The Long non-coding RNA MALAT1 functions as a competing endogenous RNA to regulate vascular remodeling by sponging miR-145-5p/HK2 in hypertension

ABSTRACT

Long non-coding RNAs (LncRNAs) have been found to play a regulatory role in the pathophysiology of vascular remodeling-associated illnesses through the lncRNA-microRNA (miRNA) regulation axis. LncRNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is thought to be involved in proliferation, migration, apoptosis, and calcification of vascular smooth muscle cells (VSMCs). The purpose of this study was to investigate the regulatory role of MALAT1 on vascular remodeling in hypertension. Our data indicate that the expression of MALAT1 is significantly upregulated in hypertensive aortic smooth muscle. Knockdown of MALAT1 inhibited the proliferation, migration, and phenotypic transition of VSMCs induced by Ang II. Bioinformatics analysis was used to predict the complementary binding of miR-145-5p to the 3’-untranslated region of MALAT1. Besides, the expressions of MALAT1 and miR-145-5p were negatively correlated, while luciferase reporter assays and RNA immunoprecipitation assay validated the interaction between miR-145-5p and MALAT1. The proliferation, migration and phenotypic transformation of VSMCs induced by overexpression of MALAT1 were reversed in the presence of miR-145-5p. Furthermore, we verified that miR-145-5p could directly target and bind to hexokinase 2 (HK2) mRNA, and that HK2 expression was negatively correlated with miR-145-5p in VSMCs. Knockdown of HK2 significantly inhibited the effects of overexpression of MALAT1 on Ang II-induced VSMCs proliferation, migration and phenotypic transformation. Taken together, the MALAT1/miR-145-5p/HK2 axis may play a critical regulatory role in the vascular remodeling of VSMCs in hypertension.

KEYWORDS:

• MALAT1
• hypertension
• miR-145-5p
• HK2
• vascular remodeling

Introduction

Hypertension is the leading preventable risk factor for cardiovascular disease (CVD) and all-cause mortality worldwide. It is estimated that 31.1% of the global adult population (1.39 billion) worldwide had hypertension in 2010.¹ Hypertension encompasses multiple risk factors, including high sodium intake, low potassium intake, alcohol consumption, obesity, lack of physical activity, and unhealthy diet.¹ The vascular remodeling, a remarkable feature of hypertension, is typically characterized by vascular tissue rearrangement, increased cross-sectional area, narrowing of the vessel lumen, and increased collagen deposition.² Vascular remodeling reflects protective and adaptive changes in the vessel wall in response to various stimuli.³ However, prolonged hypertension-induced vascular remodeling leads to increased vascular resistance, luminal narrowing, depletion of the compensatory capacity of the vascular system, and triggers cardiovascular events.⁴ The abnormal proliferation and migration of vascular smooth muscle cells (VSMCs) play pivotal roles in vascular remodeling.⁵ Therefore, it is extremely important to further explore the mechanism of VSMCs remodeling and explore new therapeutic options for the clinical treatment of hypertension.

Long non-coding RNAs (lncRNAs) are a class of functional RNA molecules that are typically transcribed for more than 200 nucleotides in eukaryotic cells, which is known as the “noise” of the transcription process.⁶ LncRNAs have important functions in transcriptional silencing, transcriptional activation, chromosome modification, and intranuclear transport.⁷ Metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) is a highly conserved lncRNA.⁸ It has been reported that MALAT1 is highly expressed in hypertensive patients and hypertensive rats, and down-regulated MALAT1 improved the vascular lesions and remodeling in hypertensive rats by inhibiting the Notch signaling pathway.⁹ Moreover, knockdown of MALAT1 inhibited smooth muscle cell proliferation and suppressed cardiac hypertrophy in mice with hypertension.¹⁰ Meanwhile, MALAT1 was found to be associated with apoptosis and calcification of VSMCs.^11,12 This suggests an important role for MALAT1 in regulating vascular remodeling in hypertension.

Competing endogenous RNA (ceRNA) is the most widely studied mechanism for lncRNAs, which competitively sponge target miRNAs and abolish the repressive effects of miRNA on downstream target genes.¹³ Bioinformatic analysis revealed that lncRNA MALAT1 could bind to miR-145-5p efficiently. It was reported that the expression of microRNA (miRNA)-145-5p was downregulated in the thoracic aortas of SHR rats compared with WKY rats.⁵ In addition, the roles of miR-145-5p on cell proliferation and migration in tumors and pulmonary hypertension have been widely recognized.^14,15 However, research on the interactions of MALAT1 and miRNAs in primary hypertension is limited.

The purpose of our study was to investigate the pathophysiology of MALAT1 in essential hypertension. Our findings demonstrated that MALAT1 expression was up-regulated in the thoracic aorta of hypertension mice and angiotensin II (Ang II)-induced VSMCs. Furthermore, knockdown of MALAT1 inhibited the proliferation and migration of VSMCs induced by Ang II. MALAT1 was also shown to be a ceRNA for miR-145-5p. MALAT1 was involved in the phenotypic transformation of VSMCs by binding to miR-145-5p to form a molecular sponge, which increased the expression of the downstream target gene hexokinase 2 (HK2). The current findings contribute to what is currently accepted regarding the role of MALAT1 in essential hypertension and may provide new therapeutic targets and biomarkers for treatment.

Method

Animals

C67BL/6J, 10–12 weeks old, weighing 20–22 g, were obtained from Beijing Animal Laboratory. Mice were fed at room temperature (~25°C) with a standard 12-hour light-dark cycle and appropriate humidity. All animal care and laboratory protocols were in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health.

Isolation of mouse aortic smooth muscle cells

Adult male C57BL/6J (weighing approximately 22 g) were culled by cervical dislocation. The mouse aorta was rapidly isolated according to a previous study, and the aortic intima and periaorta were separated by enzymatic digestion, followed by the isolation of smooth muscle cells. The isolated cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, Grand Island, NY, USA) with 10% fetal bovine serum and, 1% v/v penicillin/streptomycin (Beyotime, Shanghai, China). Cells were maintained at 5% CO₂ and 37°C in an incubator for subsequent experiments.

Cell viability assay

To detect the rate of cell proliferation, VSMCs were seeded into 96-well plates. The cultured VSMCs (70%-80% confluent) were treated with vehicle (0.1% DMSO) or Ang II (1.0 μmol/L, MedChemexpress, Monmouth Junction, NJ, USA) for 12 h or 24 h after lncRNA siRNA or NC siRNA intervention. 10 μL of CCK-8 (MedChemexpress, Monmouth Junction, NJ, USA) reagent was added into each well, and the OD value was determined using a microplate reader at 450 nm wavelength (ThermoFisher, Waltham, MA, USA).

EdU staining

According to the kit instructions, BeyoClick™ EdU-594 Cell Proliferation Assay Kit (Beyotime, Shanghai, China) was used for EdU staining. Cells were inoculated on a 24-well plate with glass crawl sheets and stained with 50 μM EdU for 2 h, followed by fixation with 50 μL of 4% paraformaldehyde for 15 min. Subsequently, the cells were stained with Click reaction solution for 10 min. Pictures were acquired by using a fluorescence microscope (Olympus, Tokyo, Japan).

Wound healing assay

Cell migration capacity was determined by the scratch method.¹⁴ VSMCs were inoculated in 24-well plates for 24 h until the cells were 80–90% confluent. A sterile 1 μl pipette was used to create linear wound traces and the cells were rinsed three times with sterile PBS to remove non-adherent cells. Subsequently, light microscopy was used to photograph cell gaps at 0 h, 12 h or 24 h to assess the cell migration capacity by determining the distance between multiple random cell gaps.

RNA extraction and real-time PCR

Total RNA was extracted from cultured VSMCs using the RNAiso Plus reagent and cDNA was synthesized using the PrimeScript™ RT Master Mix System kit according to the manufacturer’s instructions (TaKaRa, Tokyo, Japan). The cDNA was then subjected to qRT-PCR using the SYBR Green Premix Ex Taq^TM and Thermal Cycler Dice™ Real. Relative quantification was performed according to the 2^−ΔΔCt method and normalized to GAPDH. The PCR primer sequences used in the experiments were shown in Table 1.

Table

MALAT1 F	GCAGGCGTTGTGCGTAGAG
MALAT1 R	TTGCCGACCTCACGGATT
MiR-145-5p F	CTCACGGTCCAGTTTTCCCA
MiR-145-5p R	ACCTCAAGAACAGTATTTCCAGG
HK2 F	GAGCCACCACTCACCCTACT
HK2 R	CCAGGCATTCGGCAATGTG
GAPDH F	AGGTCGGTGTGAACGGATTTG
GAPDH R	TGTAGACCATGTAGTTGAGGTCA

Plasmid, ASO-miRNA and siRNA transfection

VSMCs were seeded into 6-well plates for 24 hours. Subsequently, lncRNA MATAL1, miR-145-5p, and HK2 overexpression plasmids or si-lncRNA MALAT1, ASO-miR-145-5p, and si-HK2 (RiboBio, Guangzhou, China) were transfected with liposomal Lipofectamine 2000 in serum-free medium according to the manufacturer’s instructions. 24 hours after transfection, the medium was replaced with normal culture medium.

Western blotting

Total proteins were extracted from VSMCs using Western and IP cell lysates (Beyotime, Shanghai, China). The homogenate was sonicated, centrifuged at 12 000 g for 30 min, and then quantified using the BCA kit (Beyotime, Shanghai, China). Protein samples (50 μg) were separated by SDS-PAGE using a 10% polyacrylamide gel and subsequently transferred to nitrocellulose membranes, which were incubated with a primary antibody overnight at 4°C. Protein bands were visualized on a gel imaging system (FluorChem FC3, Alpha, USA) by ECL Western Blotting Substrate (PE0010, Solarbio, China).

The above primary antibodies included: α-SMA antibody (1:1000, 42 kDa 14 395–1-AP, proteintech, Wuhan, China), TAGLN antibody (1:2000, 23 kDa, ab213273, Abcam, UK), cyclin D1 antibody (1:1000, 34 kDa, ab16663, Abcam, UK), PCNA antibody (1:10000, 38 kDa 10 205–2-AP, proteintech, Wuhan, China), HK2 antibody (1:10000, 41 kDa, ab209847, Abcam, UK), β-actin antibody (1:20000, 41 kDa 81 115–1-RR, proteintech, China), secondary antibodies included goat anti-rabbit (1:10000, ab205718, Abcam, UK) and goat anti-mouse (1:10000, ab6789, Abcam, UK). β-actin was used as an internal control.

Luciferase reporter assay

VSMCs were inoculated into 48-well plates 24 hours in advance. We transfected HEK-293 cells with pmirGLO-MALAT1-wt/mut, pmirGLO-HK2 3’UTR-wt/mut and miR-145-5p or ASO-miR145-5p. After 36 h, the cells were lysed. We detected the fluorescence activity using the Dual-Lucy Assay Kit (Solarbio, Beijing, China).

RNA pulldown

The RNA-binding protein immunoprecipitation kit (17–700, Millipore, USA) was used to confirm the interaction between miR-145-5p and MALAT1. Briefly, VSMCs were lysed using RIP lysis buffer for 5 min on ice. AgO2 antibody (1:50, #2897, Cell Signalling Pathway, USA) or IgG antibody (1:1000, #2729, Cell Signalling Pathway, USA) was incubated with magnetic beads for 30 min at room temperature. The supernatant of the cell lysate was incubated with the magnetic beads-antibody complex for 3 h. The precipitate was washed with RIP Wash Buffer and separated. Subsequently, the precipitate was resuspended in 150 μL of Proteinase K Buffer and incubated at 55°C for 30 min. RNA was extracted from the precipitates and the enrichment of miR-145-5p or MALAT1 in the precipitates was measured by qRT-PCR.

Statistics

Data are expressed as mean ± standard error (SEM). The student t-test was used to compare the differences between the two groups. One-way analysis of variance (ANOVA) and Tukey post-hoc tests were used for multiple comparisons. All statistical analyses were performed using GraphPad Prism 8 software (LaJolla, CA). P < .05 indicates a significant difference.

Result

LncRNA MALAT1 is elevated in Ang II-Induced hypertension mice

To clarify the expression of lncRNA MALAT1 in the aortic smooth muscle of hypertensive mice. The mice were infused with Ang II (1.44 mg/kg body weight/d) for 28 days. Our results showed that mice pumped with Ang II had significantly higher blood pressure and higher expression of lncRNA MALAT1 in the aorta (Figure 1a,b). Meanwhile, the thoracic aortic smooth muscle cells were isolated and we detected a significant increase in the expression of lncRNA MALAT1 after stimulation with Ang II in vitro (Figure 1c). The above results indicate that an Ang II-induced hypertension model was successfully constructed, and lncRNA MALAT1 was elevated in hypertension.

Figure 1. LncRNA MALAT1 is elevated in Ang II-Induced hypertension mice. (a) SBP was measured in mice every 7 days after Ang II infusion by the tail-cuff method (SBP: systolic blood pressure, Ang II: angiotensin II, n = 6). Expressions of lncRNA MALAT1 in the aorta of Ang II-induced hypertensive mice (b) and in Ang II-stimulated VSMCs (c) were detected by qRT-PCR (VSMCs: vascular smooth muscle cells, *p < .05 vs. saline, n = 6). The data were presented as the means ± SEM.

Knockdown of MALAT1 suppresses Ang II-induced biological behavior of VSMCs

To further investigate the effect of lncRNA MALAT1 on the biological features of hypertension, we designed the siRNA of lncRNA MALAT1 to knockdown its endogenous expression and the knockdown efficiency of lncRNA MALAT1 was confirmed by qRT-PCR (Figure 2b). To test the effect of lncRNA MALAT1 on the proliferation and migration of VSMCs, we transfected si-NC and si-lncRNA MALAT1. We found that transfection with si-lncRNA MALAT1 was effective against Ang II-induced VSMCs proliferation (Figure 2b). Meanwhile, EdU staining also showed that lncRNA MALAT1 knockdown reversed the Ang II-induced promotion of EdU-positive cell percentage (Figure 2c,d). In addition, the migration of VSMCs was observed to increase with Ang II treatment, but knockdown of lncRNA MALAT1 blocked the effect (Figure 2e,f). We similarly found that knockdown of MALAT1 inhibited Ang II-induced proliferation (Cyclin D1, PCNA) and phenotypic transformation (TAGLN, α-SMA) of VSMCs (Figure 2g,h). Therefore, our results reveal that knockdown of lncRNA MALAT1 significantly inhibits Ang II-induced cell proliferation and migration.

Figure 2. Knockdown of MALAT1 suppresses Ang II-Induced biological behavior of VSMCs. (a) the efficiency of lncRNA MALAT1 knockdown was assessed by qRT-PCR (*p < .05 vs. si-NC, n = 3). (b-d) CCK-8 and EdU assays were used to detect the proliferation of VSMCs cells after lncRNA MALAT1 knockdown (Ang II: angiotensin II, CCK-8: cell counting kit-8, EdU: 5-ethynyl-2’-deoxyuridine, *p < .05 vs. saline, ^#p < .05 vs. Ang II + si-NC, n = 3, scale bar = 50 μm). (e, f) the migratory capacity of lncRNA MALAT1-silenced VSMCs was assessed by wound healing (*p < .05 vs. saline, ^#p < .05 vs. Ang II + si-NC, n = 3, scale bar = 100 μm). (g, h) Western blots were used to detect a-SMA, TAGLN, cyclin D1 and PCNA levels. The immunoblots were calculated by densitometric analysis using β-actin as the internal reference (*p < .05 vs. saline, ^#p < .05 vs. Ang II + si-NC, n = 3). The data were presented as the means ± SEM.

MALAT1 functions as a CeRNA for MiR-145-5p

LncRNAs often act as miRNA sponges, mediating target genes to modulate downstream target genes. Therefore, we screened the database for target genes of LncRNA MALAT1 and chose miR-145-5p (Figure 3a) for further experiments. We thus found that the expression of miR-145-5p was significantly decreased in the aorta of hypertensive mice and Ang II-stimulated VSMCs (Figure 3b,c). Furthermore, we found that the luciferase activity decreased when WT-LncRNA MALAT1 and miR-145-5p mimic were co-transfected into VSMCs. However, when MUT-LncRNA MALAT1 and miR-145-5p mimic were co-transfected into VSMCs, there was no significant change in luciferase activity (Figure 3d). Meanwhile, knockdown of LncRNA MALAT1 significantly promoted miR-145-5p expression (Figure 3e). In conclusion, the above results suggest that LncRNA MALAT1 binds competitively to miR-145-5p.

Figure 3. MALAT1 functions as a ceRNA for MiR-145-5p. (a) Bioinformatics website http://starbase.Sysu.edu.cn/prediction of lncRNA MALAT1 and miR-145-5p. Expression of miR-145-5p in the aorta of Ang II-induced hypertensive mice (b) and in Ang II-stimulated VSMCs (c) were detected by qRT-PCR (Ang II: angiotensin II, VSMCs: vascular smooth muscle cells, *p < .05 vs. saline, n = 6). (d) a dual luciferase reporter gene assay was used to detect luciferase activity in VSMCs co-transfected with lncRNA MALAT1 WT/MUT and miR-145-5p M/MC (*p < .05 vs. MALAT-WT MC, n = 3). (e) the targeting relationship between miR-145-5p and lncRNA MALAT1 was detected by the RNA binding protein immunoprecipitation method (*p < .05 vs. si-NC, n = 3). The data were presented as the means ± SEM.

MALAT1 impacts the biological behavior of VSMCs via modulating MiR-145-5p

The above study has clarified the role of MALAT1 as a ceRNA in the regulation of miR-145-5p. However, whether miR-145-5p was involved in lncRNA-MALAT1 to regulate VSMCs? Our data found that the transfection of pcDNA-MALAT1 upregulated lncRNA-MALAT1 expression in VSMCs, while miR-145-5p expression was decreased, which was reversed by co-transfection with miR-145-5p mimic (Figure 4a,b). Meanwhile, lncRNA-MALAT1 upregulation promoted VSMCs proliferation, as indicated by EdU staining and cell viability assays, which were all reversed by co-transfection of miR-145-5p (Figure 4c–e). In addition, we found that the migration of VSMCs promoted by lncRNA-MALAT1 was inhibited in the presence of miR-145-5p (Figure 4f,g). The above data suggest that lncRNA-MALAT1 promotes Ang II-induced VSMCs proliferation and migration by regulating miR-145-5p.

Figure 4. MALAT1 impacts the biological behavior of VSMCs via modulating MiR-145-5p. (a) the efficiency of lncRNA MALAT1 overexpression was assessed by qRT-PCR (*p < .05 vs. pcDNA 3.1, n = 3). (b) expression of miR-145-5p in VSMCs was detected by RT-qPCR after co-transfection of pcDNA 3.1 lncRNA MALAT1 and miR-145-5p mimic (VSMCs: vascular smooth muscle cells, *p < .05 vs. pcDNA 3.1, ^#p < .05 vs. pcDNA 3.1-MALAT1 + mimic NC, n = 3). (c-e) CCK-8 and EdU assays were used to detect the proliferation of Ang II-induced VSMCs cells after lncRNA MALAT1 knockdown (CCK-8: cell counting kit-8, EdU: 5-ethynyl-2’-deoxyuridine, *p < .05 vs. pcDNA 3.1, ^#p < .05 vs. pcDNA 3.1-MALAT1 + mimic NC, n = 3, scale bar = 50 μm). (f, g) migratory capacity of lncRNA MALAT1 overexpression on Ang II-induced VSMCs was assessed by wound healing assay (*p < .05 vs. pcDNA 3.1, ^#p < .05 vs. pcDNA 3.1-MALAT1 + mimic NC, n = 3, scale bar = 100 μm). The data were presented as the means ± SEM.

HK2 is a direct target of MiR-145-5p

Recent studies have shown that the binding of lncRNAs to miRNAs releases the inhibitory effect of miRNAs on their target genes.¹⁶ Bioinformatics analysis was used to predict that HK2 might be a target gene of miR-145-5p (Figure 5a). Therefore, HK2 3’UTR containing miR-145-5p binding sites were generated. The luciferase activity was significantly lowered in VSMCs co-transfected with pmirGLO-HK2 3’UTR-wt and miR-145-5p compared to the control group, while the luciferase activity was significantly increased after co-transfection of pmirGLO-FGF10 3’UTR-wt with a miR-145-5p inhibitor. However, there was no significant difference in the co-transfection of pmirGLO-HK2 3’UTR-mut and miR-145-5p (Figure 5b). We then found that HK2 expression was upregulated in the aorta of hypertensive mice and Ang II-induced VSMCs (Figure 5d–g). Furthermore, we examined the protein and mRNA expression of HK2 under different expression levels of miR-145-5p. The results showed that overexpression of miR-145-5p decreased the expression of FGF10 mRNA and protein, while knockdown of miR-145-5p increased the expression of FGF10 mRNA and protein (Figure 5c,h,i). The above results suggest that HK2 is a direct target of miR-145-5p.

Figure 5. HK2 is a direct target of MiR-145-5p. (a) putative binding sites between miR-145-5p and HK2. (b) a dual luciferase reporter gene assay was used to detect luciferase activity in VSMCs co-transfected with miR-145-5p and HK2 3’UTR-wt fragment or HK2 3’UTR-mut (*p < .05 vs. mimic NC, ^#p < .05 vs. inhibitor NC, n = 3). (c) the targeting relationship between miR-145-5p and MALAT1 was detected by RNA pulldown (*p < .05 vs. mimic NC, ^#p < .05 vs. inhibitor NC, n = 3). (d, e) Western blot was used to detect the expression of HK2 in aorta of hypertensive mice (*p < .05 vs. normal, n = 3). (f, g) Western blot was used to detect the expression of HK2 in Ang II-induced VSMCs (*p < .05 vs. saline, n = 3). (h, i) HK2 expression in Ang II-induced VSMCs after downregulation or elevation of miR-145-5p detected by Western blot (*p < .05 vs. mimic NC, ^#p < .05 vs. inhibitor NC, n = 3). The data were presented as the means ± SEM.

MALAT1 impacts the biological behavior of VSMCs via modulating MiR-145-5p/HK2 pathway

To further clarify whether lncRNA MALAT1 affected Ang II-induced VSMCs proliferation and migration by regulating the miR-145-5p/HK2 axis, we co-transfected pcDNA-lncRNA MALAT1 and si-HK2 into Ang II-induced VSMCs. The results showed that transfection of pcDNA-lncRNA MALAT1 alone increased the proliferation, migration and phenotype switching of VSMCs, as demonstrated by EdU staining, cell viability assay, cell scratch assay and western blots. However, the above effects were inhibited with si-HK2 co-transfection (Figure 6a–g). In brief, lncRNA MALAT1 regulates Ang II-induced VSMCs proliferation, migration and phenotype switching through the miR-145-5p/HK2 axis.

Figure 6. MALAT1 impacts the biological behavior of VSMCs via modulating MiR-145-5p/HK2 Pathway. (a-c) CCK-8 and EdU assays were used to detect the proliferation of Ang II-induced VSMCs cells after lncRNA MALAT1 overexpression and HK2 knockdown (CCK-8: cell counting kit-8, EdU: 5-ethynyl-2’-deoxyuridine, con: control, n = 3, scale bar = 50 μm). (d, e) migratory capacity of lncRNA MALAT1 overexpression and HK2 knockdown on Ang II-induced VSMCs was assessed by wound healing assay (n = 3, scale bar = 100 μm). (f, g) Western blots were used to detect a-SMA, TAGLN, cyclin D1 and PCNA levels. The immunoblots were calculated by densitometric analysis using β-actin as the internal reference (n = 3). *p < .05 vs. pcDNA 3,1 + si-NC, ^#p < .05 vs. pcDNA 3.1-lncRNA MALAT1 + si-NC. The data were presented as the means ± SEM.

Discussion

The discovery of lncRNAs as key regulatory genes has greatly improved our understanding of the complex mechanisms involved in the pathology of various diseases.¹⁷ Studies have shown that lncRNA MALAT1 plays a key role in a variety of cardiovascular diseases, including myocardial infarction, heart failure, and pulmonary hypertension.^18–20 When it comes to hypertension, lncRNA MALAT1 expression was increased in hypertensive patients and rats, and suppression of its expression successfully lowered blood pressure.⁹ In addition, lncRNA MALAT1 promotes ventricular remodeling in hypertensive rats by inhibiting MyoD.²¹ lncRNA MALAT1 has also been reported to regulate pregnancy-induced hypertension by modulating miR-150-5p/ET1.²² In our study, the Ang II-induced hypertensive mice were first constructed and we found that lncRNA MALAT1 expression was increased in the hypertensive thoracic aorta. Subsequently, we found that knockdown of lncRNA MALAT1 inhibited cell proliferation and migration in VSMCs. The western blots showed that Ang II-induced phenotypic transformation of VSMCs (downregulation of a-SMA, TAGLN, and upregulation of cyclin D1, PCNA) was reversed after knockdown of lncRNA MALAT1. These data suggest that lncRNA MALAT1 is involved in the vascular remodeling of hypertension.

Superimposed on genomic and epigenomic programs, lncRNA establishes a novel regulatory mode by interacting with proteins and nucleic acids to regulate gene expression.²³ There are now three primary ways to regulate lncRNAs. The first is through binding to proteins and controlling their intracellular activity, which in turn controls the expression of downstream genes. The second is to inhibit RNA polymerase II, chromatin remodeling, and histone modification to affect downstream genes.⁵ In addition, lncRNA, as an endogenous RNA, acts as a molecular sponge that binds to miRNAs and inhibits their expressions and activities, which is the most widely studied mechanism called endogenous competitive RNA (ceRNA).²⁴ In the bioinformatics prediction of lncRNA MALAT1, miR-145-5p was screened as a molecular adsorbent of lncRNA MALAT1 for further study. Meanwhile, the regulatory role of miR-145-5p in hypertension has been clearly reported.²⁵ Subsequently, the binding of lncRNA MALAT1 to miR-145-5p was confirmed by a dual luciferase reporter assay and RNA pulldown, and the negative correlation was verified by qPCR. In addition, we found that overexpression of lncRNA MALAT1 promoted the proliferation and migration of VSMCs, which was reversed in the presence of miR-145-5p mimic. Overall, our results suggest that lncRNA MALAT1 regulates VSMCs by binding to miR-145-5p and inhibiting its expression.

As a short non-coding RNA, miRNA functions primarily by inhibiting the expression of downstream target genes.²⁶ Bioinformatics prediction was used to select HK2 as a target gene for miR-145-5p. HK is a key enzyme in glycolysis.²⁷ HK2 is a crucial protease that regulates the rate of glycolysis in VSMCs and has a significant impact on the cell proliferation and migration of VSMCs.²⁸ However, whether HK2 is associated with the lncRNA MALAT1-regulated phenotypic transformation of VSMCs has not been confirmed. We found that miR-145-5p could negatively regulate HK2 expression by binding to its 3 ‘UTR in dual luciferase reporter assays. In addition, we found that knockdown of HK2 inhibited lncRNA MALAT1 to promote proliferation, migration and phenotypic transformation of VSMCs. Therefore, we conclude that lncRNA MALAT1/miR-145-5p/HK2 regulates vascular remodeling in hypertension.

Taken together, our findings confirm that the lncRNA MALAT1 is an important regulator of VSMCs proliferation, migration, and phenotypic transformation, which is mediated by the miR-145-5p/HK2 axis. Our study provides new therapeutic options for the mechanism and clinical management of hypertension.

Author contribution

FP and JY conceived and designed research; JY, GJ, LH, ZL, RJ AND GC performed experiments; FP and JY interpreted results of experiments; JC, HZ, LC and XC analyzed data; JY and FP drafted manuscript; GJ and LH prepared figures; JY and FP edited and revised manuscript; FP approved final version of manuscript.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

The National Natural Science Foundation of China (81960089), the Natural Science Foundation of Chongqing (cstc2020jcyj- msxmX1031), the Joint Medical Research Project of Chongqing Science and Health (2019MSXM096).