Angiotensin II-induced vascular endothelial cells ferroptosis via P53-ALOX12 signal axis

ABSTRACT

Objectives

The present study aimed to investigate the effect and mechanism of angiotensin II–induced ferroptosis in vascular endothelial cells.

Methods

In vitro, HUVECs were treated with AngII, AT_1/2 R antagonist, P53 inhibitor, or their combinations. MDA and intracellular iron content were evaluated using an ELISA assay. The expression of ALOX12, P53, P21, and SLC7A11 were determined by western blotting in HUVECs and then confirmed through RT-PCR.

Results

As the concentration of Ang II (0, 0.1,1,10,100, and 1000uM for 48 h) increased, the level of MDA and intracellular iron content increased in HUVECs. Compared with the single AngII group, ALOX12, p53, MDA, and intracellular iron content in AT_1/2R antagonist group decreased significantly. In pifithrin-α hydrobromide-treated, ALOX12, P21,MDA, and intracellular iron content decreased significantly as compared to the single AngII group. Similarly, the effect of combined use of blockers is stronger than that of blockers alone.

Conclusions

AngII can induce ferroptosis of vascular endothelial cells. The mechanism of AngII-induced ferroptosis may be regulated through the signal axis of p53-ALOX12.

KEYWORDS:

• Angiotensin II
• ferroptosis
• vascular endothelial cells

Introduction

Ferroptosis is an independent mode of cell death, which is different from apoptosis, necroptosis, and autophagy. The accumulation of lipid reactive oxygen species (ROS) is an important characteristic for this form of programmed cell death. With the deepening of the research, ferroptosis has been found in the pathophysiological processes of more and more diseases. However, the study of ferroptosis is still in the early stages, and many problems remain unclear. (1–4)

The renin-angiotensin-aldosterone system (RAAS) plays a key regulating role in the function of cardiovascular system. Angiotensin II (Ang II) is a potent vasoconstrictive peptide and the main effector molecule of the RAAS, which acts through two receptors: Angiotensin II type 1 receptor (AT₁R) or Angiotensin II type 2 receptor (AT₂R). Overactivation of the RAS has been proved to be involved in the development of multiple cardiovascular diseases. AngII is one of the important causes of endothelial cell dysfunction. There is a lot of research showing that AngII is a proinflammatory mediator in hypertension through production of ROS in endothelial cells. (5,6) However, the effect and mechanism of AngII–induced ferroptosis in vascular endothelial cells are not clarified. In this study, we examined the roles of AngII in vascular endothelial ferroptosis and its potential mechanism.

Materials and methods

Cell culture and treatments

Human umbilical vein endothelial cells (HUVECs) were obtained from the Cell bank of Yazai biological company (Shanghai, China), and HUVECs at passages 4–8 are used in the present study. In the first part of the in vitro experiment, HUVECs were cultured with different concentrations of AngII (0.1uM, 1uM, 10uM, 100uM, and 1000uM, respectively) at 37°C. Based on literature and improved upon, we choose 48 hours as the observation time. (JCI Insight. 2021;6(18):e133690.) (Front Physiol.2020;11:566410.) According to the results of the first part of the experiment, select the best Ang II concentration to carry out the second part of the experiment. In the second part of experiment, the cells were randomly assigned to five groups and treated in different methods respectfully. The HUVECs of AT1R blocking group were treated with Valsartan. The HUVECs in inhibition of AT₂R group were incubated with olodanrigan. The HUVECs in blockade of p53 group were treated with pifithrin-α hydrobromide. The HUVECs in AT₁R and AT₂R simultaneous blocking group were combined for treatment with Valsartan and olodanrigan. In combined blocking of AT₁R and p53 group, valsartan was applied together with pifithrin-α hydrobromide.

Ferroptosis analysis

Measurement of malonaldehyde

The levels of malonaldehyde (MDA) to be released from HUVECs were quantified by enzyme-linked immunosorbent assay (ELISA). After 48 hr of administration, collected cell lyses to detect following the manufacturer’s instructions of ELISA kits (Abcam Co, United States). (7)

Measurement of intracellular iron content

Intracellular iron content was estimated using Iron test kit (colorimetric method). The specific experimental operation was carried out according to the instructions (Iron Assay kit, Abcam Co, United States). The absorbance is displayed at 593 nm. The optical density of the plate was read using an ELISA reader, and the concentration of the test sample was calculated.

Determination of Arachidonic acid 12-lipoxygenase, Solute carrier family 7 member 11, P53,P21

1) Detection of Exogenous Gene Expression Protein – Western blotting

Protein levels of Arachidonic acid 12-lipoxygenase (ALOX12), P53, P21, Solute carrier family 7 member 11 (SLC7A11) were determined in HUVECs after treatment with the corresponding drugs. The protein extraction and homogenization protocol is well established in Yazai biological company (Shanghai, China). Protein concentrations were determined using a BCA protein assay kit according to the manufacturer’s instructions, and 25 µg of protein was analyzed by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Detected protein expressions were processed and analyzed by ImageJ software. (Exp Mol Med. 2019,51:1–15) Protein expression levels were normalized to the expression of GAPDH and presented as relative protein levels. For detection of target proteins, rabbit polyclonal antibodies by abcam Co, United States: Arachidonic acid 12-lipoxygenase (ALOX12), P53, P21, Solute carrier family 7 member 11 (SLC7A11); mouse monoclonal GAPDH antibody (cst Co, United States), Goat Anti-Rabbit secondary antibody (Beyotime Co, China) were used.

2) Identification of foreign gene transcription level – quantitative RT-PCR

qPCR analyses confirmed that expression of ALOX12, P53, and SLC7A11 after treatment with the corresponding drugs. Total RNA was harvested from HUVEC using TRIzol reagent (Invitrogen, Carlsbad, CA, United States) and the RNeasy Kit (Qiagen Co., Hilden, Germany) according to the manufacturer’s instructions. Primer sequences to be used in the experiment are presented in Table 1 (Yazai biological co, China).

Table 1. Primer sequences.

Primer name	Primer sequences (5’→3’)	Amplification products
h-GAPDH-F	GGAGCGAGATCCCTCCAAAAT	197
h-GAPDH-R	GGCTGTTGTCATACTTCTCATGG
H-VEGFA-F	AGGGCAGAATCATCACGAAGT	75
H-VEGFA-R	AGGGTCTCGATTGGATGGCA
H-ALOX12-F	ATGGCCCTCAAACGTGTTTAC	111
H-ALOX12-R	GCACTGGCGAACCTTCTCA
H-p53-F	CAGCACATGACGGAGGTTGT	125
H-p53-R	TCATCCAAATACTCCACACGC

Quantitative RT-PCR was carried out using Thermo/ABI quantstudio five fluorescence quantitative PCR system (illumine-eco Co, United States). The expression level of each gene was represented as the fold change using the 2− ΔΔCt methods. For each target gene, the average Ct values calculated from triplicate PCRs were normalized to the average Ct values for GAPDH.

Statistical analysis

All the experiments were independently repeated at least three times. Mean ± standard deviation (SD) was displayed to show the data. Statistical analysis was carried out using SPSS 22 statistical software package and Microsoft Excel software to assess the differences between experimental groups. Students’ t-test and one-way analysis of variance (ANOVA) were utilized for the contrast among different groups. P values of less than 0.05 were considered statistically significant. Post hoc Tukey tests were performed where significant interactions were observed in ANOVAs. The Benjamini-Hochberg method was used for multiple test correction.

Results

The relation concentration of angiotensin II (Ang II) and HUVECs ferroptosis

To characterize the effect of Ang II on ferroptosis in vascular endothelial cell, we carried out concentration-response experiments on HUVECs. As the concentration of Ang II (0, 0.1,1,10,100, and 1000uM for 48 h) increased, the level of MDA increased in HUVECs. In addition, Ang II also increased intracellular iron content in a concentration-dependent manner (Figure 1). The cutoff point for changes in the effect of different concentrations of Ang II is between 10 and 100 μM.

Figure 1. Concentration-dependent effects of angiotensin II (Ang II) on the level of MDA and intracellular iron content in HUVECs. In these experiments, Ang II was applied in the range of 0.1 to 1000 uM. Different groups were administered with different concentrations of Ang II and measured after incubation for 48 hours. A: MDA,B: intracellular iron content. Mean ± SEM; *p < .05 vs. control,**p < .01 vs. control.

The influence of different concentrations of Ang II on ALOX12, and P53 in HUVECs

Western blot revealed that Ang II treatment for 48 h dose-dependently up-expressed ALOX12, P53 and down-expressed SLC7A11 in HUVECs (Figure 2A), Then we used RT-PCR to analyze the relation between concentration of Ang II and expression of ALOX12, P53, and SLC7A11 in HUVECs to further confirm (Figure 2B). In order to determine the appropriate concentration, we used 10 μM Ang II alone for further verification. Consistent with previous experiments, the relevant observation indexes (Including ALOX12, SLC7A11, and P21) of the 10 µM Ang II group were significantly different from those of the control group (Figure 3).

Figure 2. The expression of ALOX12, P53 and SLC7A11 in HUVECs after treatment of Ang II for 48 h. (a) Western blot analysis. (b) RT-PCR verification . Data are presented as relative values compared to control data. Mean ± SEM; *p < .05 vs. control,**p < .01, ***p < .001 vs. control.

Figure 3. The expression of ALOX12, P21 and SLC7A11 in HUVEC to be treated with AngII, which concentration was 10 uM. Mean ± SEM; *p = .031, **p = .02, ***p = .00 vs. control. The experiments were repeated twice, independently, with similar results.

Impacts of AT_1/2 R antagonist, P53 inhibitor on vascular endothelial ferroptosis

Incubation of HUVECs in AngII to be treated with antagonist (Including valsartan – AT1R blocker, Olodanrigan – AT2R blocker, pifithrin-α hydrobromide–P53 blocker) for 48 h reduces intracellular iron content and MDA. Compared with the single AngII-treated group, intracellular iron content and MDA in valsartan and/or Olodanrigan group was decreased markedly (Figure 4).

Figure 4. Influence of inhibitor AT1/2R and P53 on the effects of Ang II for intracellular iron content and MDA in HUVECs. The presented data were recorded after administration of blocker for 48 h. Mean ± SEM; *p < .05, **p < .01, and ***p < .001 vs. control.

Effects of AT_1/2 R and P53 on AngII- induced vascular endothelial ferroptosis

After HUVECs were treated with pifithrin-α hydrobromide, ALOX12, P21 was down-expressed significantly, as compared to Ang II group. The most larger reduction in ALOX12, P21 was pifithrin – α hydrobromide combined with valsartan group (Figure 5). Meanwhile, qRT-PCR analysis showed that ALOX12 in group to be treated with valsartan and/or Olodanrigan was significantly up-expressed in group to be treated with valsartan and/or olodanrigan compared to single Ang II induced group. In contrast, P53, SLC7A11 in group to be treated with valsartan and/or olodanrigan was significantly down-expressed in group to be treated with valsartan and/or olodanrigan compared to single Ang II induced group. Compared with single drug treatment group, the effect in combined administration of valsartan and olodanrigan was stronger inhibition on vascular endothelial ferroptosis to be induced by AngII (Figure 6).

Figure 5. P21-ALOX12 is critical for Ang II–induced vascular endothelial ferroptosis. Western blot analysis of HUVECs treated with pifithrin-α hydrobromide and/or valsartan treated as indicated for 48 h. Mean ± SEM: pifithrin-α hydrobromide *p < .05, **p < .001 vs Ang II;. Valsartan ^#p < .05, ^##p < .01 vs Valsartan+ pifithrin-α hydrobromide.

Figure 6. The Influence of AT1/2R on P53,SLC7A11 and ALOX12 in HUVECs to be treated with Ang II. RT-PCR analysis of HUVECs treated with valsartan or/and olodanrigan. Mean ± SEM; *p < .05, **p < .01, and ***p < .001 vs. control.

Discussion

Up to date, no study has investigated the correlation between RAAS and vascular endothelial ferroptosis . At present, we found that treatment of Ang II may induce ferroptosis in HUVECs and the signal axis of P53-ALOX12 plays a relevant role in the regulation of Ang II–induced vascular endothelial ferroptosis.

Extensive research into the process of ferroptosis during the last few years has revealed that it is linked to different pathological states. The clinical significance of ferroptosis in the occurrence, development, and treatment of diseases has gradually emerged. Activating or blocking the ferroptosis pathway to alleviate the progression of the disease, which provides a promising therapeutic strategy for many diseases. (1–4,8,9)

Ferroptosis is an iron-dependent, lipid peroxide-driven form of cell death that differs from other forms of regulated cell death with respect to the biochemical pathways. Iron-dependent lipid ROS accumulation is involved in ferroptosis in all pathways. Some scholars recently found that p53 plays an important role in modulating ferroptotic responses through its metabolic targets. (1–4,8,9) Although high levels of ferroptosis were detected in Ang II-treated HUVECs in our experiment, ferroptosis was blocked by pifithrin-α hydrobromide (p53 inhibitor) and the expression of p21 in HUVECs was also descreased. Those evidences prove that p53 is closely related to ferroptosis in Ang II-treated HUVECs.

A large number of literatures have reported that ALOX12 is critical for p53-mediated ferroptosis. Inactivation of ALOX12 can reduce p53-mediated ferroptosis caused by active oxygen stress. ALOX12 was shown to be related to the ferroptosis independent of ACSL4. As an important lipoxygenase, ALOX12 are not only necessary for normal biological processes but also the basis for many diseases. ALOX12 is involved in the regulation of inflammation and apoptosis. (10,11) ALOX12 R261Q is associated with the risk of essential hypertension in the Spanish population. ALOX12 expression was reduced in carotid atherosclerosis. Down-regulation of ALOX12 blocks a response caused by vascular endothelial contraction (12). In addition, the increased expression of ALOX12 in the vascular smooth muscle of hypertensive rats can increase the expression level of AT1R (13). Excess aldosterone can upregulate the expression of ALOX12 in human vascular smooth muscle, thereby increasing the risk of LDL oxidation and atherosclerosis (14). In our study, Ang II was used to treat HUVECs; it increased p53 and ALOX12 of HUVECs. Furthermore, our results showed that MAD, intracellular iron content and ALOX12 decreased after blocking AT₁R or p53. Moreover, the level of ALOX12 was reduced further in HUVECs treated with both p53 inhibitor and AT1R blocker, indicating the involvement of both AT1R and p53 in the Ang II-induced HUVECs ferroptosis. In contrast, the expression of SLC7A11 in HUVECs was up-regulated. Bo et al. reported that p53 is able to activate ALOX12 function indirectly by transcriptional repression of SLC7A11, resulting in ALOX12-dependent ferroptosis upon ROS stress (1). Hence, we suggested that p53 can promote ALOX12 function indirectly by downregulating SLC7A11. Similar data were also obtained in blocking AT2R and further analysis showed that AT2R was able to fully induce cell ferroptosis under the same conditions. Taken together, we considered that AT1/2R may mediate ferroptosis through the signal axis of p53-ALOX12. The possible mechanism is that p53 promotes ferroptosis through transcriptional repression of SLC7A11, which in turn releases the lipoxygenase activity of ALOX12 from SLC7A11 inhibition.

Our study is limited by the fact that we did not observe the effect of ALOX12 to be blocked in HUVECs directly. It is also a limitation not to directly detect AT1R and AT2R protein levels. Another limitation is that there are few indicators to evaluate ferroptosis in our study. Despite these limitations, the results of our research can still clarify many problems.

Conclusion

Overall, our results show that AngII may induce ferroptosis of vascular endothelial cells. The signal axis of p53-ALOX12 is one of the pathway for AngII-induced vascular endothelial cells ferroptosis.

Disclosure statement

No potential conflict of interest was reported by the authors.

Additional information

Funding

This research is supported by Grant No. 2018YFC2002400 from the National Key R&D Program of China.