ABSTRACT
Objective
Hypertension is one of the leading causes of human death and disability. MTHFR and MTRR regulate folate metabolism and are closely linked to hypertension, although the relationship is inconsistent among different ethnic groups. The present study aims to investigate the effects of MTHFR C677T (rs1801133), MTHFR A1298C (rs1801131), and MTRR A66G (rs1801394) polymorphisms on hypertension susceptibility in the Bai nationality of the Yunnan Province, China.
Methods
This case–control study included 373 hypertensive patients and 240 healthy controls from the Chinese Bai population. The genotyping of MTHFR and MTRR gene polymorphisms was carried out by using the KASP method. The effects of genetic variations of MTHFR and MTRR genes on hypertension risk were evaluated with odds ratios (OR) and 95% confidence intervals (95% CI).
Results
The present study revealed that the CT and TT genotypes and T allele of MTHFR C677T locus were considerably associated with an increased risk of hypertension. In addition, MTHFR A1298C locus CC genotype could significantly increase the hypertension risk. The T-A and C–C haplotypes of MTHFR C677T and MTHFR A1298C could increase the risk of hypertension. Further stratified analysis by risk rank of folate metabolism indicated that people with poor utilization of folic acid were more prone to develop hypertension. In the hypertension group, the MTHFR C677T polymorphism was significantly associated with fasting blood glucose, fructosamine, apolipoprotein A1, homocysteine, superoxide dismutase, and malondialdehyde levels.
Conclusion
Our study suggested that genetic variations of MTHFR C677T and MTHFR A1298C were significantly associated with susceptibility to hypertension in the Bai population from Yunnan, China.
Introduction
Hypertension is the most common chronic disease characterized by a sustained rise in blood pressure. Hypertension can be divided into primary and secondary hypertension. Primary hypertension is the most common and prevalent form, with almost 90% reported cases (Citation1). The complex pathogenesis of primary hypertension is determined by tight interactions between various genetic and environmental factors (Citation2). At present, patients with hypertension mainly control their blood pressure through drugs or lifestyle changes. Researchers have shown that approximately 25–60% variability in human hypertension was attributed to multiple genetic factors (Citation3). Studies on genetic factors of hypertension can identify susceptible individuals and provide valuable information and reference for clinical prevention and diagnosis of hypertension.
Folic acid (FA), an essential vitamin B in human body, cannot be synthesized by ourselves and must be obtained from diet. Folic acid deficiency can lead to megaloblastic anemia and neural tube defects in newborns, which are also potential risk factors for hypertension, cardiovascular diseases, and malignancies (Citation4–10). Folic acid deficiency can occur because of the low dietary folic acid intake or hereditary defect of folate metabolism. Methylenetetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) are known as two key enzymes involved in homocysteine (Hcy) and folate metabolism. The deficiencies of these two enzymes’ activities lead to a decrease in folate utilization and an increase in Hcy level, which may eventually induce vascular endothelial injury, cardiovascular disease, diabetes, and cancer (Citation11,Citation12). MTHFR, located at human chromosome 1p36.3, is required to catalyze the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, which is essential for the one-carbon metabolism (Citation13). Two single nucleotide polymorphisms (SNPs), MTHFR C677T (rs1801133), and MTHFR A1298C (rs1801131) have been shown to alter the enzyme activity (Citation14). MTRR gene is present on human chromosome 5p15.2–15.3, which is a related flavoprotein that maintains the methionine synthase enzyme in an active state for the remethylation of Hcy to become methionine (Citation15). MTRR A66G (rs1801394) polymorphism causes the substitution of isoleucine with methionine at codon 22. Researchers have explored the relationship between specific MTHFR or MTRR gene variations and hypertension, but the results were controversial, especially in population-based studies (Citation8,Citation16–21). For example, Wu et al. (Citation17) reported that MTHFR C677T polymorphism was an independent risk factor for hypertension in the Hakka people in southern China. However, no association has been found in the Zhuang population from Guangxi, China (Citation19). Such differences might be caused by different genetic backgrounds, gene linkage disequilibrium, or environments. Therefore, the associations between these variations and hypertension need to be verified in different ethnic groups.
Yunnan province has the largest number of ethnic minorities in China. The hypertension susceptibility genes may show differences in different nationalities because of the genetic and cultural diversity. The Dali Bai Autonomous Prefecture is located in the northwest of Yunnan province. Bai is the major ethnic group that is composed of the majority of the Dali population. The Bai population is at high risk and more prone to develop hypertension due to their high-salt diet and high-altitude environment. So far, very few studies have been performed on the genetic risk factors for hypertension in the Bai population. In the present study, we conducted a case–control study to investigate the potential associations of MTHFR C677T, MTHFR A1298C, and MTRR A66G polymorphisms with hypertension in the Bai population from Yunnan, China. Our study may provide a basis for epidemiological study of hypertension and effective strategies for early prevention of hypertension in the Dali Bai Autonomous Prefecture.
Materials and methods
Study subjects
This study included 613 Bai people (373 hypertensive patients and 240 unrelated healthy controls) recruited from the First Affiliated Hospital of Dali University from January 2021 to June 2022. According to the 2018 Chinese Guidelines for the Prevention and Treatment of Hypertension, the hypertension diagnosis was defined as without taking any antihypertensive drugs, mean systolic blood pressure ≥140 mmHg, and/or diastolic blood pressure ≥90 mmHg after measurement more than three times on different days. Patients suffering from any of the following conditions were excluded from the study: secondary hypertension, chronic liver or kidney diseases, malignant tumors, autoimmune diseases, hematological diseases, and mental diseases. This study was approved by the Medical Ethics Committee of Dali University (No. 202010–21). All participants provided written consent to participate in this study.
Biochemical analysis
After 12-h overnight fasting, 2–3 mL of venous blood was collected, and serum was separated to measure total protein (TP), albumin (ALB), globulin (GLB), albumin/globulin (ALB/GLB), blood urea nitrogen (BUN), creatinine (CREA), uric acid (UA), fasting blood glucose (FBG), fructosamine (FMN), total cholesterol (TC), triglyceride (TG), high-density lipoprotein-cholesterol (HDL-C), low-density lipoprotein-cholesterol (LDL-C), apolipoprotein A1 (APOA1), apolipoprotein B (APOB) levels by using Hitachi 7600 automatic biochemical analyzer (Hitachi Diagnostic Products Shanghai Co., Ltd., model number: Hitachi 7600–120).
Genomic DNA extraction and genotyping
Genomic DNA was extracted from the peripheral blood using a DNA extraction kit (TIANGEN BIOTECH Co., Ltd., Lot Number: DP304) according to the manufacturer’s instructions. Identification of variants MTHFR C677T (rs1801133), MTHFR A1298C (rs1801131), and MTRR A66G (rs1801394) was carried out by using the kompetitive allele-specific PCR (KASP) method as described in a previous paper (Citation22). The primers used in this study are listed below: Forward (C): AAAGCTGCGTGATGATGAAATCGG, Forward (T): AAAGCTGCGTGATGATGAAATCGA and Reverse: TTGAGGCTGACCTGAAGCACTTGA for MTHFR C677T; Forward (A): GGAGGAGCTGACCAGTGAAGA, Forward (C): GGAGGAGCTGACCAGTGAAGC and Reverse: CCCGAGAGGTAAAGAACGAAGACTT for MTHFR A1298C; Forward (A): CATGTACCACAGCTTGCTCACAT, Forward (G): CATGTACCACAGCTTGCTCACAC and Reverse: AGGCAAAGGCCATCGCAGAAGAAAT for MTRR A66G. Genotyping was performed using StepOnePlus Real-Time PCR System (Applied Biosystem, Inc., USA).
Detection of serum Hcy, TNF-α, IL-6, SOD, and MDA levels
After separating the serum, enzyme-linked immunosorbent assays (ELISA) were performed to detect the levels of Hcy (Wuhan Huamei Bioengineering Co., Ltd., Lot Number: CSB-E08895h), tumor necrosis factor alpha (TNF-α) (NOVUS., Lot Number: VAL105), and interleukin 6 (IL-6) (NOVUS, Lot Number: VAL102) following the manufacturer’s instructions. The activity of serum superoxide dismutase (SOD) (Beyotime Biotechnology Co., Ltd., Lot Number: S0109) was examined by using the nitrogen blue tetrazolium (NBT) colorimetric method. The serum malondialdehyde (MDA) (Bryotime Biotechnology Co., Ltd., Lot Number: S0131S) level was examined using the thiobarbituric acid (TBA) method.
Statistical analysis
Statistical analyses were performed using SPSS v.25.0 (SPSS, Inc., Chicago, IL). Hardy–Weinberg equilibrium was calculated using χ2 test. The normally distributed data were shown as the mean ± standard deviation. Student’s t-test was used for comparison between two groups, and one-way ANOVA was used for comparison among three groups. Nonnormally distributed data were represented as the median ± interquartile range. The Wilcoxon signed rank test was used for comparison between the two groups, and the Kruskal–Wallis H test was used for comparison among three groups. Genotype and allele frequencies were compared by χ2 test or Fisher’s exact probability. Logistic regression analysis was applied to the risk assessment for hypertension, and the values were represented by odds ratios (OR) and 95% confidence intervals (95% CI). SHEsisPlus online software (http://shesisplus.bio-x.cn/SHEsis.html) was used for linkage disequilibrium and haplotype analysis. A two-tailed P < .05 was considered to be statistically significant.
Results
General clinical characteristics
This study included 373 patients with hypertension (191 males and 182 females) and 240 unrelated healthy subjects (122 males and 118 females). The clinical characteristics of these two groups are summarized in . The average ages were 56.15 ± 14.47 (ranged from 21 to 93) for hypertensive patients and 54.10 ± 13.64 (ranged from 28 to 88) for the control group. As shown in , age and gender were not significantly different between these two groups, indicating that they had homogeneity. There were statistically significant differences in the prevalence of diabetes and hyperlipidemia. The biochemical variables of the hypertension group presented values that were significantly altered compared to the controls. The hypertensive group had significantly higher levels of BUN, UA, FBG, and TG. However, the levels of TP, ALB, GLB, ALB/GLB, HDL-C, and APOA1 were significantly higher in the control group.
Table 1. Comparison of clinical variables between the hypertensive and control groups.
Genotyping of MTHFR C677T, MTHFR A1298C, and MTRR A66G and Hardy-Weinberg equilibrium
The genotypes of MTHFR C677T, MTHFR A1298C, and MTRR A66G were analyzed by using the KASP method (). No significant deviation from the Hardy-Weinberg equilibrium was identified in the control group (P > .05).
Figure 1. Representation of genotyping of MTHFR C677T (a), MTHFR A1298C (b), and MTRR A66G (c) loci using KASP.
Association of MTHFR C677T, MTHFR A1298C, and MTRR A66G with hypertension
The genotype distributions for all polymorphisms are summarized in . Compared to the control group, the frequencies of CT/TT genotypes of MTHFR C677T and CC genotype of MTHFR A1298C in hypertensive patients were significantly higher. The risk assessments also found that CT/TT genotypes of MTHFR C677T and CC genotypes of MTHFR A1298C were related to an increased predisposition for hypertension. CT and TT genotypes of MTHFR C677T increased the risk of hypertension by 1.429 and 1.970 times, respectively, while CC genotypes of MTHFR A1298C conferred an 8.442-fold increased risk of hypertension. No significant difference was observed in the genotype distribution of MTRR A66G in these two groups. Next, we calculated the risk prediction under dominant, recessive, and overdominant models to identify the predictive properties of these polymorphisms on hypertension risk (). The data show that the MTHFR C677T polymorphism was found to be associated with the development of hypertension in the dominant model (whose odds ratio was 1.517). Additionally, the association between MTHFR A1298C and hypertension was significant under the recessive model, which coffered 7.945-fold risk toward hypertension development. These results indicate that the presence of T allele of MTHFR C677T polymorphism and CC genotypes of MTHFR A1298C polymorphism appeared to be risk factors for the development of hypertension in the Bai population.
Table 2. Genotype distributions and allele frequencies of MTHFR C677T, MTHFR A1298C, and MTRR A66G polymorphisms in the study population and risk analyses of hypertension.
Association of different genotype combinations of MTHFR C677T and MTHFR A1298C polymorphisms with hypertension
Nine genotype combinations could be formed between MTHFRC677T and MTHFR A1298C: CC/AA, CC/AC, CC/CC, CT/AA, CT/AC, CT/CC, TT/AA, TT/AC, and TT/CC. As shown in , the frequencies of CC/CC, CT/AC, TT/AA, and TT/AC genotype combinations in the hypertension group were significantly higher than those in the control group, and conferred 1.204-fold, 2.122-fold, 2.081-fold, and 1.130-fold risk of hypertension, respectively.
Table 3. Different genotype combinations of MTHFR C677T and MTHFR A1298C polymorphisms in hypertension and control groups.
Linkage disequilibrium and haplotype analysis of MTHFR C677T and MTHFR A1298C
The MTHFR C677T (rs1801133) and MTHFR A1298C (rs1801131) polymorphisms were found to be in moderate linkage disequilibrium in the hypertension group and control group (). Four haplotypes could be formed between MTHFR C677T and MTHFR A1298C: C-A, T-A, C-C, and T-C. The haplotype T-C with frequency less than 0.03 was excluded, and three haplotypes (C-A, T-A, and C-C) were finally used for analysis. As shown in , the frequencies of T-A and C-C haplotypes in the hypertension group were significantly higher than those in the control group and conferred 1.517-fold and 1.532-fold risk of hypertension, respectively.
Figure 2. The linkage disequilibrium analysis of MTHFR C677T (rs1801133) (a) and MTHFR A1298C (rs1801131) (b) polymorphisms in the hypertension group and control group.
Table 4. A haplotype analysis of MTHFR C677T and MTHFR A1298C polymorphisms in the hypertension and control groups.
Risk assessment of folic acid utilization capacity and hypertension
The folic acid utilization capacity was further ranked according to the genotypes of MTHFR C677T, MTHFR A1298C, and MTRR A66G. The risk grading standard mainly referred to the Chinese Center for Disease Control and Prevention, which includes four ranks of un-identified risk, lower risk, average risk, and higher risk (). The data showed that the number of people with poor utilization of folic acid was higher in the hypertension group compared to the controls (). People with an average risk for the ability of folate metabolism showed 2.002-fold risk toward hypertension development.
Table 5. Risk assessment of folic acid utilization capacity in the hypertension and control groups.
Association of MTHFR C677T and MTHFR A1298C polymorphisms with glycolipid metabolism indexes
The influence of MTHFR C677T and MTHFR A1298C polymorphisms on glycolipid metabolism index alterations was analyzed in the hypertension group. It was found that the TT genotype of MTHFR C677T could significantly increase the FBG and FMN levels and decrease the APOA1 level in hypertensive patients (). No significance was observed for MTHFR A1298C polymorphisms.
Table 6. The association of the MTHFR C677T and MTHFR A1298C genetic variants with glycolipid metabolism, Hcy, inflammation, and oxidative stress indexes in the hypertension group.
Association of MTHFR C677T and MTHFR A1298C polymorphisms with Hcy, oxidative stress, and inflammatory response
We next analyzed the effects of MTHFR C677T and MTHFR A1298C polymorphisms on Hcy, oxidative stress, and inflammatory response in hypertensive patients. As shown in , the MTHFR C677T variants were significantly associated with elevated Hcy in the hypertensive patients (). We also found that the TT genotype of MTHFR C677T could significantly increase the levels of MDA and decrease the SOD inhibition rate. No significant association was found for MTHFR A1298C polymorphism.
Discussion
Genetic heterogeneity of hypertension susceptibility loci exists in different ethnic groups. To the best of our knowledge, this is the first study to investigate the effects of MTHFR C677T, MTHFR A1298C, and MTRR A66G polymorphisms on hypertension susceptibility in the Bai population of Yunnan, China. We identified a significant association of MTHFR C677T and MTHFR A1298C with the risk of hypertension. MTHFR C677T and MTHFR A1298C genetic variants could significantly increase the hypertension risk among the Bai population.
Previous studies have demonstrated that there is a wide variation in the genotype frequency among different countries and even in the same country but with different ethnicities and geographic regions (Citation23–25). Li et al. (Citation21) reported that MTHFR A1298C locus mutation could affect the level of blood pressure in the Chinese population. In the Korean population, MTRR A66G locus mutation could reduce the risk of hypertension and act as a protective factor against hypertension (Citation26). In the present study, we found an obvious association of MTHFR C677T polymorphism with the hypertension susceptibility in the Bai population, which was similar to the results in Hakka people in southern China (Citation17). However, we failed to establish a significant association between MTRR A66G and hypertension in the present population. Considering that a few studies have investigated the interaction effects of derived allele combinations on hypertension risk, we first performed haplotype analysis for MTHFR C677T and MTHFR A1298C loci. We found that T-A and C-C haplotypes conferred an increased risk toward hypertension of the Bai population. Furthermore, we assessed the hypertension risk according to the folic acid utilization capacity. Interestingly, we found that people with poor utilization of folic acid were more prone to develop hypertension, confirming the direct effect on Hcy metabolism. The number of people with average risk utilization of folic acid was higher in the hypertension group compared to the controls, although no significant difference was observed in the high-risk group because of the limited number of studied population.
Patients with hypertension often have abnormal glucose or lipid metabolism. In fact, many researches focused on the influence of genetic factors on metabolic diseases, and some genetic polymorphisms have been reported to contribute to glycolipid metabolism. For example, KCNJ11, CDKAL1, and SLC2A2 gene polymorphisms could affect blood glucose level (Citation27–29). PPM1K and UCP1 gene polymorphisms could increase TG level and decrease HDL-C level (Citation30,Citation31). However, APOA5 gene mutation could decrease the levels of TC, TG, and LDL-C (Citation32). When we compared the clinical variables between hypertensive patients and the control group, significant changes were observed in FBG, TG, HDL-C, and APOA1. It was also reported that MTHFR C677T could affect the LDL-C level (Citation33,Citation34). Therefore, we focused on these known polymorphisms in the MTHFR gene with the biochemical variables of glycolipid metabolism. Our study showed that MTHFR C677T genetic variants could alter the levels of FBG, FMN, and APOA1 in patients with hypertension. However, Spiridonova et al. (Citation35) found no association between MTHFR C677T and blood lipids in the western Siberian population. These contradictory results certified genetic heterogeneity across regions or ethnic groups.
Studies have demonstrated that the pathophysiological processes of oxidative stress and inflammatory response played roles in the pathogenesis of hypertension (Citation36–39). It is well evident that MTHFR and MTRR have vital roles involved in folic acid metabolism and maintaining Hcy level (Citation40,Citation41). A sustained high level of Hcy is involved in many pathophysiological processes, such as vascular endothelial injury, oxidative stress response, and inflammatory response, and may eventually result in hypertension (Citation42). At present, no attempt has been made to unveil the impact association of MTHFR gene polymorphisms with oxidative stress and inflammatory response. In the present study, we also identified that the variants of MTHFR C677T were significantly associated with elevated Hcy level in hypertensive patients, which was consistent with previous studies. Further analysis showed that the MTHFR C677T variants significantly affected the MDA level and SOD inhibition rate, which suggested that the MTHFR C677T polymorphism was associated with oxidative stress. Although no significant associations were observed in inflammatory variables, the increased levels of TNF-α and IL-6 indicated the potential role of MTHFR C677T polymorphism in inflammatory response. However, a comprehensive study is needed to confirm these potential correlations.
In conclusion, the current findings suggest that the MTHFR C677T and MTHFR A1298C polymorphisms represented important determinant of susceptibility to hypertension in the Bai population from Yunnan, China. Further functional and large, well-designed studies are expected to provide more evidence on how genetic variants of MTHFR affect hypertension susceptibility. Our conclusions were of guiding significance for the prevention and treatment of hypertension folate supplementation in the local region.
Acknowledgments
We are thankful to all the study participants for their contribution and cooperation toward this work. This work was financially supported by the Undergraduate Research Fund of Dali University in 2022 (Grant No. 84) and National Undergraduate Innovation and Entrepreneurship Training Program (Grant No. 202110679036). We thank the reviewers for their insightful comments on this article.
Disclosure statement
No potential conflict of interest was reported by the author(s).
Additional information
Funding
References
- Rivera SL, Martin J, Landry J. Acute and chronic hypertension: what clinicians need to know for diagnosis and management. Crit Care Nurs Clin North Am. 2019 Mar;31(1):97–9. doi:10.1016/j.cnc.2018.11.008.
- Biino G, Parati G, Concas MP, Adamo M, Angius A, Vaccargiu S, Pirastu M, Clarke R. Environmental and genetic contribution to hypertension prevalence: data from an epidemiological survey on Sardinian genetic isolates. PLoS One. 2013;8(3):e59612. doi:10.1371/journal.pone.0059612.
- Manosroi W, Williams GH. Genetics of human primary hypertension: focus on hormonal mechanisms. Endocr Rev. 2019 Jun 1;40(3):825–56. doi:10.1210/er.2018-00071.
- Socha DS, DeSouza SI, Flagg A, Sekeres M, Rogers HJ. Severe megaloblastic anemia: vitamin deficiency and other causes. Cleve Clin J Med. 2020 Mar;87(3):153–64. doi:10.3949/ccjm.87a.19072.
- Gaskins AJ, Chavarro JE. Diet and fertility: a review. Am J Obstet Gynecol. 2018 Apr;218(4):379–89. doi:10.1016/j.ajog.2017.08.010.
- Ingles DP, Cruz Rodriguez JB, Garcia H. Supplemental vitamins and minerals for cardiovascular disease prevention and treatment. Curr Cardiol Rep. 2020 Feb 14;22(4):22. doi:10.1007/s11886-020-1270-1.
- Shulpekova Y, Nechaev V, Kardasheva S, Sedova A, Kurbatova A, Bueverova E, Kopylov A, Malsagova K, Dlamini JC, Ivashkin V. The concept of folic acid in health and disease. Molecules. 2021 Jun 18;26(12):3731. doi:10.3390/molecules26123731.
- Yuan X, Wang T, Gao J, Wang Y, Chen Y, Kaliannan K, Li X, Xiao J, Ma T, Zhang L, et al. Associations of homocysteine status and homocysteine metabolism enzyme polymorphisms with hypertension and dyslipidemia in a Chinese hypertensive population. Clin Exp Hypertens. 2020;42(1):52–60. doi:10.1080/10641963.2019.1571599.
- Tamura T, Kuriyama N, Koyama T, Ozaki E, Matsui D, Kadomatsu Y, Tsukamoto M, Kubo Y, Okada R, Hishida A, et al. Association between plasma levels of homocysteine, folate, and vitamin B12, and dietary folate intake and hypertension in a cross-sectional study. Sci Rep. 2020 Oct 28;10(1):18499. doi:10.1038/s41598-020-75267-3.
- Feng Y, Kang K, Xue Q, Chen Y, Wang W, Cao J. Value of plasma homocysteine to predict stroke, cardiovascular diseases, and new-onset hypertension: a retrospective cohort study. Medi (Baltimore). 2020 Aug 21;99(34):e21541. doi:10.1097/MD.0000000000021541.
- Smith AD, Refsum H. Homocysteine - from disease biomarker to disease prevention. J Intern Med. 2021 Oct;290(4):826–54. doi:10.1111/joim.13279.
- Hasan T, Arora R, Bansal AK, Bhattacharya R, Sharma GS, Singh LR. Disturbed homocysteine metabolism is associated with cancer. Experimental & Molecular Medi. 2019 Feb 21;51(2):1–13. doi:10.1038/s12276-019-0216-4.
- Goyette P, Sumner JS, Milos R, Duncan AM, Rosenblatt DS, Matthews RG, Rozen R. Human methylenetetrahydrofolate reductase: isolation of cDNA, mapping and mutation identification. Nat Genet. 1994 Jun;7(2):195–200. doi:10.1038/ng0694-195.
- Raghubeer S, Matsha TE. Matsha TE. Methylenetetrahydrofolate (MTHFR), the one-carbon cycle, and cardiovascular risks. Nutrients. 2021 Dec 20;13(12):4562. doi:10.3390/nu13124562.
- Wilson A, Platt R, Wu Q, Leclerc D, Christensen B, Yang H, Gravel RA, Rozen R. A common variant in methionine synthase reductase combined with low cobalamin (vitamin B12) increases risk for spina bifida. Mol Genet Metab. 1999 Aug;67(4):317–23. doi:10.1006/mgme.1999.2879.
- Yadav U, Kumar P, Rai V. Distribution of Methionine Synthase Reductase (MTRR) Gene A66G polymorphism in Indian population. Indian J Clin Biochem. 2021 Jan;36(1):23–32. doi:10.1007/s12291-019-00862-9.
- Wu H, Huang Q, Yu Z, Zhong Z. Association of ALDH2 rs671 and MTHFR rs1801133 polymorphisms with hypertension among Hakka people in Southern China. BMC Cardiovasc Disord. 2022 Mar 27;22(1):128. doi:10.1186/s12872-022-02577-x.
- Song J, Hou J, Zhao Q, Liu X, Guo Q, Yin D, Song Y, Li X, Wang S, Wang X, et al. Polymorphism of MTHFR C677T gene and the associations with the severity of essential hypertension in Northern Chinese population. Int J Hypertens. 2020 Oct 14; 1878917. doi: 10.1155/2020/1878917.
- Huang LQ, Wu CX, Wei HQ, Xu G. Clinical characteristics of H-type hypertension and its relationship with the MTHFR C677T polymorphism in a Zhuang population from Guangxi, China. J Clin Lab Anal. 2020 Nov;34(11):e23499. doi:10.1002/jcla.23499.
- Wu YL, Hu CY, Lu SS, Gong FF, Feng F, Qian ZZ, Ding XX, Yang HY, Sun YH. Association between methylenetetrahydrofolate reductase (MTHFR) C677T/A1298C polymorphisms and essential hypertension: a systematic review and meta-analysis. Metabolism. 2014 Dec;63(12):1503–11. doi:10.1016/j.metabol.2014.10.001.
- Li WX, Liao P, Hu CY, Cheng F, Zhang T, Sun YY, Tang L, Wang MM, Liu KS, Liu D, et al. Interactions of methylenetetrahydrofolate reductase gene polymorphisms, folate, and homocysteine on blood pressure in a Chinese hypertensive population. Clin Lab. 2017 Apr 1;63(4):817–25. doi:10.7754/Clin.Lab.2016.160918.
- Urzi F, Pokorny B, Buzan E. Pilot study on genetic associations with age-related sarcopenia. Front Genet. 2021 Jan 11;11:615238. 10.3389/fgene.2020.615238
- Meng H, Huang S, Yang Y, He X, Fei L, Xing Y. Association between MTHFR polymorphisms and the risk of essential hypertension: an updated meta-analysis. Front Genet. 2021 Nov 26;12:698590. 10.3389/fgene.2021.698590
- Jiang S, Zhao R, Pan M, Venners SA, Zhong G, Hsu YH. Associations of MTHFR and MTRR polymorphisms with serum lipid levels in Chinese hypertensive patients. Clinical and Applied Thrombosis/Hemostasis. 2014 May;20(4):400–10. doi:10.1177/1076029612467226.
- Qian XL, Cao H, Zhang J, Gu ZH, Tang WQ, Shen L, Hu JL, Yao ZF, Zhang L, Tang MN, et al. The prevalence, relative risk factors and MTHFR C677T genotype of H type hypertension of the elderly hypertensives in Shanghai, China: a cross-section study: prevalence of H type hypertension. BMC Cardiovasc Disord. 2021 Aug 4;21(1):376. doi:10.1186/s12872-021-02151-x.
- Kim YR, Kang SH, Hong SH. Effects of methionine synthase and methionine synthase reductase polymorphisms on hypertension susceptibility. Genes Genomics. 2020 Apr;42(4):477–83. doi:10.1007/s13258-020-00917-9.
- He B, Li X, Zhou Z. Continuous spectrum of glucose dysmetabolism due to the KCNJ11 gene mutation—Case reports and review of the literature. J Diabetes. 2021 Jan;13(1):19–32. doi:10.1111/1753-0407.13114.
- Ghosh C, Das N, Saha S, Kundu T, Sircar D, Roy P. Involvement of Cdkal1 in the etiology of type 2 diabetes mellitus and microvascular diabetic complications: a review. J Diabetes Metab Disord. 2022 Jan 13;21(1):991–1001. doi:10.1007/s40200-021-00953-6.
- Sansbury FH, Flanagan SE, Houghton JA, Shuixian Shen FL, Al-Senani AM, Habeb AM, Abdullah M, Kariminejad A, Ellard S, Hattersley AT. SLC2A2 mutations can cause neonatal diabetes, suggesting GLUT2 may have a role in human insulin secretion. Diabetologia. 2012 Sep;55(9):2381–85. doi:10.1007/s00125-012-2595-0.
- Hu W, Liu Z, Yu W, Wen S, Wang X, Qi X, Hao H, Lu Y, Li J, Li S, et al. Effects of PPM1K rs1440581 and rs7678928 on serum branched-chain amino acid levels and risk of cardiovascular disease. Ann Med. 2021 Dec;53(1):1316–26. doi:10.1080/07853890.2021.1965204.
- Kieć-Wilk B, Wybrańska I, Malczewska-Malec M, Leszczyńska-Gołabek L, Partyka L, Niedbał S, Jabrocka A, Dembińska-Kieć A.Correlation of the -3826A >G polymorphism in the promoter of the uncoupling protein 1 gene with obesity and metabolic disorders in obese families from southern Poland. J Physiol Pharmacol. 2002 Sep;53(3):477–90. PMID: 12375583.
- Bertoccini L, Sentinelli F, Incani M, Bailetti D, Cimini FA, Barchetta I, Cavallo MG, Cossu E, Lenzi A, Loche S, et al. The Arg282Ser missense mutation in APOA5 gene determines a reduction of triglyceride and LDL-cholesterol in children, together with low serum levels of apolipoprotein A-V. Lipids Health Dis. 2017 Sep 19;16(1):179. doi:10.1186/s12944-017-0569-4.
- Yilmaz H, Agachan B, Isbir T, Akoglu E. Is there additional effect of MTHFR C677T mutation on lipid abnormalities in renal allograft recipients? Transplant Proc. 2003 Jun;35(4):1390–92. doi:10.1016/s0041-1345(03)00454-8.
- Pitsavos C, Panagiotakos D, Trichopoulou A, Chrysohoou C, Dedoussis G, Chloptsios Y, Choumerianou D, Stefanadis C. Interaction between Mediterranean diet and methylenetetrahydrofolate reductase C677T mutation on oxidized low density lipoprotein concentrations: the ATTICA study. Nutr Metab Cardiovasc Dis. 2006 Mar;16(2):91–99. doi:10.1016/j.numecd.2005.04.004.
- Spiridonova MG, Stepanov VA, Pyzyrev VP, Karpov RS. Analiz vzaimosviazi polimorfizma C677T gena metilentetragidrofolatreduktazy s klinicheskimi proiavleniiami koronarnogo ateroskleroza [Relationship between polymorphism C677T of the methylene tetrahydrofolate reductase gene with clinical symptoms of coronary atherosclerosis]. Genetika. 2000 Sep;36(9): pp. 1269–73. Russian. PMID: 11042814.
- Xiao L, Harrison DG. Inflammation in Hypertension. Can J Cardiol. 2020 May;36(5):635–47. doi:10.1016/j.cjca.2020.01.013.
- Mikolajczyk TP, Szczepaniak P, Vidler F, Maffia P, Graham GJ, Guzik TJ. Role of inflammatory chemokines in hypertension. Pharmacol Ther. 2021 Jul;223: 107799.10.1016/j.pharmthera.2020.107799.
- Small HY, Migliarino S, Czesnikiewicz-Guzik M, TJ G. Hypertension: focus on autoimmunity and oxidative stress. Free Radical Biol Med. 2018 Sep;125: 104–15.10.1016/j.freeradbiomed.2018.05.085.
- Barrows IR, Ramezani A, Raj DS. Inflammation, immunity, and oxidative stress in hypertension-partners in crime? Adv Chronic Kidney Dis. 2019 Mar;26(2):122–30. doi:10.1053/j.ackd.2019.03.001.
- Cai W, Yin L, Yang F, Zhang L, Cheng J. Association between Hcy levels and the CBS844ins68 and MTHFR C677T polymorphisms with essential hypertension. Biomed Rep. 2014 Nov;2(6):861–68. doi:10.3892/br.2014.357.
- Liao S, Guo S, Ma R, He J, Yan Y, Zhang X, Wang X, Cao B, Guo H. Association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and H-type hypertension: a systematic review and meta-analysis. Ann Hum Genet. 2022 Sep;86(5):278–89. doi:10.1111/ahg.12468.
- Moretti R, Caruso P. The controversial role of homocysteine in neurology: from labs to clinical practice. Int J Mol Sci. 2019 Jan 8;20(1):231. doi:10.3390/ijms20010231.