Small RNA-big impact: exosomal miRNAs in mitochondrial dysfunction in various diseases

ABSTRACT

Mitochondria are multitasking organelles involved in maintaining the cell homoeostasis. Beyond its well-established role in cellular bioenergetics, mitochondria also function as signal organelles to propagate various cellular outcomes. However, mitochondria have a self-destructive arsenal of factors driving the development of diseases caused by mitochondrial dysfunction. Extracellular vesicles (EVs), a heterogeneous group of membranous nano-sized vesicles, are present in a variety of bodily fluids. EVs serve as mediators for intercellular interaction. Exosomes are a class of small EVs (30–100 nm) released by most cells. Exosomes carry various cargo including microRNAs (miRNAs), a class of short noncoding RNAs. Recent studies have closely associated exosomal miRNAs with various human diseases, including diseases caused by mitochondrial dysfunction, which are a group of complex multifactorial diseases and have not been comprehensively described. In this review, we first briefly introduce the characteristics of EVs. Then, we focus on possible mechanisms regarding exosome-mitochondria interaction through integrating signalling networks. Moreover, we summarize recent advances in the knowledge of the role of exosomal miRNAs in various diseases, describing how mitochondria are changed in disease status. Finally, we propose future research directions to provide a novel therapeutic strategy that could slow the disease progress mediated by mitochondrial dysfunction.

KEYWORDS:

• Exosome
• miRNA
• mitochondrial dysfunction
• diseases
• Extracellular vesicle

Introduction

Mitochondria play a multifunctional role in the maintenance of cell homoeostasis. They are important organelles involved in energy metabolism, stress responses and biosynthetic processes [1,2]. Beyond its most well-known cellular bioenergetics, mitochondria are also essential to propagate many important cellular outcomes by conveying information through their possible role as signal organelles [1,3]. Mitochondria initiate multiple mechanisms to adapt to environmental changes, including mitophagy, mitochondrial fission and fusion and oxidative phosphorylation changes [4]. However, a deleterious consequence of this cellular process is the side-products of these reactions that are generated as a self-destructive arsenal of factors [5], including mitochondrial reactive oxygen species (mROS) [6]. Abnormal mitochondrial function and structure affect cell homoeostasis, and thereby contribute to the initiation and development of multiple diseases caused by mitochondrial dysfunction. For example, mROS may cause changes in some biological molecules, including nuclear gene expression, and initiate the formation of new radical species [6]. A dysfunctional interplay between mROS and Ca²⁺ has been the subject of numerous studies, especially in cardiac pathologies [7,8], However, the mechanism of diseases caused by mitochondrial dysfunction is complex and poorly understood. The emerging intercellular communication mechanism mediated by extracellular vesicles (EVs) has drawn attention in recent years.

Exosomes are a class of small EVs that have a particle size of approximately 30–100 nm and are derived from most human cells. These vesicles carry functional cargoes, including nucleic acids [DNA, mRNA, and noncoding RNA species, metabolites (e.g. lipids) and proteins (cytosolic, nuclear, membrane proteins and extracellular matrix proteins) [9,10]. Serving as mediators by encapsulating cargoes (especially miRNAs), exosomes widely mediate the crosstalk between multiple organs under pathophysiological conditions [9,11,12]. Among these cargoes, microRNAs (miRNAs) have garnered the most attention, because of their involvement in regulating gene expression. miRNAs are a class of short noncoding RNAs with 19–25 nucleotides in length [13]. Exosomal miRNAs (Exo-miRs) have been involved in the pathophysiology of a variety of diseases [14–17]. They are more stable in exosomes, because of the protection of the double membrane, than as free miRNAs themselves [13]. Evidence is accumulating that exo-miRs emerge as critical regulators in the progression of mitochondrial dysfunction in various diseases [14–17]. Change in mitochondrial morphology and function is not only the consequence of direct stimulation of environmental changes, but also the possibly indirect effect of exosomes derived from the different pathological status of cells. The release of exosomes allows cells to act on the mitochondria of target cells by transferring miRNAs [4,18]. Dysregulated expression of miRNAs in exosomes leads to mitochondrial dysfunction, mainly through multiple processes, including mitophagy, mitochondria-dependent apoptosis, mitochondrial complex inactivity, mitochondrial calcium overload, abnormal mitochondrial biogenesis and mitochondrial DNA (mtDNA) damage [14–17]. For the EV field to progress, it is of great significance to describe their roles in mitochondrial dysfunction in various diseases in a comprehensive manner.

In this review, we attempt to comprehensively and critically update the role of exosomes in diseases caused by mitochondrial dysfunction. We describe that mitochondria as signalling organelles can interact with exo-miRs by integrating signalling networks. We then review recent literatures regarding the involvement of exo-miRs in various diseases mediated by mitochondrial dysfunction.

Characteristics of exo-miRs

Exosome biogenesis

EVs refer to a heterogeneous group of membranous nano-sized particles that are derived from various cell types. These vesicles contain functional biomolecules and mediate intercellular communication [19–21]. The biological characteristics of EVs have been recognized and reviewed extensively elsewhere [22,23]. First described in the 1980s, EVs were restricted to be considered as a waste disposal system for cells [24,25]. However, EVs contain functional cargoes and have been found in different biological fluids, including plasma [15,16], urine [26], saliva [27] and cerebrospinal fluid [28]. They are now generally accepted as mediators involved in intercellular communications and signalling transduction between most cell types. Different types of EVs vary in biogenesis, size and mechanism of secretion [19,23]. Exosomes are small vesicles, with a diameter of 30–100 nm, formed by dynamic exocytosis. Exosomes originate from endosomes, after sagging inward to form intraluminal vesicles within multivesicular bodies [9,11]. Besides, emerging evidence supports a more complicated exosomal subpopulation system than previously thought. The novel subgroups of exosomes can be classified as low- and high-density fractions [29].

According to previous studies, parent cells have a sorting mechanism that directs selective intracellular miRNAs towards exosomes. There are four potential sorting pathways of miRNAs into the exosomes [30], including: 1) The neural sphingomyelinase 2 (nSMase2)-dependent pathway [31]; 2) The miRNA motif and sumoylated heterogeneous nuclear ribonucleoproteins (hnRNPs)-dependent pathway [32]; 3) The 3’-end of the miRNA sequence-dependent pathway [33,34]; 4) The miRNA induced silencing complex (miRISC)-related pathway [34,35]. Thus, exosomal incorporation of miRNAs may be directed by the specific sequence of miRNAs, or by enzymes/other proteins in a miRNA sequence-independent manner.

Regarding the process of exosome secretion, the interaction between Rab GTPases and SNARE proteins regulates the biogenesis and secretion of exosomes [36]. Rab GTPases, the most prevalent protein family within the Ras superfamily of GTPases, are crucial in intracellular vesicle transport, including multivesicular bodies (MVBs) trafficking to lysosomes and endosome recycling. Rab27 is found to be responsible for transmitting endolysosomal vesicles to the plasma membrane [37], and Rab27b shares common function with Rab27a in endosomal recycling by HeLa cells, although their subcellular localizations are different [38]. Rab11 and Rab35, which function in late endosomal compartments recycling, affect the secretion of exosomal cargoes in oligodendrocytes and the neuromuscular junction of drosophila [39,40]. Moreover, Rab2b, Rab5a, and Rab9 also contribute to promoting exosome secretion [38]. However, it has been shown that Rab7 May decrease the level of exosomal secretion [41]. Additionally, SNARE proteins (T-SNARE syntaxin 5 [42], T-SNARE SNAP23 [43] and an unidentified V-SNARE [42]) also regulate exosome secretion through co-ordination with RAL1 (Ras-related GTPases homolog). Thus, the mechanisms of exosome biogenesis and secretion are heterogeneous, depending on the cell-type and their specific trafficking functions. It is noteworthy that miRNAs are the contents more specifically transferred into recipient cells by exosomes released through a Rab27-regulated manner [44].

miRNA biogenesis and delivery mechanisms of exo-miRs

Exosomes carry various biologically active cargoes, such as lipids, proteins and nucleic acids [9,11]. miRNAs are one of them and are involved in regulating the function of the target cells, through intercellular information transportation and signal transduction [13]. miRNAs are a class of short noncoding RNAs with 19–25 nucleotides in length (11). However, dysregulated expressions of miRNAs are associated with the pathogenesis of various diseases, through the regulation of genome-wide gene networks [14–17]. Increasing evidence indicates that stressful conditions, such as hypoxia [4], inflammation [45] and oxidative stress [17], may increase secretion of exo-miRs. They can not only induce abnormal regulation in target cells, but can also affect their microenvironment and organelles, including mitochondria. For example, the effect of exosome miRNAs on the regulation of mitochondria under hypoxia has been comprehensively reviewed. Under hypoxia, the release of exosomes increases in cells, which indirectly affects the mitochondrial function through miRNA transportation. The mitochondrial dysregulation subsequently contributes to several pathological processes, such as inflammatory response, ischaemic injury and tumour progression, in the recipient cells [4].

Classically, exosomes originate from cells through an endosomal pathway in a stepwise process (Figure 1) [9,11,19,22]. Exosomes are generated as intraluminal vesicles (ILVs) within MVBs, and then released by various cell types. MVBs also known as late endosomes, develop from early endosomes and mature into endocytic compartments that enclose ILVs [46]. During maturation, ILVs are formed via the mechanism of inward budding originating from the limiting membrane of endosomes [47]. miRNAs are first transcribed in the nucleus, and further processed by a number of different proteins [48]. As is shown in Figure 1, three primary miRNA secretion mechanisms in biological fluids have been described. Recent studies shed light on miRNAs found in the non-vesicular fraction. Argonaute (AGO), an essential protein related to the RISC, has been recently reported for its cytoplasmic function in miRNA biogenesis [49,50]. The biological actions of mature miRNA are thought to involve loading into AGO complex (miRNA-AGO complex), which stabilizes the annealing of miRNA base pairs with target mRNA, to promote transcriptional repression or degradation [50,51]. Interestingly, it has been demonstrated an interaction between mitochondria and AGO-miRNA-containing processing bodies, and the slight uncoupling of mitochondria leads to a reduction in the functional efficiency of cellular miRNA [52]. Additionally, AGO2 has been potentially involved in the encapsulation of miRNAs, like miR-451 [34], into exosomes. Despite what might be expected, whether miRNAs associated with proteins function in a paracrine manner awaits further investigation [34]. Extracellular miRNAs within exosomes are instead delivered to target cells where they initiate signalling events and mediate functional activity [53].

Figure 1. Exo-miRs biogenesis and interact with mitochondria. Initially, early endosomes are formed by the invagination of the plasma membrane (endocytosis), or from TGN. They subsequently mature into late endosomes and ultimately generate MVBs, also known as mature late endosomes. ILVs are formed during the endosomal maturation process, through the invagination of the endosomal membrane into the lumen of endosomes. The fate of MVBs can be the fusion with lysosomes/autophagosomes for degradation. Alternatively, MVBs can also fuse with the plasma membrane, resulting in the secretion of ILVs as exosomes. In the nucleus, initial miRNAs genes are transcribed by RNA pol II into pri-miRNAs, which are subsequently processed by drosha complex. The resultant pre-miRNAs are exported into the cytoplasm by EXP5. An intermediary miRNA duplex is produced by the cleavage of the Dicer complex, of which one strand is loaded into the AGO protein complex (termed RISC) to produce mature miRNA. A fraction of miRNAs are secreted extracellularly: (i) encapsulated within MVB and released via exosomes; (ii) correlated with RNA-binding proteins like AGO2 and secreted as the miRNA-AGO complex; and (iii) incorporated into HDL particles. Once released extracellularly, exo-miRs can be further delivered to target cells by (i) direct fusion with plasma membrane; (ii) direct interaction with surface receptors; (iii) internalization, including phagocytosis/microphagocytosis and (iv) endocytosis. The mitochondrial outer membrane, with the endoplasmic reticulum, serves as a signalling platform. Mitochondria is critical in producing ATP by oxidative phosphorylation. Exosomes target the cells and initiate multiple modes of mitochondrial-dependent signalling, including the release of metabolites to promote histone and DNA demethylation; production of cytochrome C to activate caspases cascade; release of mtDNA to induce the secretion of pro-inflammatory cytokines; generation of mitochondrial ROS to change the gene expression via HIF/AMPK/Ca²⁺/Cn; activation of AMPK to modulate mitochondrial dynamics and metabolism.

Abbreviations: pol II, polymerase II; TGN, trans-Golgi network; DGCR8, diGeorge syndrome critical region in gene 8; EXP5, exportin-5; RISC, RNA-induced silencing complex; AGO, argonaute; HDL, high-density lipoproteins; ILVs, intraluminal vesicles; MVB, multi-vesicular body; MOM, mitochondrial outer membrane; TCA tricarboxylic acid; mROS, mitochondrial ROS; BAX, B cell lymphoma-2 (BCL-2)-associated X protein; BAK, BCL-2 antagonist/killer 1; ER, endoplasmic reticulum; Cn, calcineurin; HIF, hypoxia-inducible factor; AMPK, adenosine monophosphate‐activated protein kinase.

Exo-miRs are released extracellularly, either into distant cells through the circulation with an endocrine effect, or into the neighbouring cells in an autocrine/paracrine manner [53,54]. After arriving at the target cell, signalling events can be initiated by (i) direct interaction with surface receptors; for example, Through MHC-peptide complex interaction, dendritic cell-derived exosomes can activate T lymphocytes, enhancing immune responses [55]. (ii) direct plasma membrane fusion; Exosomes containing the lipophilic dye octadecyl rhodamine B (R18) have been used in studies to distinguish between endocytosis and fusion, which have been shown in dendritic and tumor cells [56]. (iii) internalization, including phagocytosis [57]or micropinocytosis [58], and (iv) endocytosis mediated by clathrin [59], caveolin [59] and lipid raft [60].

miRNAs are important in regulating the expression of approximately 60% of protein-coding genes in humans. They achieve this regulation at the post-transcriptional level by facilitating the destabilization/degradation of mRNA, and/or by inhibiting translation [61,62]. Specific binding sites for miRNAs, denoted as ‘seed regions’ (cis-acting elements), are mostly localized within 3’ untranslated region (UTR) and are composed of 6 consecutive nucleotides [63]. After transfer into the cytoplasm, miRNAs mediate posttranscriptional gene silencing, through binding to the 3’-UTR of target messenger RNAs (mRNAs) [64]. Specifically, the strand that has a less stable 5′ end thermodynamically is typically selected and inserted into the RISC complex, acting as a guide for mRISC to locate its complimentary motifs in the 3′-UTR of the target mRNAs [64]. It appears that the primary contribution of miRNAs to proteosynthesis reduction is due to the destabilization of target mRNA (more than 84% of the mRNAs examined), while the impact on translation efficiency remains relatively modest [63,65]. Interestingly, under certain circumstances, miRNAs have also been reported in specific conditions to function as translation activators. For example, in quiescent cells, they are arrested in the G0/G1 phase of the cell cycle [66,67]. However, the rules governing miRNA binding are complicated and poorly understood. The establishment of direct cause-and-effect between miRNAs and their mRNA targets is crucial for understanding the molecular mechanisms that drive diseases and the subsequent development of therapeutic interventions.

Exosome isolation and RNA extraction

In the research of exosomes, the methodologies employed for exosome collection and purification are of particular importance. Currently, despite the existence of several collection methods, a universally accepted consensus has not been established, especially regarding exosome isolation and purification. Differential centrifugation was a common method for sample processing in many exosome collection protocols. Briefly, one or more low-speed centrifugation, ranging from 300–10000×g, with/without size exclusion methods are employed to remove dead cells, cell debris and particles larger than 200 nm. Exosomes are pelleted by subsequent ultracentrifugation (mostly at 100,000×g for 70 min at 4^◦C) [15,16,68–72]. The exosome pellets are resuspended in PBS or nuclease-free water for RNA extraction, or stored at −80°C until analysis.

For RNA extraction from the exosome pellets, six commercially available kits were recommended: Trizol® with cleanup using the modified RNeasy® Mini Kit, miRNeasy Mini Kit, miRCURYTM RNA Isolation Kit, mirVana PARIS Kit, miRNeasy with RNeasy MinElute Cleanup Kit and Plasma/Serum Exosome RNA Isolation Maxi Kit [73–75]. According to the manufacturer’s instructions, the RNeasy® Mini Kit exclusively extracts RNA molecules that have a size greater than 200 nucleotides. To extract small RNA, a modified version of the RNeasy® Mini Kit was employed. Briefly stated, 700 μl of RLT buffer containing 1% mercaptoethanol was used to disrupt and homogenize exosomes, and 3.5 volumes of 100% ethanol were added to the samples before utilizing the RNeasy® mini spin column. The samples underwent two washes in 500 μl RPE buffer before being eluted in RNase-free water. Using capillary electrophoresis, the RNA quality, quantity, and cellular total and small RNA were evaluated [73,74].

Mitochondria as signaling organelles interact with exosomes

In the past, eukaryotic mitochondria were well appreciated for their role of biosynthesis and bioenergy in the adaptive cellular response. Beyond its well-established role in energy metabolism, emerging interest is now focusing on mitochondria that function as critical signalling organelles to propagate different cellular outcomes (Figure 1) [5].

By integrating signalling networks, mitochondria are organelles with pivotal roles in biochemical, transduce metabolic, neuroendocrine, and other local or systemic signals for cell and organism adaptation [1]. The signal components released from mitochondria into the cytoplasm include ROS generation, cytosolic calcium concentration, cytochrome C, metabolites, mtDNA and adenosine monophosphate-activated protein kinase (AMPK) activation [4]. For example, despite the view that excessive ROS has a negative effect on cells in terms of oxidative stress, low levels of mROS act as signalling molecules of intracellular pathways to maintain physiological functions, including the Sirt3 and FOXO for antioxidant activity, the BNIP3 or NIX for mitophagy activation, UCPs for maintenance of mitochondrial membrane potential [76]. Furthermore, the mitochondrial outer membrane can be served as a signalling platform for information exchange, through its contact with other endomembrane compartments, including the endoplasmic reticulum (ER), peroxisomes and vacuoles [4].

Mitochondria are increasingly important in exosome-mediated gene expression profiles and signal pathway activation. The cargoes of exosomes can be released extracellularly and delivered to the cytoplasm of the target cells. After that, they can be directly transferred into organelles, through the contact of organelles with endosomes containing internalized exosomes [4,18]. The VOR complex, a tripartite protein complex that orchestrates the specific localization of late endosomes into the nucleoplasmic reticulum, is crucial for the nuclear transfer of cargoes of exosomes [77]. Interestingly, it is reported that normal syncytiotrophoblast exo-miRs are primarily deposited to the mitochondria, whereas preeclampsia syncytiotrophoblast exo-miRs exhibit a greater degree of deposition within ER. This may be attributed to the distinct molecules or tags on the exosomal surface, which guide the intracellular transfer of vesicles towards different organelles [18]. Exosomes shuttle with endosomes along the ER in a stop-and-go movement before being sorted to the lysosome. Intracellular exosome trajectories predominantly follow filamentous and mesh-like structures, which allowed for the identification as ER based on labelling with ER-Tracker [78]. Analogously, an interaction has been showed between the ER and Rab5- and Rab7-positive endosomal vesicles [79]. Internalized exosomes that are tagged with CD63-Apex2 primarily occur as vesicles within larger vesicles close to the rough ER or cytoskeleton [78]. Exo-miRs could be efficiently incorporated into the translation machinery through the directed transport of exosomes to the ER membrane. Therefore, this indicates an interaction between the exosomes and different organelles, rather than solely random crossing of trajectories.

As for the mitochondria, it has been reported that late endosomes, but not early endosomes, can interact with or even merge into mitochondria. Angiogenic proteins (angiostatin and isthmin) can be transferred to mitochondria through the interaction between late endosomes and mitochondria, subsequently initiating apoptosis in endothelial cells. Both membrane fusion and the ‘kiss-and-run’ mechanism are involved in this interaction. As suggested, the endosomal trafficking pathway allows the proteins and lipids to be transferred from the extracellular environment to mitochondria through late endosomes [80]. However, the related mechanisms and the corresponding influencing factors of transferring exo-miRs from endosomes to mitochondria remain poorly understood. It is of great significance for further understanding of the role of exo-miRs in mitochondrial signal transduction in affecting intracellular fates.

Exosomes versus. mitochondrial-derived vesicles

Recently, mitochondria were indicated to generate Mitochondrial-Derived Vesicles (MDVs) that consist of single- or double- membrane structures [81,82]. Unlike the endolysosomal system of exosomes, MDVs are budded from the intracellular mitochondria surface [81,82]. Exosomes are known to carry various types of cargoes, whereas MDVs are selectively abundant in mitochondrial protein markers [82,83]. The budding process determines the MDV cargo, which selectively incorporates mitochondrial proteins, including TOMM20 and PDH (pyruvate dehydrogenase) [82–84]. Besides, the diameter of these vesicles has been relatively uniform, ranging from 70 to 150 nm. The established mitochondrial fission GTPase Drp1 is not necessary for the process of their scission [85]. MDVs were found to have two unique fates: their targeting either to a subpopulation of peroxisomes for metabolic process [86], or to late endosomes/MVBs for degradation [85].

However, several studies have identified the presence of mitochondrial proteins in exosomes, suggesting a connection between exosomes and MDVs. MDVs can be directed towards the cell surface, where their limiting membranes can merge with the plasma membrane. This process indicates that MDVs contribute to the release of mitochondrial cargoes in EVs [86]. It has been shown that exosomes released by dendritic cells contain mitochondrial cargoes [87]. Human melanoma tissues have been found to contain mitochondrial protein-enriched exosomes, which were detected in patient plasma [88]. However, the underlying mechanisms for the incorporation of mitochondrial proteins into exosomes remain to be further elucidated.

Exo-miRs versus. non-exo-miRs

Accumulating studies have demonstrated that the presence of miRNAs is not only within EVs, but also in different cells and biofluids, which are respectively termed cellular miRNAs [89] and extracellular/circulating miRNAs [90]. Both of them are reportedly involved in the regulation of mitochondrial function in diseases [91–93]. Suppression of miR-143-3p of cardiomyocytes could alleviate mitochondria-mediated apoptosis by targeting Bcl-2 in myocardial ischaemia-reperfusion injury [92]. Overexpression of miR-491-5 in pancreatic cancer cells induces an apoptotic process by inhibiting both Bcl-XL and TP53 [94]. Plasma miR-151a-5p could reduce mitochondrial respiratory activity by targeting cytochrome b in asthenozoospermia [93]. However, compared to the cellular/extracellular miRNAs, it has been suggested that exo-miRNAs have improved stability with the protection of double-membrane structures [95]. They exhibit resistance to degradation under conditions of prolonged storage and freeze/thaw cycles [96]. Exo-miRs exhibit stability in different biological fluids, which presents a potential avenue for employing miRNAs as diagnostic markers for various clinical conditions. Besides, compared with the cellular miRNA content the exosomal concentration of certain miRNAs is shown to be substantially higher and originated from a specific group of genes. For example, miR-21 has 40-fold elevated levels in exosomes in glioblastoma patients [97]. Furthermore, miRNA profiles in exosomes differ from those observed in the parental cells, indicating that miRNAs are selectively encapsulated into exosomes [53]. The miRNA expression profiles of exosomes derived from T cells, B cells, and dendritic cells were found to be distinct from those of their respective parental cells [98]. The stability, abundance and selective package of miRNAs in these membrane-bound vesicles enhance the research attractiveness of exosomes in regulating mitochondrial function in various pathological conditions.

Initially, it was considered that miRNAs function solely in the cytoplasm. Recently, however, numerous miRNAs originating directly inside mitochondria in mammalian cells have been identified. Mitochondrial miRNAs (mitomiRs), which are derived from the nucleus genome or encoded by the mtDNA [99], have been involved in regulating mitochondrial transcripts and mitochondrial functions, although the mechanism remains poorly understood. Interestingly, mitomiRs possess distinct characteristics that can distinguish them from conventional exo-miRNAs [99]. Their size slightly differs (17–25 nt), instead of the average 22 nt. They have short 3′overhangs, stem-loop secondary structures, and distinctive thermodynamic features [100]. They lack 5’cap, and the majority of them were predicted to target multiple mtDNA sites in silico. The majority of the nuclear-encoded mitomiRs are located near or inside mitochondrial gene clusters, and their transcriptions are frequently coregulated [101]. Therefore, it has been hypothesized that at least some of these characteristics may serve as a signal for miRNA entrance into mitochondria [99].

Indeed, recent studies have established a correlation between dysregulated mitomiRs and the pathophysiology of mitochondria-related diseases [102]. Several mitomiRs, including mitomiR-2392, mitomiR-5787, mitomiR-34a, mitomiR-181a and mitomiR-146a, play a role in modulating drug resistance, mitochondrial functions, autophagy and oxidative phosphorylation (OXPHOS) [103,104]. Interestingly, The RNA-binding protein MSI2 has been observed to interact with miR-301a-3p and enhance its distribution in the mitochondria of endothelial cells [105]. Various isoforms of miRNAs derived from mtDNA have been identified in gametes, zygotes and germ cells (PGCs and spermatogonia), which play a potential role in gamete differentiation and fertilization [106]. Besides, it has been proposed that cells with dysfunctional mitochondria may release exosomes containing miRNA profiles that reflect abnormal mito-miR profiles linked to impaired mitochondria. These exo-mitomiR profiles possess potential diagnostic value in predicting the evolution from dysfunctional mitochondria to the onset of diseases. Retinal pigmented epithelial cells with impaired mitochondria secrete exosomes containing mitomiR-494-3p, which serve as indicators of their reduced mitochondrial functionality [102]. Thus, the findings led us to hypothesize that there is a difference, and relation as well, between exo-miRs and mitomiRs.

miRNAs in mitochondrial dynamics and quality control systems

Although mitochondria were classically perceived as distinct organelles, it is currently known that mitochondria constitute a highly dynamic network that constantly undergoes remodelling through the elimination of impaired mitochondria (fission) and merging of functional mitochondria (fusion). Mitochondrial dynamics of fusion and fission are essential for cellular survival and response to varying environmental changes [107]. Recently, it has been shown that miRNAs affecting cardiovascular diseases may have a connection to mitochondrial dynamics. In an experimental study, overexpression of miR-485-5p inhibits mitochondrial fission and cardiac hypertrophy by upregulating fusion factor Mfn2 [108]. In a clinical study, the upregulation of miR-140 and downregulation of miR-485-5p have been suggested to promote mitochondrial dynamics to fission, leading to the proliferation of pulmonary vascular cells [109]. Accordingly, these findings emphasize a potential role for mitochondrial dynamics-related miRNAs in the regulation of haemodynamics of cardiovascular diseases.

Mitochondrial quality control (mQC) systems have been identified to be essential for effective mitochondrial function and also be critical to health and disease [110]. The mitochondrial unfolded protein response (mtUPR), an evolutionarily conserved mechanism for protein quality control, represents an important mQC mechanism. mtUPR has been associated with type 2 diabetes mellitus [110]and has also been dysregulated in Parkinson’s disease [110]. Through the actions of chaperones and proteases, the main function of the mtUPR is to resolve proteotoxic stress (the accumulation of deleterious protein aggregates), contributing to the folding or degradation of misfolded/unfolded proteins [111].

Interestingly, miRNAs have been reported to regulate mitochondrial dynamics and mQC systems. In a previous study, the mtUPR is activated in muscle cells when miR-382-5p is silenced, which results from mitonuclear protein imbalance and a collective downregulation of the transcripts encoding for mitochondrial ribosomal proteins [112]. Besides, there is a close relationship between the components of the mtUPR and mitochondrial morphology and function. Studies in skeletal muscle demonstrate that the mtUPR is compromised in mice models of obesity and diabetes [113], and that 19 miRNAs have been identified to be involved in the regulation of muscle mitochondrial function [114]. This highlights the relevance of miRNAs as modulators of the mtUPR in skeletal muscle. However,

These results were derived from animal experiments and only focused on skeletal muscle, a highly metabolically active tissue. Further studies are required to investigate the regulation of miRNAs in mtUPR in other metabolically active tissues. Taken together, these findings revealed a potential role of miRNA in mitochondrial dynamics and mQC systems. However, whether exosome-mediated transfer of miRNA could also concern mitochondrial dynamics and mQC systems remains to be determined.

Mitochondrial changes mediated by exosomes

Mitochondria-dependent diseases may be mainly manifested as mitochondria-specific disorders or secondary to systemic diseases. Increasing evidence suggests that exo-miRs serve as endocrine and paracrine mediators that cause mitochondrial changes in various cells. In recent years, many miRNAs contained in exosomes regulating mitochondrial changes have been identified in different organs (Table 1). The predicted interaction between exo-miRNAs and their target genes has also been summarized in diseases caused by mitochondrial dysfunction (Table 2).

Table 1. Candidate exo-miRnas associated with mitochondrial dysfunction in various diseases.

miRNA	Diseases	Exo type	Source of Exo	Effector cells	Exo isolation	Regulation of miRNA	Mitochondrial change	Effect	Ref.
Neuronal disease
miR-137	Schizophrenia	Exos	Plasma	Parvalbumin interneurons	DC	up	Decreased mitophagy markers (NIX, Fundc1, and LC3B) and accumulation of damaged mitochondria, further exacerbating oxidative stress	Parvalbumin interneuron impairment.	[14]
miR-137	Hemorrhagic stroke	Exos	endothelial progenitor cells	Neurons	DC	up	Improving cellular MMP and ATP levels; decreased ROS.	Suppressing apoptosis and ferroptosis in neuroblastoma cells.	[68]
miR-146a	Alzheimer’s disease	Exos	astrocytes	Astrocytes	mirVana miRNA isolation kit	up	Possibly mitochondrial fusion; depolarized mitochondria; activation of mitophagy.	Alleviating astrocytic inflammation.	[115]
miR-155	Traumatic spinal cord injury	Exos	M1-polarized macrophages	Vascular endothelial cells	DC	up	Decreased MMP; the decline of OCR, basal respiration, ATP production, respiration capacity and respiration reverse; ROS accumulation; mitochondrial swelling, shortened mitochondrial length and fragmented mitochondria.	EndoMT.	[45]
miR-328-3p	Alzheimer’s disease	Exos	Cerebrospinal fluid	N/A	miRCURY Exosome Cell/Urine/CSF Kit	down	Autophagy.	Amyloid-β peptides and tau metabolism.	[116]
miR-210-5p, etc	Parkinson’s disease	Exos	aSyn stably expressing MN9D dopaminergic cell	Neuronal cells	DC	up	Autophagy, inflammation and hypoxia.	α-synuclein misfolding in metal neurotoxicity.	[117]
Skin disease
miR-375-3p	Severe drug-induced skin reactions	Exos	Plasma	Keratinocytes	DC	up	MMP collapse; decreased ATP production; change in mitochondrial morphology; proapoptotic proteins CYTO-C, SMAC, and APAF-1 release.	Keratinocyte apoptosis.	[15]
miR-690	Melanoma	Exos	Melanoma cells	CD4^+ T cell	DC	up	Mitochondrial apoptotic pathway activation.	Apoptosis of CD4+ T cells.	[118]
Respiratory/lung disorder
miR-27a	HIV-mediated lung diseases	Exos	Macrophages exposed to HIV viral protein	Lung epithelial cells	DC	up	Increased mitochondrial ROS; reduced OCR; reduced ATP concentration; blunting oxidative capacity.	Lung epithelial barrier dysfunction.	[71]
miR-23a, miR-221 and miR-574	COPD	Exos	Plasma	N/A	ExoQuick commercial kit Ribo™ Exosome Isolation Reagent	up	Possibly decreased mitochondrial activity (respiration, glycolysis, and ATP levels); an increased production of ROS.	Decreased FEV1/FVC values.	[119]
Cardiovascular disease
miR-29a	Obesity-related cardiomyopathy	Exos	Plasma	Cardiomyocytes	DC	up	Reduction of ATP production, basal oxygen consumption and mitochondrial complex I activity.	Cardiac dysfunction.	[69]
miR-194	Obesity-related cardiomyopathy	Exos	Plasma	Cardiomyocytes	DC	up	Reduction of ATP production, basal oxygen consumption and mitochondrial complex I activity.	Cardiac hypertrophy and fibrosis; reduction of ejection fraction.	[16]
miR-122	Obesity-related cardiomyopathy	Exos	Plasma	Cardiomyocytes	DC	up	Decreased ATP production and basal oxygen consumption.	Deteriorated cardiac structure and functional index.	[70]
miR-802-5p	Obesity- and diabetes-related cardiomyopathy.	Exos	Hypertrophic Adipocyte	Cardiomyocytes	DC	up	Increased intracellular ROS formation.	Insulin Resistance in Cardiac Myocytes.	[120]
miR-126	Acute myocardial infarction	Exos	N/A	Ventricular cardiomyocytes	N/A	down	Maintenance of MMP; decreased intracellular ROS.	Decreased cardiomyocyte apoptosis.	[121]
Liver fibrosis
miR-27a	Metabolic-associated fatty liver disease	Exos	Hepatocytes	Hepatic stellate cells	DC	up	Loss of MMP; reduction in basal OCR; increased ROS; a 40% decrease in maximal mitochondrial respiration, downregulated mitochondrial transcription-related genes; Mitophagy failure.	Fibrotic liver injury.	[72]
miR-181a-2-3p	Liver fibrosis	Exos	citreoviridin-treated hepatocytes	Hepatic stellate cells	DC	up	Mitochondrial calcium overload	Hepatic fibrosis.	[122]
Gestational disease
miR-130b-3p	Gestational diabetes	Exos	Placental trophoblasts	Placental trophoblasts	ExoQuick-TC Exosome Precipitation Solution	up	Increased ROS production; inhibition of PGC-1α/TFAM mitochondrial biogenesis pathway.	Metabolic disorders in women with diabetes during pregnancy and their children.	[123]
Kidney injury
miR-20a-5p	Acute tubular injury	Exos	Renal tubular epithelial cells	renal tubular epithelial cells	DC	up	Increased the copy number of mtDNA; improvement of mitochondrial injury by increasing both the numbers and length of mitochondria.	Promoting TEC’s proliferation and protecting TECs from apoptosis.	[124]
Endocrine disease
miR-210	Type 2 diabetes mellitus	Exos	Macrophage	3T3-L1 adipocytes	Serum exosome separation kit	up	Impaired mitochondrial CIV complex activity.	Suppressing adipocyte glucose uptake.	[17]
Cancer
miR-101-3p	Colorectal cancer	Exos	Colorectal cancer cells	Colorectal cancer cells	DC	up	Increased MMP; Increased ROS production; Increased mitochondrial number; Increased expression of respiratory complexes.	Promoting cell growth and migration in cancer cells.	[125]
miR-214-3p	Epithelial ovarian cancer	Exos	Ovarian cancer cells	Epithelial Ovarian Cancer Cells	Total Exosome Isolation Kit	up	ROS overproduction; MMP loss; Excessive intracellular Ca2+ uptake.	Promoting malignancy by preventing apoptosis and enhancing proliferation.	[126]
miR-27b	Colorectal cancer	Exos	Bulk milk	Colorectal cancer cells	Total Exosome Isolation Kit	up	Mitochondrial ROS accumulation; Damaged mitochondria fused to lysosomes to promote mitophagy.	Anticancer effects: Promoting apoptosis of cancer cells.	[127]

Abbreviations.

Exos, exosomes; exo-miRNAs, exosomal miRNAs; DC, ultracentrifugation; MMP, mitochondrial membrane potential; ATP, triphosadenine; ROS, reactive oxygen species; COPD, chronic obstructive pulmonary disease; FEV1/FVC, forced expiratory volume in the 1st second/forced vital capacity; RPE, Retinal pigmented epithelial cells; COX6A2, cytochrome c oxidase subunit 6A2; SOCS6, cytokine signalling 6; ERRFI1, BCL-2, B cell CLL/lymphoma-2; BCL-xL, Bcl-xL-like protein 1; PPARγ, peroxisome proliferator-activated receptor gamma; HOMX1, Heme oxygenase-1 induction; PGC-1α, Peroxisome proliferation-activated receptor γ-coactivator 1α; MCL-1, Myeloid cell leukaemia 1; NDAH, Nicotinamide adenine dinucleotide; NDUFA4, NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 4; HIF-1, Hypoxia-inducible factor 1; EndoMT, endothelial-to-mesenchymal transition; HIPK3, homeodomain-interacting protein kinase; LHX6, LIM homeobox 6; N/A, Not applicable.

Table 2. The predicted interaction between exo-miRNAs and genes in diseases caused by mitochondrial dysfunction.

miRNA	Target gene	Target gene Regulation	Mitochondrial association of Target gene	Position of Targeted gene 3’ UTR	Predicted consequential pairing of target region (top) and miRNA (bottom)	Site type	Context++ score	Ref.
Neuronal disease
miR-328-3p	CPT1A	Down	Mitochondrial enzymes; resided in outer mitochondrial membrane	Position 3144–3150	5’ …CCAUCCCUAUUCCCAAGGGCCAC… 3’ UGCCUUCCCGUCUCUCCCGGUC	7mer-m8	81	[116]
miR-155	SOCS6	Up	Promoting inflammation and mitochondrial superoxide content	Position 327–333	5’ …CACUGUGAUUUUUAUGCAUUAAA… 3’ UGGGGAUAGUGCUAAUCGUAAUU	7mer-A1	79	[45]
miR-137	Possibly COX6A2	Down	a subunit of cytochrome c oxidase complex IV in mitochondrial respiratory chain	N/A	N/A	N/A	N/A	[14]
miR-146a	Possibly IRAK1	Up	mitochondrial fusion; proinflammatory cascade 31,080,014	Position 40–47	5’ …AAAUCCGGAAGUCAAAGUUCUCA… 3’ UUGGGUACCUUAAG–UCAAGAGU	8mer	97	[115,128]
	Possibly TRAF6	Up	stabilize PINK1 on depolarized mitochondria and activation of mitophagy [129]	Position 473–480	5’ …UCCUUGGAAAACUUAAGUUCUCA… 3’ UUGGGUACCUUAAG—UCAAGAGU	8mer	95
miR-210-5p	Possibly COX10	Down	mitochondrial haem A biosynthesis [130]	N/A	N/A	N/A	N/A	[117,131]
Skin diseases
miR-375-3p	XIAP	Down	mitochondria-dependent apoptosis	N/A	5’ …UUAAUAUGCAUAGAUGUUAA 3’ UGCGCUCGGCUUGCUUGUUUU	7mer-m8	88	[15]
miR-690	Bcl-2	Down	mitochondria-dependent apoptosis	Position 2836–2842	5’ …AGAAUCUGACUUGACUAGCCUUU… 3’ AAACCAACACUCGGAUCGGAAA	7mer-m8	84	[118]
Respiratory/lung disorder
miR-27a	PPARγ	Down	a transcriptional regulator of mitochondrial gene expression (mitochondrial bioenergetics)	Position 4635–4641	5’ …UUGCUUCAACACAGCAAGCCCAA… 3’ ACGAGUGUUCGUCGAUUCGGGA	7mer-A1	54	[71]
miR-23a, miR-221 and miR-574	HOMX1, SERPINA1, MMP1	Down	promoting mitochondria biogenesis and mitochondrial activity	N/A	N/A	N/A	N/A	[119]
Gestational diseases
miR-130b-3p	PGC-1α	Down	a transcription regulator in mitochondrial biogenesis and energy metabolism	N/A	N/A	N/A	N/A	[123]
Cardiovascular diseases
miR-122	Arl-2	Down	mitochondrial ATP regulator	Position 93–99	5’ …CAGCCGGCCAAACUAACACUCCC… 3’ GUUUGUGGUAACAGUGUGAGGU	7mer-m8	97	[70]
miR-802-5p	HSP60	Down	mitochondrial chaperone for quality control of mitochondrial proteostasis; mitochondrial complex activity	Position 131–137	5’ …UCACUGUAACCAUCAGUUACUGG… 3’ UCCUACUUAGAAACAAUGACU	7mer-m8	96	[120]
miR-126	ERRFI1	Down	an inducer of mitochondrial oxidative stress	Position 363–369	5’ …GUAAUAUAUAUUCAGAAUAAUAA… 3’ GCGCAUGGUUUUCAUUAUUAC	7mer-A1	86	[121]
Endocrine disease
miR-210	NDUFA4	Down	a component of mitochondrial CIV complex	Position 57–63	5’ …UCCAGAAGCCACAUCCGCACAAU… 3’ AGUCGGCGACAGUGUGCGUGUC	7mer-A1	95	[17]
Liver fibrosis
miR-181a-2-3p	MICU1	UP	a components of mitochondrial calcium uniporter controlling the influx of calcium into mitochondria	Position 581–587	5’ …AGGAAGGCAGCAUGCUCAGUGGG… 3’ CCAUGUCAGUUGCCAGUCACCA	7mer-m8	66	[122]
miR-27a	PINK1	Down	an important regulator of mitochondrial mitophagy	N/A	N/A	N/A	N/A	[72]
Kidney injury
miR-20a-5p	Possibly HIF-1	Up	integrity of mitochondrial DNA	Position 1104–1110	5’ …AAUGUUUGAUUUUAUGCACUUUG… 3’ GAUGGACGUGAUAUUCGUGAAAU	7mer-m8	96	[124]
Cancer
miR-101-3p	HIPK3	Down	increase mitochondrial number and respiratory enzyme expression	Position 1680–1686	5’ …GAGUGUCAUUGUAACUACUGUAU… 3’ AAGUCAAUAGUGUCAUGACAU	7mer-A1	38	[125]
miR-214-3p	LHX6	Down	metabolic remodelling; oxidative stress	Position 166–173	5’ …CUGGUCUUUCCCUCUCCUGCUGA… 3’ UGACGGACAGACACGGACGACA	8mer	93	[126]

Abbreviations: exo-miRNAs, exosomal miRNAs; COX6A2, cytochrome coxidase subunit VI apolypeptide2; CPT1A, carnitine Palmitoyl transferase 1A; IRAK1, interleukin-1 receptor associated kinase 1; TRAF6, tumour necrosis factor receptor-associated factor 6; COX10, cytochrome c oxidase assembly protein; SOCS6, suppressor of cytokine signalling 6; XIAP, X-linked inhibitor of apoptosis protein; Bcl-2, B-cell lymphoma-2; PPARγ, peroxisome proliferator-activated receptor gamma; encoding α1‑antitrypsin (SERPINA1), matrix metalloproteinase 1 (MMP1), haem oxygenase‑1 (HOMX1)]; Arl-2, ADP-ribosylation factor-like 2; HSP60, heat shock protein 60; ERRFI1, ERBB receptor feedback inhibitor 1; NDUFA4, NADH dehydrogenase ubiquinone 1 alpha subcomplex 4; MICU1, mitochondrial calcium uptake 1; PINK1, putative protein kinase 1; HIF-1, hypoxia-inducible factors-1; HIPK3, Homeodomain-interacting protein kinase; LHX6, LIM homeobox domain 6.

N/A, Not applicable.

Neuronal diseases: mitophagy and neuroinflammation

Mitophagy, a selective autophagic clearance of damaged/redundant mitochondria, represents a major type of autophagy in the neuronal system [132,133]. Basal mitophagy maintains neuronal survival, whereas dysfunctional mitochondria accumulation could be a contributor to enhanced ROS generation, inflammatory response and eventually programmed neuronal death [133,134]. The involvement of exo-miRs in the mechanisms of mitophagy and neuroinflammation has been reported in neuronal diseases.

Contrary to previous conclusions that exosomal miR-137 has a neuroprotective effect by improving neuronal mitochondrial function [68], a recent study has suggested that the increased circulating exosomal miR-137, both in redox dysregulated mice and in early psychosis patients, leads to the decreased mitophagy markers (NIX, Fundc1 and LC3B), and damaged mitochondria accumulation, further aggravating ROS generation and impairment of parvalbumin interneurons. Notably, treatment with mitochondria-targeted antioxidant, alleviate all these processes. The decreased subunit COX6A2 (cytochrome C oxidase subunit VI apolypeptide2) of cytochrome c oxidase complex IV (COX-IV), a terminal enzyme in the mitochondrial respiratory chain, was found to be the downstream protein of miR-137. However, whether miR-137 has binding sites in COX6A2 remains to be determined [14]. Moreover, mitochondrial dysfunction has been implicated in the two most common neurodegenerative disorders: Alzheimer’s disease (AD) and Parkinson’s disease (PD) [135]. In patients with AD, cerebrospinal fluid exosomal miR-328-3p was downregulated, which could distinguish AD from healthy controls and frontotemporal dementia. The target genes of miR-328-3p are implicated in regulating the AMPK expression, a key metabolic regulator in cellular processes (autophagy and cell polarity). Mitochondrial enzyme CPT1A (Carnitine Palmitoyl transferase 1A), one of the target genes of miR-328-3p, resides in the outer mitochondrial membrane and participates in fatty acid oxidation [116]. Exosomal miR-146a from choroid plexus cells has a critical role in alleviating astrocytic inflammation by down-regulating NF-κB, which subsequently promotes synaptogenesis and improves cognitive impairment in astrocytes [115]. miR-146a exerts these effects possibly by targeting IRAK1 (interleukin-1 receptor-associated kinase 1) and TRAF6 (tumour necrosis factor receptor-associated factor 6), although further evidence is needed [128]. Further studies are needed to investigate, the role of exo-miRs in cytochrome oxidase (respiratory chain complex IV), the mitochondrial enzyme that has been most noticeably impacted in AD [115]. Moreover, a collection of differentially expressed exo-miRs, including miR-210-5p, from dopaminergic neuronal cells have been previously identified in PD patients. These exo-miRs regulate important biological processes, including autophagy, inflammation and hypoxia [117]. miR-210-5p has been also involved in mitochondrial dysfunction by targeting COX10 (cytochrome c oxidase assembly protein) [131]. Intracellular accumulation of α-synuclein, the hallmark protein of PD, is bi-directionally correlated with mitochondrial dysfunction [135]. Some miRNAs, including miR-7 and miR-153 [136–138], have been indicated to regulate the synthesis of α-synuclein, and it is of interest to determine whether these miRNAs are carried by exosomes. Besides, mtDNA mutations are reported to be frequent in the substantia nigra neurons in the early stage of PD [139]. The involvement of exosomes in mtDNA mutations may also be worth investigating.

Moreover, it is well established that miR-155 acts as a proinflammatory regulator in the central nervous system (CNS) [140–142]. miR-155 expression is upregulated in the brains of patients with many neurological disorders characterized by uncontrolled neuroinflammation [142]. miR-155 is also associated with ROS overproduction after CNS injury [143]. miR-155 has been recognized as mitochondria-associated microRNAs in rat hippocampus following traumatic brain injury. Accordingly, miR-155 is enriched in the mitochondria of microglia and astrocytes, and plays a role in inflammatory response [51], although the target protein of miR-155 remains unknown in the study. In traumatic spinal cord injury, a devastating CNS consequence, exosomal miR-155 from M1-polarized macrophages is increased, leading to mitochondrial dysfunction and ROS accumulation in vascular endothelial cells. SOCS6 (suppressor of cytokine signalling 6) which is recognized to downstream mRNAs with a 3’ untranslated region (3’UTR) binding to miR-155, could inhibit the NF-κB signalling pathway by degrading p65. The exo-miR-155/SOCS6/p65 axis consequently contributes to the mitochondrial superoxide content and neuroinflammation [45]. Moreover, the expression of miR-155-5p was observed to be elevated in urine exosomes at the pre-onset stage of experimental autoimmune encephalomyelitis. Exosomal miR-155-5p has early involvement in the inflammation and oxidative injury of experimental autoimmune encephalomyelitis 26,277,791, although its involvement in mitochondrial dysfunction awaits further investigation.

Accumulating studies highlight an anti-inflammatory role in the mitophagy process. Mitophagy may regulate mitochondrial antigen presentation, inhibit or weaken inflammatory cytokine secretion and inflammasome activation, and eventually maintain immune cell homoeostasis [134,144]. Considering the relationship between mitophagy and some other neuronal diseases, including ischaemic stroke [145] and neurodegenerative diseases [146], we think it will be interesting to determine whether exo-miRs may be involved in the mechanisms of inflammation caused by decreased mitophagy in neuronal diseases in the future investigation.

Skin diseases: mitochondria-dependent apoptosis

Intrinsic mitochondria-dependent apoptosis represents the intracellular pathway related to cell apoptosis. The mitochondrial apoptosis response is correlated with different processes, including an altered ratio of proapoptotic/antiapoptotic proteins, and the activation of pro-apoptotic protease activating factors [147]. Relatively, less attention has been paid to the importance of mitochondrial dysfunction in skin disorders. Emerging evidence suggests that exo-miRs may have a potential role in skin disorders and carcinoma through mitochondrial apoptotic pathways.

Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN), characterized by keratinocyte apoptosis, are severe drug-induced cutaneous reactions.

In plasma samples from 35 SJS/TEN patients, miR-375-3p levels were reported to be markedly increased. The in vitro results showed that the transport of miR-375-3p from the plasma to the keratinocytes is dependent on exosomes, which induces keratinocyte apoptosis through the mitochondrial apoptotic pathway. Exosomal miR-375-3p directly binds to the XIAP (X-linked inhibitor of apoptosis protein) 3′UTR and exerts apoptotic effect by downregulating XIAP expression, which feeds back to mitochondria and decreases the release of proapoptotic proteins (CYTO-C, SMAC and APAF-1). Thus, exosomal miR-375-3p has a key role in keratinocyte apoptosis in SJS/TEN, although in vivo studies are required to confirm the results [15].

Some miRNAs, including miR-690, were found to be highly expressed in melanoma cell-derived exosomes. Increased exosomal miR-690 can promote CD4⁺ T cell apoptosis and accelerate melanoma growth through the mitochondrial apoptotic pathway. Specifically, pro-apoptotic protease activating factors (caspase-3, caspase-7 and caspase-9) are up-regulated, while the anti-apoptotic proteins (BCL-2, MCL-1 and BCL-xL) are down-regulated in CD4+ T cells. Thereinto, miR-690 could selectively bind to the 3’UTR of the Bcl-2 gene [118]. However, contrary evidence also exists, highlighting the antitumor effect of mitochondria-dependent apoptosis in cutaneum carcinoma [148], and the specific role of the exosomes remains to be investigated.

Respiratory/Lung disorder and gestational diseases: mitochondrial biogenesis

Mitochondrial biogenesis refers to the process of mitochondrial proliferation and differentiation. It is regulated by a variety of transcription factors and co-activators, including PPARγ (peroxisome proliferator-activated receptor gamma). PPARγ functions as a transcriptional regulator of mitochondrial gene expression, and plays an important role in metabolic and inflammatory processes [149]. Considering the variety of cells (such as epithelial cells, endothelial cells, alveolar macrophage and tumour cells) in the parenchyma and airway structures of lungs, intercellular communication mediated by exo-miRs are anticipated to be important in respiratory biology [150].

Exo-miRs are found to regulate inflammatory signals in the airways, as previously demonstrated by the transfer of alveolar macrophage-derived miR-223 to different respiratory cells [151]. Macrophages exposed to HIV viral proteins have been found to increase the release of miR-23a, which disrupts lung epithelial cell integrity through dysregulating tight junction protein expression. By specifically targeting the 3′-UTR of PPARγ, miR-27a downregulates its expression and perturbs mitochondrial bioenergetics [71]. Thus, exo-miRs produced by immune cells can promote intercellular interactions in the alveolar milieu by affecting mitochondrial bioenergetics, which can, in turn, impair lung epithelial cell integrity.

In COPD, prolonged exposure to cigarette smoke has been found to cause the increased secretion of exosomes from the cells of the lung epithelium [152]. Distinct exo-miRs profiles from BALF and lung tissue have been identified in COPD and IPF (idiopathic pulmonary fibrosis) subjects [153]. Three upregulated exo-miRNAs (miR-23a, miR-221 and miR-574) had a strong correlation with the FEV1/FVC (forced expiratory volume in the 1st second/forced vital capacity) values in COPD (chronic obstructive pulmonary disease) [119]. Mitochondrial dysfunction may play mechanical roles, as three common target genes were found, including HOMX1(Heme oxygenase-1 induction), which is associated with attenuated lung fibroblasts by promoting mitochondria biogenesis and mitochondrial activity (respiration, glycolysis and ATP production) in COPD [154]. Endothelial cell injury within the lung parenchyma is a critical contributor to COPD pathogenesis [155]. However, further studies are required to determine mitochondrial dysfunction mediated by exo-miR in endothelial cell injury in COPD. In addition, increasing evidence highlights the mtDNA damage caused by accelerated mitochondrial ROS in the pathology of pulmonary fibrosis [156]. Endometrial stem cells-derived exosomal miRNA Let-7 has been reported to alleviate pulmonary fibrosis by downregulating mitochondrial DNA (mtDNA) damage in alveolar epithelial cells. A putative binding site of Let-7 was identified inside the 3′-UTR region of LOX1. This finding suggested that mtDNA damage may be also potentially involved in the mitochondrial mechanism of respiratory/lung disorder, which deserves further investigation [156].

The normal mitochondrial biogenic process is also critical to embryo development. Other transcription factors are also involved in mitochondrial bioenergetics. PGC-1α (peroxisome proliferator-activated receptor γ coactivator 1 α) and TFAM (mitochondrial transcription factor A) [157–159]. PGC-1α emerges as a transcription regulator directly involved in the processes of mitochondrial biogenesis and energy metabolism [157]. It can activate TFAM, a protein that activates mitochondrial transcription and genome replication [157,158]. The effect of exo-miRs on this process has been reported in gestational diabetes.

During pregnancy, it is reported that diabetes is related to abnormal mitochondrial biogenesis in the placenta. High-glucose conditions increase the release of exosomal miR-130b-3p by placental trophoblastic cells. miR-130b-3p has been shown to target PGC-1α mRNA. The exosomal miR-130b-3p leads to impaired oxidative phosphorylation and increased oxidative stress in placental trophoblasts, which suppresses the PGC-1α/TFAM pathway, thus initiating gestational diabetes. The altered embryofetal development caused by abnormal mitochondrial biogenesis during diabetic pregnancy is a complication that endangers the offspring long-term health [123]. Hence, the mitochondriogenic process during pregnancy is altered by the diabetic environment through a miRNA-mediated downregulation of the mitochondrial biogenesis pathway. Further study is needed to establish whether alterations in the mitochondrial biogenic process are involved in diabetic pregnancy teratogenesis and its relation to oxidative stress. Since AMP-activated protein kinase a1 (AMPKa1) is known to activate PGC-1α, and placental AMPKa1 is also decreased in diabetic women [160], the involvement of exo-miRs in mediating the relationship would be a future research direction.

Cardiovascular and endocrine diseases: mitochondrial complex activity

The mitochondrial respiratory chain contains four multi-subunit complexes (complexes I – IV), that connect the electrons transport to oxygen, with ATP synthase assembled on the inner membrane. Complex I is considered a key site of superoxide anion production in mitochondria [161]. Complex IV is involved in fatty acid oxidation and lipid accumulation in white adipocytes [162]. Studies have shown that exo-miRs have a selective effect on the activities of mitochondrial complex I (NADH dehydrogenase) and complex IV (cytochrome c oxidase) in the cardiovascular system and endocrine diseases.

In obesity-related cardiomyopathy, researchers have observed increases in plasma exosomal miR-29a and miR-194 levels, both of which have a negative effect on the cardiomyocyte mitochondrial inactivity through reducing mitochondrial complex I activity [16,69]. As suggested, the miRNAs sponge ameliorates the exo-miRs-induced reduction of basal oxygen consumption, ATP production and mitochondrial complex I activity. However, the specific target genes and pathways of these exo-miRs remain to be investigated. Other exo-miRs (miR-122 and miR-802-5p) are also proposed to cause myocyte mitochondria-dependent cardiac injury during obesity [70,120]. Transported by plasma exosomes, miR-122 was able to inhibit mitochondrial ATP synthesis and oxygen consumption in cardiomyocytes. Mechanistically, Arl-2 (ADP-ribosylation factor-like 2) is a crucial mitochondrial ATP regulator that miR-122 directly binds and inhibits, as miR-122 exhibits a high level of binding affinity towards 3’-UTR of Arl-2 [70]. Additionally, exosomal miR-802-5p from hypertrophic adipocytes contributes to the increased ROS generation in cardiomyocytes, ultimately resulting in cardiac insulin resistance [120]. The study shows that miR-802-5p-binding sites are in 3’-UTR of HSP60 (heat shock protein 60). HSP60, a mitochondrial chaperone responsible for quality control of mitochondrial proteostasis [120]. The association between HSP expression and mitochondrial complex activity has been supported by previous studies, showing that myocardial Hsp contributes to the integrated mitochondrial integrity [163]. Considering that mitochondrial complexes serve as a link between electron transport and oxygen, the results of these studies prompt us to speculate that, exo-miRs may mediate the electron leak from the electron transport chain and superoxide radical generation, leading to an oxidative phosphorylation deficiency and finally heart failure, of which the molecular mechanism deserves further investigation.

Interestingly, exosomal miRNA with therapeutic potential has been investigated in cardiovascular diseases. Exosomal miR-126 has been previously identified to have a pro-angiogenic function [164]. The cardioprotection effect of exosomal miR-126 has been found in a study with a myocardial ischemia/reperfusion injury model, which suggests that it can stabilize mitochondrial membrane potential (MMP) and attenuate oxidative stress in ventricular cardiomyocytes. The cardioprotective effects result from a direct binding relationship between miR-126 and ERRFI1(ERBB receptor feedback inhibitor 1), an inducer of mitochondrial oxidative stress [121]. Besides, the improved mitochondrial complex I activity has been correlated with myocardial recovery after reperfusion [165,166]. Accordingly, it is reasonable to hypothesize that exosomal miR-126 May enhance mitochondrial complex I activity, thereby preserving mitochondrial integrity and thus myocardial function.

In addition to the effect on complex I activity, a study reported a defect in mitochondrial complex CIV activity, which is mediated by exosomal miR-210. The 3′-UTR region of NDUFA4 (NADH dehydrogenase ubiquinone 1 alpha subcomplex 4, a subunit of mitochondrial CIV complex) is identified as the miR-210 target gene. High-glucose-treated macrophages increase the release of exosomes that impair glucose uptake by inhibition of NDUFA4 expression in 3T3-L1 adipocytes. This provides new insights into the exosome-mediated diabetic obesity pathogenesis [17].

Taken together, a common mechanism of mitochondrial respiratory complex activity impairment seems to be involved in cardiovascular and endocrine diseases. Exo-miRs play a central role in regulating the components of the respiratory chain.

Liver fibrosis: mitochondrial calcium overload and mitophagy

Mitochondrial calcium has a critical role in maintaining cellular calcium homoeostasis [167]. Mitochondrial calcium overload can induce mitochondrial fusion, mitochondrial elongation and increased ROS generation, leading to the activation of hepatic stellate cells and thereby liver fibrosis [168]. MICU1(mitochondrial calcium uptake 1) is one of the regulators of mitochondrial calcium uniporter (MCU). It functions as a gatekeeper to control the influx of calcium into mitochondria [167]. Liver fibrosis is characterized by an excessive accumulation of connective tissue within the liver [122]. Hepatic stellate cell activation is a crucial stage in the development of liver fibrosis [122]. By binding to the 3′UTR of MICU1 through the UCAGUGG sequence, exosomal miR-181a-2-3p can suppress MICU1 mRNA, and induce excessive mitochondrial calcium overload in hepatic stellate cells. The initiation of liver fibrosis can be attributed to mitochondrial dysfunction in hepatic stellate cells through mitochondrial oxidative stress. And the exosome-activated fibrogenic response can be relieved after pharmacological inhibition of mitochondrial calcium [122]. Since mitochondrial calcium is regulated by a variety of channels and their regulators, it would be interesting to investigate the role of exo-miRs in regulating other channels and regulators during liver fibrosis in the future.

The involvement of exosome-mediated mitophagy in the communication between hepatocytes and hepatic stellate cells has also been reported in fibrotic liver injury. Lipotoxic hepatocyte-derived exosomal miR-27a can induce mitophagy failure in hepatocytes, which promotes activation and proliferation of hepatic stellate cells, resulting in liver fibrosis of metabolic-associated fatty liver disease. Accordingly, the regulatory role of miR-27a in mitophagy was established by its targeting of PINK1 (putative protein kinase 1), which is widely recognized as a critical regulator of mitochondrial mitophagy [72].

Therefore, the studies provide evidence that exosomal miRNA can be a future candidate to be targeted to protect the liver from fibrosis, through the mechanisms of regulating the mitochondrial calcium equilibrium and selective mitochondrial autophagy.

Kidney injury: mtDNA damage and dysregulated mitochondrial RNAs (mtRnas)

mtDNA is the non-chromosomal DNA contained in human mitochondria [169]. Changes in mtDNA copy number can cause a variety of clinical phenotypes, and accumulation of mutated may cause multiple human diseases, including kidney injury [124]. Interestingly, emerging evidence indicates the therapeutic potential of exosomes for kidney injury.

mtDNA is vulnerable to oxidative stress [169,170]. Exposure to hypoxia may induce impaired mitochondrial function by compromising mtDNA integrity and preventing mitochondrial protein synthesis. Fragmentation of mitochondria has been found in proximal tubular cells exposed to hypoxia [171]. Hypoxia can significantly increase the generation and secretion of exosomes from PTECs (proximal renal tubular epithelial cells) in a time-dependent manner, which plays a cytoprotective role in hypoxia-induced injury [172]. A recent study shows that exosomal miR-20a-5p is beneficial for the proliferation of PTECs, and is protective against PTECs injury. These changes are associated with the increased copy number of mtDNA and thereby the improved mitochondrial functions, which can be reversed by miR-20a-5p inhibition [124]. However, the target gene of miR-20a-5p in this study is yet to be identified. Importantly, HIF-1 (hypoxia-inducible factors-1) has been implicated in promoting exosome secretion from PTECs during hypoxia and contributes to the renoprotective effect of the exosomes [172]. mtDNA integrity is necessary for persistent activation of the HIF-1α pathway [173]. Hence, further studies are needed to determine the role of HIF-1 in the protective effect of exosomal miRNA against mtDNA damage in hypoxia-induced PTEC injury. Of interest, the therapeutic potential of exosomes for mitochondria-mediated kidney injury is not restricted to the miRNAs themselves. Emerging evidence indicates that stem cell-derived exosomes also contribute to the restoration of kidney function, which will be discussed in the following parts.

Compared with mtDNA, mtRNAs seemed a stronger predictor for patient outcome and overall survival [174]. In previous studies, it has been found that mtRNAs are often observed in exosomes [175,176]. Exosomal mtRNAs may reflect the intracellular pathways that result in late endosome formation, which are involved in mitophagy, exosome synthesis, or fusion of mitochondria with lysosomes, enabling transport of mitochondrial content between mitochondria and lysosomes via vesicles [175,176]. In an RNA-seq analysis of CKD, in addition to exo-miRs, 16 dysregulated exosomal mtRNAs, predominantly mt-tRNAs, were identified. These mt-tRNAs exhibited consistent downregulation throughout different stages of chronic kidney disease (CKD). Exosomal mtRNAs may serve as possible indicators for CKD caused by renal tubular inflammation and fibrosis [177]. This finding has intriguing implications for better understanding the dysregulated exosomal RNAs in kidney injury, although a larger patient cohort of the study is still required.

Cancer: metabolic reprogramming, mitochondrial calcium overload and mitophagy

Cancer is greatly influenced by a dynamic interaction between stromal and cancer cells. Intercellular communication mediated by exo-miRs in the tumour microenvironment has been implicated in cancer progression. They are involved in tumour growth, metastasis, angiogenesis and immune escape. Besides, by activating adaptive mechanisms to optimize their oxidative phosphorylation in response to their substrate supply and energy demands, several types of cancers rely on mitochondrial metabolism. Exo-miRs may participate in metabolic reprogramming to promote the proliferation of cancer cells.

In the cancer landscape, some studies have indicated the carcinogenic properties of exo-miRs. In colorectal cancer, the increased expression of plasma exosomal miR-101-3p potentially promotes the proliferation and migration of cancer cells. An improved mitochondrial functionality was observed, involving the increased MMP ROS generation, mitochondrial number and expression of respiratory complexes. The 3’-UTR of the HIPK3 (homeodomain interacting protein kinase 3) gene harbours a specific binding site for miR-101-3p. The study proposed an association between the miR-101-3p-HIPK3 axis and metabolic reprogramming in colorectal cancer [125]. In human epithelial ovarian cancer, the expression of exosomal miR-214-3p was found to be increased with malignancy. The inhibition of miR-214-3p induces ROS production and MMP loss, along with excessive intracellular Ca²⁺ uptake in cancer cells. The expression of LHX6 (LIM homeobox domain 6), which is recognized as a target gene of miR-101-3p, exhibits a relationship with cancer metabolic remodelling and tumour progression [126]. Interestingly, a recent study indicates the anticancer effects of exosomal miR-27b from buffalo milk in colorectal cancer. It can promote apoptosis of cancer cells, by disrupting mitochondrial activity, mitochondrial ROS overgeneration and lysosome accumulation. The damaged mitochondria are fused to lysosomes, which results in the mitophagy process. Accordingly, miR-27b exerts an anticancer effect through regulating PERK/IRE1/XBP1/CHOP protein modulation, but the specific target gene of miR-27b requires further determination [127]. Highlighting the role of tumour-derived exosomes in the escape of tumour cells from immune surveillance, as mentioned above, a previous study showed that melanoma-released exosomes have the potential to promote the apoptosis of CD4+ T cells and the growth of melanoma cells. This effect was associated with the mitochondrial apoptotic pathway activated by exo-miRs, including miR-690 [118].

Hence, the exo-miRs involved in the modulation of mitochondrial function in cancer progression may be potentially utilized for improved diagnosis and treatment. However, the detection of exo-miRs encountered analogous challenges as those faced in the context of conventional cancer biomarkers. The amount and functional impact of exosomes released by cancer cells differed greatly from those of exosomes from non-cancerous cells [178].

Therapeutic potential of exo-miRs

Increasing evidence indicates that exo-miRs may represent promising therapeutic agents targeting mitochondrial pathways. First, the miRNAs carried by exosomes have the potential as therapeutic targets to weaken their possible pathogenic properties in mitochondrial dysfunction. For example, dysregulated expression of miRNAs has been implicated in the pathogenesis of different kidney diseases. It is related that manipulating miRNAs might be possible to achieve therapeutic effects [179,180]. Of interest, they could be developed into efficient nano‐platforms for miRNA‐based drug delivery to specific recipient cells [181].

Furthermore, with the extensive investigation of stem cell therapies, accumulating studies have focused on stem cell‐derived EV therapy, as a novel strategy of ‘cell-free therapy’. Because of their higher safety profile and barrier-penetrating capability [182,183], the administration of stem cell‐derived EV therapy is considered a promising therapeutic strategy. For example, we have previously conducted a systematic review and meta-analysis, showing that stem/progenitor cell‐EVs are effective in improving renal outcomes in rodent ischemia/reperfusion injury‐induced AKI model [184]. Growing studies of exosomal therapy are aimed at solving the negative issue of cell therapy by the introduction of miRNA machinery. In particular, it has been indicated that stem cell‐derived exosomes can mediate the transfer of miRNAs into target cells and protect cells from mitochondrial dysfunction.

In kidney injury, according to a previous study, human Wharton Jelly MSC-derived exosomes can ameliorate proximal tubular epithelia cell (PTECs) injury, by inhibiting mitochondrial fission, which is mediated by miR-30 [185]. In line with this, enriched miR-200a-3p is detected in exosomes from placenta-derived MSCs, which protected PTECs from oxidative damage by attenuating mitochondrial fragmentation, increasing mtDNA copy number, and normalizing MMP [186]. An in vivo study shows that bone marrow-derived MSCs can release exosomes that have a renoprotective effect by stabilizing mtDNA and mitochondrial OXPHOS in injured PTECs. This may be attributed to the anti-inflammatory miRNAs (eg. miR-21, miR- 23, miR-25, miR-126, and miR-let-7) [187]. More recently, the renoprotection of exosomes from bone marrow-derived MSCs has been determined both in vitro and in vivo. These exosomes miR-223-3p can inhibit inflammasome activation to promote mitophagy through the miR-223-3p/NLRP3 Axis [188]. These findings suggest that exosomes from MSCs could be a promising therapeutic strategy for treating kidney injury caused by mitochondrial dysfunction.

As mentioned above, exosomes derived from menstrual blood-derived stem cells could alleviate pulmonary fibrosis by delivering miR-Let-7 to alveolar epithelial cells. Exosomal miR-Let-7 can downregulate ROS levels, mtDNA damage, expression of LOX1 (lectin-like oxidized low-density lipoprotein receptor-1), and inflammatory body NLRP3 activation [156]. Neural stem cell-derived exosomes have the potential to improve mitochondrial biogenesis and mitochondrial dynamics, as illustrated by the enhancement in mitochondrial biogenesis-related factors (PGC1α, NRF1, NRF2) and mitochondrial dynamics-related factors (Fis1). These vesicles could prevent inflammatory responses, improve synaptic activity, and restore cognitive deficits in Alzheimer’s disease mice [189]. In addition, neural stem cell-derived exo-miRs (hsa-mir-182-5p, hsamir-183-5p, hsa-mir-9, and hsa-let-7) have potent neuroprotective effects in PD. These exo-miRs reduced ROS accumulation and improved MMP, inhibiting mitochondrial dysfunction in SH-SY5Y cells [190].

Taken together, these studies indicate exo-miRs from MSCs to be a potential therapeutic strategy for mitochondrial dysfunction-related diseases, with an understanding of their mechanisms, including mitochondrial changes, targeting protein and tissue distribution. However, to the best of our knowledge, except for kidney injury, lung disorders and neuronal diseases, no in-depth studies are focusing on the therapeutic effect of MSCs-derived exo-miRs on mitochondrial dysfunction in other clinical phenotypes [188]. Besides, it is imperative to thoroughly evaluate the and long-term consequences and therapeutic duration of MSCs-derived exo-miRs before advancing towards their clinical implementation.

Conclusions and future directions

Exo-miRs are closely associated with the pathogenesis of various diseases caused by mitochondrial dysfunction through integrating signalling networks (Figure 2). They mediate the changes in mitochondria as signal organelles through multiple processes, including mitophagy, mitochondria-dependent apoptosis, mitochondrial complex inactivity, mitochondrial calcium overload, abnormal mitochondrial biogenesis, mtDNA damage, and metabolic reprogramming. However, research on their role in mitochondrial dysfunction in various mediated diseases is still nascent. Many important issues still require to be resolved. Firstly, miRNAs are abundant in the plasma exosomes, but it is unclear what the parental cells are for these exo-miRs. Besides, we still need to investigate the contribution of exo-miRs to mitochondrial physiology, such as mitochondrial metabolic homoeostasis, mitochondrial fission and fusion, and how they are released in normal physiological conditions. In addition, future research will need to reveal the mechanisms by which miRNAs are functionally displayed at the mitochondria across the endosomal (and exosomal) double-lipid membranes, and to investigate the factors that may licence exosomes for this specific cell entrance route. Furthermore, although miRNAs have been recommended as biomarkers, differentiating multiple disease phenotypes is challenging, with overlapping dysregulated exo-miRs that also exert effects on mitochondrial mechanisms. For example, a decrease in the expression of plasma exosomal miR-124 has been reported in asthma patients. It is also reported that overexpression of miR-124 regulates motor neuron morphology, and affects mitochondrial localization and function. Importantly, future research calls for more efforts for the optimization of EV isolation, with special regard to better purity and higher recovery rate. Anyway, persistent advancement is being made. This review may serve as an inspiration to settle these or more issues.

Figure 2. The role of exosomal min miRNAs the mitochondrial changes in various diseases. Different pathological conditions increase the release of exosomes containing miRNAs. These vesicles can be taken up by the mitochondria of target cells, where they exert the regulatory function in mitochondrial function through multiple processes, including mitophagy for neuronal diseases, mitochondria-dependent apoptosis for skin diseases, abnormal mitochondrial biogenesis for gestational diseases, mitochondrial complex inactivity for cardiovascular and endocrine diseases, mitochondrial calcium overload for liver fibrosis, and mtDNA damage for kidney injury.

Abbreviations: COX6A2, cytochrome c oxidase subunit 6A2; SOCS6, suppressor of cytokine signalling 6; BCL-2, B cell CLL/lymphoma-2; BCL-xL, Bcl-xL-like protein 1; PGC-1α, Peroxisome proliferation-activated receptor γ-coactivator 1α; MCL-1, Myeloid cell leukaemia 1; NDAH, Nicotinamide adenine dinucleotide; NDUFA4, Nadh dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 4; HIF-1, Hypoxia-inducible factor 1.

In conclusion, mitochondria can be considered as critical disease-modifying sites in many acute or chronic pathologies. Investigating the biological actions of exo-miRs will help reveal the mechanisms underlying diseases caused by mitochondrial dysfunction and thereby provide new perspectives for the clinical application of exosomes.

Acknowledgments

The authors are grateful to Rachel Granham for the English language revision.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

Data sharing is not applicable to this article as no new data were created or analysed in this study.

Correction Statement

This article has been republished with minor changes. These changes do not impact the academic content of the article.

Additional information

Funding

This work was supported by the National Natural Science Foundation of China (82270756); Guangdong Engineering Technology Research Center (507204531040), Guangzhou Development Zone Entrepreneurship Leading Talent Project (2017-L153), Guangzhou Entrepreneurship Leading Team (202009030005).