, *** p < .001(n = 3).

MiR-3646 regulated inflammatory response of Ang II-induced hVSMCs via targeting CYP2J2

To further investigate the role of miR-3646 and its underlying molecular mechanism in inflammatory response of Ang II–induced hVSMCs, Ang II–induced hVSMCs were transfected with miR-3646 mimics or miR-3646 inhibitor. qRT-PCR analysis indicated that miR-3646 mimics up-regulated miR-3646 level but miR-3646 inhibitor down-regulated miR-3646 level, and Ang II–induced miR-3646 expression was promoted by miR-3646 mimics but decreased by miR-3646 inhibitor. Inversely, Ang II–inhibited CYP2J2 expression was aggravated by miR-3646 mimics but alleviated by miR-3646 inhibitor (Figure 2a). Then, MTS assay indicated that the decrease of Ang II–induced hVSMCs viability was aggravated by miR-3646 mimics but reversed by miR-3646 inhibitor (Figure 2b). Inversely, Ang II–induced MDA was accelerated by miR-3646 mimics while miR-3646 inhibitor decreased the level of MDA induced by Ang II (Figure 2c). ELISA analysis furtherly revealed that Ang II–induced inflammatory factors expression including IL-1β, IL-6 and TNF-α was promoted by miR-3646 mimics, whereas decreased by miR-3646 inhibitor (Figure 2d). Inversely, Western blot analysis indicated that Ang II–inhibited CYP2J2 expression was exacerbated by miR-3646 mimics but relieved by miR-3646 inhibitor (Figure 2e). Furthermore, analysis revealed that the luciferase activity of CYP2J2-WT reported gene was inhibited by co-transfection of miR-3646 mimics, but the luciferase activity of CYP2J2-MUT reported gene in Ang II–induced hVSMCs was not changed by co-transfection of miR-3646 mimics, indicating miR-3646 negatively targeted to CYP2J2 in Ang II–induced hVSMCs. Inversely, the luciferase activity of PPARγ-WT or p65-WT reported gene had no change after co-transfection with miR-3646 mimics, and the luciferase activity of PPARγ-MUT or p65-MUT reported gene also no change, indicating there was no targeting relationship between miR-3646 and PPAR γ or p65 gene (Figure 2f). To sum up, miR-3646 regulated inflammatory response of Ang II–induced hVSMCs via targeting CYP2J2.

Figure 2. miR-3646 regulated inflammatory response of Ang II–induced hVSMCs via targeting CYP2J2. Ang II–induced hVSMCs were transfected with miR-3646 mimics or miR-3646 inhibitor. Untreated hVSMCs served as the negative control for Ang II–induced hVSMCs (Model group), NC mimics served as the negative control for miR-3646 mimics, NC inhibitor served as the negative control for miR-3646 inhibitor. (a) qRT-PCR detected miR-3646 and CYP2J2 levels. (b) MTS assay detected hVSMCs viability. (c) Lipid Peroxidation MDA Assay Kit assessed MDA level. (d) ELISA measured IL-1β, IL-6, and TNF-α levels in the supernatant of hVSMCs. (e) Western blot measured CYP2J2 protein level in hVSMCs. (f) The targeting relationship between miR-3646 and CYP2J2, PPAR γ and p65 was detected by dual-luciferase reporter assay. *p < .05, **p < .01, ***p < .001 (n = 3).

CYP2J2 overexpression alleviated inflammatory response of Ang II-induced hVSMCs via EETs/PPARγ axis

To explore the role of CYP2J2 and its underlying molecular mechanism in inflammatory response of Ang II–induced hVSMCs, Ang II–induced hVSMCs were transfected with oe-CYP2J2. qRT-PCR analysis showed that oe-CYP2J2 was successfully transfected, and Ang II–inhibited CYP2J2 level was reversed by oe-CYP2J2 (Figure 3a). As shown in Figure 3b, hVSMCs’ viability decreased by Ang II was rescued by CYP2J2 overexpression. Inversely, MDA level increased by Ang II was down-regulated by CYP2J2 overexpression (Figure 3c). Subsequently, analysis revealed that IL-1β, IL-6, and TNF-α levels induced by Ang II were down-regulated by CYP2J2 overexpression (Figure 3d). Moreover, Western blot analysis indicated that the levels of CYP2J2 and PPARγ inhibited by Ang II were reversed by CYP2J2 overexpression in hVSMCs. Whereas Ang II promoted NF-kB p65 level in the nucleus of hVSMCs but inhibited NF-kB p65 level in the cytoplasmic of hVSMCs, however, this trend was reversed by CYP2J2 overexpression (Figure 3e). Consistently, ELISA analysis showed that EETs metabolites (11,12-DHET) showed the same expression trend (Figure 3f). These findings revealed that CYP2J2 overexpression reduced Ang II–induced nuclear translocation of NF-KB P65. In total, CYP2J2 overexpression alleviated inflammatory response of Ang II–induced hVSMCs via EETs/PPARγ axis.

Figure 3. CYP2J2 overexpression alleviated inflammatory response of Ang II–induced hVSMCs via EETs/PPARγ axis. (a) qRT-PCR detected CYP2J2 level after hVSMCs were transfected with oe-CYP2J2 or oe-NC. Ang II–induced hVSMCs (Model group) were transfected with oe-CYP2J2 or oe-NC. (b) MTS assay measured hVSMCs viability. (c) Lipid Peroxidation MDA Assay Kit detected MDA level. (d) ELISA assessed IL-1β, IL-6, and TNF-α levels in the supernatant of hVSMCs. (e) Western blot measured CYP2J2, PPARγ and NF-kB p65 proteins levels in nucleus and cytoplasm of hVSMCs. (f) ELISA detected EETs metabolites (11, 12-DHET) in the supernatant of hVSMCs. *p < .05, **p < .01, ***p < .001 (n = 3).

MiR-3646 aggravated inflammatory response of Ang II-induced hVSMCs via mediating CYP2J2 /EETs axis

To explore whether miR-3646 accelerated inflammatory response of Ang II–induced hVSMCs via CYP2J2/EETs axis, Ang II–induced hVSMCs were transfected with miR-3646 inhibitor or sh-CYP2J2. qRT-PCR analysis indicated that Ang II–induced miR-3646 level was inhibited by miR-3646 inhibitor, but sh-CYP2J2 had no effect on miR-3646 level. Inversely, Ang II–inhibited CYP2J2 was alleviated by miR-3646 inhibitor, while this trend was reversed by sh-CYP2J2 (Figure 4a). MTS assay analysis depicted that Ang II–induced reduction in cell viability of hVSMCs was promoted by miR-3646 inhibitor, whereas the impact of miR-3646 inhibitor was subsequently recovered by CYP2J2 depletion (Figure 4b). Further analysis indicated that Ang II–induced increase of MDA was abolished by miR-3646 inhibitor, while CYP2J2 knockdown reversed the effect of miR-3646 inhibitor (Figure 4c). Consistently, inflammatory factors expression including IL-1β, IL-6, and TNF-α showed the same trend (Figure 4d). Furthermore, Western blot analysis indicated that Ang II–induced reduction of CYP2J2 and PPARγ proteins expression was alleviated by miR-3646 inhibitor, while the effect of miR-3646 inhibitor was subsequently recovered by CYP2J2 knockdown, ELISA analysis furtherly showed that EET metabolites (11,12-DHET) showed the same trend (Figure 4e,f). In conclusion, miR-3646 aggravated inflammatory response of Ang II–induced hVSMCs via mediating CYP2J2/EETs axis.

Figure 4. miR-3646 aggravated inflammatory response of Ang II–induced hVSMCs via mediating CYP2J2 /EETs axis. Ang II–induced hVSMCs (Model group) were transfected with miR-3646 inhibitor or inhibitor NC and sh-CYP2J2 or sh-NC. (a) qRT-PCR detected miR-3646 and CYP2J2 levels. (b) MTS assay detected hVSMCs viability. (c) Lipid Peroxidation MDA Assay Kit detected MDA level. (d) ELISA detecedIL-1β, IL-6, and TNF-α levels in the supernatant of hVSMCs. (e) Western blot measured CYP2J2 and PPARγ proteins levels. (f) ELISA deteced EETs metabolites (11, 12-DHET) levels in the supernatant of hVSMCs. *p < .05, **p < .01, ***p < .001 (n = 3).

Discussion

Ang II is a vasoactive peptide that increases arterial blood pressure leading to hypertension and induces endothelial dysfunction by inducing oxidative stress in VSMCs (21). VSMCs are a component of arteries that play an important role not only in vascular structure and function but also in maintaining tissue elasticity, wall stress homeostasis, and vascular stiffness (22). Increasing evidence shows that inflammatory reaction of VSMCs is the main driving factor of hypertension (23). In this study, we mainly clarify the regulatory mechanism of VSMCs inflammatory response. Our findings illustrated that miR-3646 accelerated inflammatory response of Ang II–induced hVSMCs via CYP2J2/EETs axis. MiR-3646 may be an effective target for regulating inflammatory response in hVSMCs. We confirmed for the first time that miR-3646 mediates CYP2J2/EETs axis to aggravate the inflammatory response of hVSMC in hypertension model.

MiRNA regulates a variety of cardiovascular diseases, including diabetes, myocardial infarction, hypertension, etc., which confirm that miRNA is a potential biomarker of cardiovascular diseases progression and prognosis (24–26). Li et al. indicated that miR-150 prevents hypoxia-induced pulmonary vascular remodeling and fibrosis (27). Ryszard Nosalski et al. reported that miR-214 is increased in the plasma of hypertensive patients and mediates perivascular fibrosis in hypertension (28). Recent studies have shown that miR-3646 is significantly up-regulated in serum samples from coronary artery disease patients and acute myocardial infarction mice (13). However, the specific mechanism of miR-3646 in vascular endothelial cells in hypertensive diseases has not been reported. Crucially, miRNAs also modulate Ang-II-induced inflammatory responses. For example, miR-103a-3p promotes angiotensin II–induced renal inflammation and fibrosis via SNRK/NF-κB/P65 regulatory axis (29). Our results showed that miR-3646 was increased in the blood of hypertensive patients and Ang II–induced hVSMCs, indicting miR-3646 may play a positive role in disease progression. Subsequently, our hypothesis was further confirmed by the fact that miR-3646 overexpression promoted inflammatory response of hVSMCs by targeting CYP2J2 in hypertension model, while miR-3646 knockdown inhibited inflammatory response.

CYP2J2 metabolizes arachidonic acid into EETs, which exert various effects in the cardiovascular system (30). CYP2J2-EETs axis plays a key role in maintaining vascular function (31). Feng et al. indicated that CYP2J2-EETs axis inhibited the migration of pulmonary artery SMCs induced by TGF- β1 (32). CYP2J2 and its metabolite EETs have been reported to inhibit inflammation, oxidative stress and apoptosis in pulmonary artery endothelial cells (32). Moreover, Zheng et al. reported that CYP2J2-EETs axis alleviates ameliorates monocrotaline-induced pulmonary arterial hypertension (33). Similarly, our findings showed that CYP2J2 was downregulated in the blood of hypertensive patients and Ang II–induced hVSMCs, indicting CYP2J2 may play a negative role in disease progression. Subsequently, functional studies have shown CYP2J2 overexpression alleviated inflammatory response of Ang II–induced hVSMCs via EETs/PPARγ axis. Furthermore, our research finally proved that miR-3646 aggravated inflammatory response of Ang II–induced hVSMCs via mediating CYP2J2/EETs axis. Our results indicated that miR-3646 may be an effective target for regulating inflammatory response in hVSMCs.

Summary, our research illustrated that our findings illustrated that miR-3646 accelerated inflammatory response of Ang II–induced hVSMCs via CYP2J2/EETs axis in hypertension model. MiR-3646 may be an effective target for regulating inflammatory response of hVSMCs in hypertension model. However, there are still many deficiencies in our research. For example, further validation and exploration were needed at the animal level and in signaling pathways, which will be our future research direction.

Ethics approval and consent to participate

The ethics committee of Xiangya Hospital, Central South University approved our study.

Acknowledgments

We would like to give our sincere gratitude to the reviewers for their constructive comments.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher.

Additional information

Funding

This work was supported by Natural Science Foundation of Hunan Province (S2021JJKWLH0039) and Natural Science Foundation of Hunan Province (2021JJ70055).