Effects of intermittent fasting on the histology and mRNA expression of major drug-metabolizing cyp450s in the liver of diabetic mice

ABSTRACT

Introduction:There is a variation in drug response among patients who practice intermittent fasting. Alteration in the expression of drug-metabolizing enzymes (DMEs) can affect the pharmacokinetics and drug response.

Aims: This research aimed to determine the effect of intermittent fasting on the mRNA expression of major drug-metabolizing cyp450s in the liver of diabetic mice.

Methods: Thirty-two male Balb/c mice were divided into four groups; control, nonfasting diabetic, non-diabetic fasting, and diabetic fasting mice. Insulin-dependent diabetes was induced in mice by a single high-dose (250 mg/kg) streptozocin. Mice of non-diabetic and diabetic fasting groups were subjected to 10-day intermittent fasting for 17 hours daily. Then, the mRNA expression of mouse phase I DMEs cyp1a1, cyp2c29, cyp2d9, and cyp3a11 was analyzed using real-time polymerase chain reaction. In addition, the liver of mice in all groups was examined for pathohistological alterations.

Results: Diabetes downregulated the mRNA expression of hepatic drug-metabolizing cyp450s in diabetic mice, while intermittent fasting significantly (P < 0.05) increased it. Also, cyp2d9 and cyp3a11 were upregulated in the liver of diabetic fasting mice. These alterations in the gene expression were correlated with the pathohistological alterations, where livers of diabetic mice showed dilatation in the blood sinusoids and inflammatory cells leukocyte infiltrations. Whereas livers of diabetic fasting mice showed almost comparable histological findings to control mice.

Conclusions: Intermittent fasting can protect the liver against diabetes-induced hepatotoxicity and the down-regulation of DME genes in the diabetic liver. These results can explain, at least partly, the inter-individual variation in the drug response during practicing fasting.

KEYWORDS:

• Cyp450s
• diabetes
• Ramadan intermittent fasting
• liver
• mRNA expression

1. Introduction

Drug-metabolizing enzymes (DMEs) metabolize exogenous and endogenous chemicals [1]. The major site of drug metabolism is the liver [2]. Most medications lose their therapeutic action primarily through metabolic biotransformation, which results in metabolites having a high solubility in water and being easily eliminated. Therefore, the regulation of drug pharmacokinetics depends greatly on metabolizing enzymes [2]. DMEs are classified into two categories: 1) Phase I enzymes which consist mainly of cytochrome P450 enzymes (CYP450s), and 2) Phase II enzymes, the conjugation phase, which consist mainly of UDP-glucuronosyltransferases (UGTs) [3]. Several factors, including genetic, health status, and environmental factors, affect the expression and activity of DMEs and hence affect the pharmacokinetics and drug response [4]. It was found that genetic variants in genes encode DMEs affect the response of many drugs used among diabetic patients [5–7].

Diabetes mellitus (DM) presents as high blood sugar or an increased glycosylated hemoglobin A1C and occurs due to problems with insulin synthesis by the pancreas or resistance by end-organ tissues [8]. Patients with DM frequently experience diabetic complications [8,9]. DM affects the activity of DMEs. It was found that the frequency of slow acetylators was higher among type II DM patients than non-DM controls [10]. In addition, we found previously that DM downregulated the mRNA expression of phase I and II hepatic DMEs [11].

Fasting is the behavior of refraining from eating food and/or drinking liquids for varying lengths of time. Fasting is advised as a therapeutic strategy for managing various chronic, non-infectious disorders [12]. To enhance body composition and general health, some methods that use short-term fasts by modifying the timing of eating are referred to as intermittent fasting [13]. The Islamic Ramadan fast is a 29–30 day fast during which food, liquids, medicines, and smoking are forbidden during the day. Depending on the region and season, this period can be extended from 13 to 18 hours daily [14]. Fasting during Ramadan is classified as intermittent fasting [15]. It was reported that there is a variation in the response of drugs during fasting of Ramadan month [16]. We found newly that intermittent fasting of mice upregulated the mRNA expression of the major hepatic DMEs [11].

According to the above information, both DM and intermittent fasting affect the expression of DMEs, however in an opposite manner. Many DM patients fast during Ramadan month. The exact expression of DMEs in the liver of fasted diabetic patients was still not investigated. This study designed in vivo animal model of DM mice exposed to intermittent fasting. This research aimed to find out the effect of fasting on the mRNA expression of the major hepatic DMEs in the livers of DM mice and to correlate the alterations in the expression of DMEs with pathological alterations in the liver induced by DM and fasting.

2. Material and methods

2.1. Chemicals

Ethanol (96%) was purchased from EMSURE (Darmstadt, Germany). Streptozocin, citric acid, and sodium citrate were purchased from Sigma-Aldrich (St. Louis, USA). Formaldehyde solution concentration (37–41%) was bought from SDFCL (Mumbai, India). Normal Saline (0.9%) was purchased from DEMO S.A (Kryoneri, Attiki, Greece). Complementary deoxyribonucleic acid (cDNA) synthesis kit and TRIazol reagent were obtained from Thermo Fisher Scientific (Massachusetts, USA). Nuclease-free water was purchased from Promega (Wisconsin, USA). Luna® Universal quantitative polymerase chain reaction (qPCR) Master Mix was bought from New England Biolabs (Massachusetts, USA). TB Green® Premix Ex Taq™ II (Tli RNase H Plus) was purchased from (Shiga, Japan). Primers of PCR were obtained from Integrated Deoxyribonucleic acid (DNA) technologies (Coralville, Iowa, USA).

2.2. Experimental animals

Thirty-two male Balb/c mice (Mus musculus), were obtained from Al-Zaytoonah University of Jordan’s animal house (Amman, Jordan). The mice weighed 28-34 g and were of similar age. The experimental procedure was approved by the ethical committee at Al-Zaytoonah University of Jordan (2017–2016/22/40), and the mice were handled according to the Canadian Council on Animal Care’s guidelines [17]. The mice were kept in cages that were 23°C ±1°C and had a 12-hour light/dark cycle. All animals were placed in separate cages and fed ad libitum pellets from a standard laboratory animal diet.

2.3. Experiment protocol

The mice were divided into four groups, each consisting of eight. Each group was kept in a separate cage, followed by a period of stabilization for one weak.

Groups of this experiment include:

1. The first group was the control group, which consisted of healthy non-diabetic mice that were fed diet pellets and water.

2. The second group was the non-diabetic fasted mice group, which consisted of healthy non-diabetic mice which fasted for 10 days.

3. The third group was the diabetic non-fasted mice group, which consisted of mice that were fed diet pellets and water.

4. The fourth group was the diabetic fasted mice group, which consisted of diabetic mice who fasted for 10 days.

The mice fasted from drinking and eating for 17 hours each day. The duration of the experiment was selected according to previous studies showed that 10 and less days of diabetes and fasting caused hepatotoxicity [18,19] and could alter the mRNA expression of DMEs [11].

The animal models and groups used in this study were selected in a trial to mimic the clinical situation where there are diabetic patients used to practice RIF.

2.4. Induction of diabetes in mice

Streptozocin was used to induce insulin-dependent DM in mice at a high single dose of 250 mg/kg [18]. Citrate buffer was freshly prepared from sodium citrate and citric acid. The buffer molarity was 0.1 M, and the pH of the buffer was acidic equal to 4.5. The pH of the buffer was measured with a pH meter to adjust the pH of the buffer before it was used. Streptozocin was dissolved in citrate buffer in a concentration of 250 mg/dL and placed on ice. The dose for each mouse was calculated according to the mouse’s weight. The mice were injected with streptozocin via an inter-peritoneal route. To ensure the induction of diabetes in mice, blood glucose levels were measured three days after streptozocin injection using Accu-Chek Performa® (Roche, Switzerland). The mouse was considered diabetic when the level of fasting blood glucose level is more than 200 mg/dL [20]. After three days of streptozocin injection, the blood glucose levels of streptozocin-treated mice were higher than 400 mg/dL, whereas the blood glucose levels of control non-diabetic mice were less than 125 mg/dL.

2.5. Blood glucose level analysis

Accu-Chek Performa® (Roche, Swiss) was used to measure the blood sugar level. The samples of blood were obtained from the tails of the experimental mice. The blood glucose levels were measured before starting of the fasting and after three days of streptozocin injection. In addition, the blood glucose level was measured for all mouse groups before starting the experiment.

2.6. Physical observation

Throughout the experiment, death and general health in the nondiabetic and diabetic groups were monitored daily. The body weights of mice were measured several times during this study: before the experiment, during the experiment, and at the end of the experiment before the mice were sacrificed. The amount of food and water consumed were monitored every day by weighing the average daily amount of food in grams and the volume of water consumed in mL. Furthermore, after the sacrificing of mice, the liver was isolated and the relative liver weight was determined for each mouse.

2.7. Histological analysis

The histological analysis was performed as we published previously [20]. After scarification of the mice, the liver samples were removed from the mice and rinsed in 0.9% normal saline, and then the liver samples were preserved in 10% formalin for more than one day. The samples were then dehydrated by passing them through a series of graded alcohols (70%, 80%, 90%, 95%, and 100%), followed by the cleaning agent xylene. After that, the liver tissues were embedded completely in paraffin wax. Hematoxylin and eosin were used to stain the liver slices. Finally, the Leica® microscope attached to a digital camera was used to take figures of liver slices.

2.8. RNA extraction and cDNA synthesis

The extraction of hepatic RNA followed by the synthesis of cDNA was done as we published previously [20]. About 200 mg of the liver was isolated from each mouse. The total RNA extraction from the liver samples was done using TRIazol solution according to the manufacturer’s instructions. Then, the synthesis of cDNA from the extracted RNA was done using the cDNA Synthesis Kit®, according to the manufacturer’s instructions. Briefly, 1 mg of the extracted RNA was added to a reaction mixture containing 100 pmol oligo-deoxythymine, 2.5 mM dNTP, 0.1 M DTT, 1X reverse transcriptase buffer, and 100 units of Moloney Murine Leukemia Virus reverse transcriptase, and then finally incubated at 37°C for 45 minutes.

The concentration and purity of the RNA and cDNA samples were determined by analyzing 1.5 μl from each sample using the NanoDrop instrument Quawell DNA/Protein Analyzer (Sunnyvale, CA, USA). Samples were within the acceptable purity ratio [21], which were around 2 ± 0.1 and 1.8 ± 0.1 for RNA and cDNA, respectively.

2.9. Gene expression analysis

The mRNA expression of mouse phase I enzymes cyp3a11, cyp1a1, cyp2c29, and cyp2d9 and housekeeping beta-actin genes were examined in this study, as prescribed previously [20]. The mouse cyp3a11, cyp1a1, cyp2c29, and cyp2d9 are equal to the human CYP3A4, CYP1A1, CYP2C9, and CYP2D6 genes that encode CYP450s metabolize 90% of total prescribe drugs [22,23]. The quantitative real-time polymerase chain reaction (RT-PCR) (Bio-Rad CFX96, Berkeley, CA, USA) was used to determine the fold change in the mRNA expression of these analyzed genes, as we published previously [16,20]. Briefly, 10ng of the synthesized cDNA was added to a reaction mixture containing TB Green® master mix and 10 pmoles of each forward and reverse primer. The following PCR condition was used: denaturation at 95°C for 3 minutes, followed by 40 cycles of denaturation at 95°C for 10 seconds and annealing at 53°C for genes and 55°C for beta-actin gene for 30 seconds (as shown in Table 1). The fold change in the mRNA expression was done using the ∆∆CT method [24].

Table 1. The primer name and sequence, the amplicon size, and the annealing temperature of cyp3a11, cyp1a1, cyp2c29, and cyp2d9 genes.

Gene Name	Forward primer	Reverse primer	Amplicon Size	Annealing temperature
cyp3a11	GGGCAGCATTGATCCTTATG	GAGGGAGACTCATGCTCCAG	250	53°C
cyp1a1	TGTGAAACCAGTGGCGGGTTA	GGCCAGGAAAGAGARAAGACC	220	53°C
cyp2c29	AGGAGTTTCCCAAACCCAGAG	TTCTTTTGGGTGGACCAGAG	203	53°C
cyp2d9	TCCTCCATGCTGAAAGATGA	CTGTCCATCAGGCACTGAGA	219	53°C

2.10. Statistical analysis

Results of gene expression, in this study, were expressed as the fold change in gene expression of groups of mice that had diabetes or/and fasted in comparison to the control group. The statistical tool used to compare the control group with other groups was the one-way ANOVA followed by the Tukey test. All the statistical analyses were done using the statistical package for social Sciences (SPSS) software (version 26). The results were considered statistically significant when the P-value was less than 0.05.

3. Results

3.1. Analysis of blood glucose level

Figure 1. Shows the analysis of blood glucose levels among tested animals. The blood glucose level of the control and the fasted groups is 96±3.64 mg/dL and 95±4.08 mg/dL, respectively. These blood glucose level values are within the normal range of blood glucose levels of mice [25]. In addition, blood glucose levels of the diabetes group and diabetes + fasting group were 479±105.49 mg/dL and 464±72.71 mg/dL, respectively, which were higher significantly (P value < 0.001) when compared with the control group.

Figure 1. Mice blood glucose level before starting the fasting. Values were represented as mean ± standard deviation. “*” indicates statistical significance with P value < 0.05.

3.2. Physical observation

3.2.1. Mice body weight

Figure 2 shows the average body weight of tested animals. The average body weight of the control and fasting groups was almost similar (control = 30.2 g, fasting = 31.1 g), while the average body weight of mice in the diabetic and diabetic + fasting groups was 25.5 g for both groups which was significantly (P value < 0.001) lower than the control group by 17%.

Figure 2. The average body weight of mice. Values are represented the mean ± SD.

3.2.2. Mice liver relative weight

Figure 3 represents the relative liver weights of the mice in this experiment. The results show that there is no significant (P value = 0.720) difference in the relative liver weight between the control and the diabetic group. However, the average relative liver weight of the two groups of non-diabetic fasted and diabetic fasted mice was significantly (P value = 0.001) lower than the average relative liver weight of the control mice (Figure 3).

Figure 3. The relative liver weight of mice. Values are represented as mean ± SD. ‘*’ indicates statistical significance with P value < 0.05.

3.3. Food consumption

The results of this study showed that fasted mice consumed food more significantly (P value < 0.001) than the control non-fasted group. In addition, diabetic mice consumed food more significantly (P value = 0.02) than the control non-diabetic group which is also a symptom of diabetes polyphagia for diabetes. The diabetic mice which fasted showed the highest consumption of food among other groups (P value < 0.001). Figure 4 shows the average food consumption during the experiment.

Figure 4. The average food consumption during the experiment (g/mouse). Values are represented as mean ± SD. ‘*’ indicates statistical significance with P value < 0.05.

3.4. Water consumption

Figure 5 shows the average amount of water consumed in mL for each mouse group. The results showed that the amount of water consumed among fasted mice was higher significantly (P value = 0.005) than the amount of water consumed among the control mice. Furthermore, the water consumption among diabetic mice was higher significantly (P value < 0.001) when compared with the control group which is a symptom of diabetes polydipsia among diabetic mice. The group with the significant (P value < 0.001) highest water consumption, among all tested groups, was the diabetic fasting mice.

Figure 5. The average amount of water consumed in mL for each mouse group. Values represent the mean ± SD. ‘*’ indicates statistical significance with P value < 0.05.

3.5. Histological analysis

Figure 6A–D represents histological sections of the mouse liver for the control, non-diabetic fasting, diabetes non-fasting, and diabetes fasting group. The results showed that livers of control (Figure 6a) and non-diabetic fasting (Figure 6b) mice have a normal histological appearance of Kupffer cell (KC), central vein (CV), and portal area (PA) and no alterations occurred in hepatocytes. The liver of diabetic non-fasting (Figure 6c) mice group showed several alterations in hepatocytes, including dilatation in the blood sinusoids (DBS), inflammatory cells leukocyte infiltrations (LI), the appearance of activated Kupffer cells (AKC), and dilatation in the central vein (DCV) and portal area (PA). The diabetic fasting (Figure 6d) mice had a normal histological appearance which was very similar to the control group.

Figure 6. Histopathological examination of mice liver sections. a: liver of control mice without fasting, b: liver sections of non-diabetic mice with fasting, c: liver sections of diabetic mice without fasting, d: liver sections of diabetic mice with fasting.

3.6. mRNA levels of Major drug metabolizing genes

Regarding gene expression, the mRNA level of phase I DMEs cyp3a11, cyp1a1, cyp2c29, and cyp2d9 genes were determined during this experiment.

3.7. mRNA expression of cyp3a11 gene

The strongest effect of diabetes and fasting was observed on the expression of the hepatic cyp3a11 gene (P value < 0.001), where diabetes downregulated significantly its expression by 4.76 ± 1 folds while fasting upregulated its expression by 13.7 ± 1.8 folds. Furthermore, it was found in this study that the expression of cyp3a11 was upregulated significantly by 3.5 ± 1.8 folds in the liver of diabetic and fasted mice, as shown in Figure 7a.

Figure 7. Effects of diabetes and fasting on the mRNA expression of mouse DME genes in the liver. a: the expression of cyp3a11, b: the expression of cyp1a1, c: the expression of cyp2c29, d: the expression of cyp2d9. Values are represented by mean ± SD. ‘*’ indicates statistical significance with P value < 0.05. Further details are in the method section.

3.8. mRNA expression of cyp1a1 gene

It was found in this study that there were some slight alterations in the mRNA expression of hepatic cyp1a1 induced by diabetes and fasting (Figure 7b). The expression of the cyp1a1 gene was downregulated by 1.7 ± 0.42 folds in the liver of diabetic mice, while it was slightly up-regulated by 1.23 ± 0.81 folds in the liver of fasted mice. The expression of cyp1a1 in the liver of both fasted and diabetic mice was comparable (1.07 ± 0.19 folds) to the control non-diabetic and non-fasted mice (1 ± 0.22). However, all these alterations in the cyp1a1 expression failed to reach the statistical difference (P value = 0.32).

3.9. mRNA expression of cyp2c29 gene

Figure 7c represents alterations in the mRNA expression of hepatic cyp2c29 induced by diabetes and fasting. The expression of cyp2c29 was significantly lower in the liver of diabetic mice (2.86 ± 0.87 folds) and higher in the liver of fasted mice (2.17 ± 1.03 folds). Fasting could significantly normalize the down-regulation of cyp2c29 expression induced by diabetes, where the expression of cyp2c29 in the mouse liver of diabetic fasted mice (1.74 ± 1.08 folds) was comparable to the control mice (1 ± 0.6 folds).

3.10. mRNA expression of cyp2d9 gene

Diabetes and fasting induced significant (P value = 0.01) alterations on the expression of hepatic mouse cyp2d9, as illustrated in Figure 7d. Diabetes down-regulated the expression of cyp2d9 by 1.62 ± 0.7 folds, while fasting upregulated its expression by 1.60 ± 0.6 folds. In addition, it was found that the expression of cyp2d9 was upregulated by 1.6 ± 0.32 folds in the liver diabetic and fasted mice.

4. Discussion

The rate and degree of drug metabolism vary greatly between people due to physiological, genetic, pharmacologic, environmental, and dietary variables [7,26]. Fasting can also contribute to medication disposition variability, which can lead to variations in drug response [27]. In addition, diabetes changes the hepatic capacity toward drug metabolism. We confirmed in this study what was reported previously that fasting upregulated significantly [11] the mRNA expression of the major hepatic DMEs cyp3a11, cyp2c29, and cyp2d9, while diabetes downregulated significantly these DME genes [18]. We added in this study that fasting could significantly ameliorate the downregulation of hepatic DMEs cyp3a11, cyp2c29, and cyp2d9 that are caused by diabetes. This finding was correlated with what was found in this study that fasting protected against pathohistological alterations induced by diabetes in the mouse liver. Accordingly, it can be speculated that fasting has a beneficial effect on the liver and hence the drug metabolism and response among human diabetic patients. These findings can increase our understanding of the variation in the drug response among diabetic patients through that RIF can influence further the mRNA expression of DMEs.

The majority of previous researches investigated different effects of fasting where animals had fully avoided food but still had access to water [28,29]. In the present study, the mice fasted by preventing both food and water to mimicking Islamic fasting during Ramadan month. The mice were fasted for 17 hours to match the average hours of Ramadan fasting in humans. We found previously that two-week fasting of mice caused a significant upregulation of hepatic DME genes [11]. Therefore, the mice have fasted for two weeks in the present study.

Uncontrolled insulin-dependent diabetes has several signs and symptoms, including hyperglycemia, ketoacidosis, polyuria, polydipsia, weight loss, stomach discomfort, and headaches. These symptoms often appear quickly, within days to weeks [11]. The tested mice in this study showed hyperglycemia, weight loss, polydipsia, and polyphagia after a few days of streptozocin injection. These symptoms confirm that the diabetic mice model in this study was an insulin-dependent diabetic mouse model.

One of the symptoms of insulin-dependent diabetes is weight loss [30]. In addition, weight, fat mass, and fat-free mass all significantly decreased during Ramadan fasting [31]. According to several research studies, mice lost weight considerably after 12, 24, and 72 hours of fasting [32,33]. Other studies found that mice lost weight differently following different fasting intervals in a time-dependent manner [11], where longer duration of fasting resulted in more weight loss [34]. In the present study, the total body weight of mice in groups of diabetic non-fasting and diabetic fasting mice was lower than groups of control and non-diabetic fasting mice. The body weights of control and non-diabetic fasting mice were comparable. It can be concluded from these findings that fasting alone did not reduce the mice’s weight, while diabetes decreased significantly the mouse’s body weight even when their food consumption was increased. This can be explained by the increased degradation of fats for energy production in the absence of intracellular glucose in insulin-dependent mice [35].

We found in this study that the relative liver weight of fasted mice, either diabetic or non, was significantly less than the weight of the livers of control and diabetic non-fasting mice. This finding agrees with what Balasmeh et al found that the relative weight of liver was reduced among fasted mice [11]. It can be concluded that fasting reduces the relative liver weight among diabetic and non-diabetic mice. It is still unclear the reason for relative liver weight reduction among fasting mice.

We found in this study that both diabetes and fasting increased food and water consumption. These findings confirm what we reported previously that the food and water consumption was increased by diabetic [18] and fasted [11] mice. It was reported that fasting for different periods caused higher food consumption among fasted mice [11]. Increased consumption of food and water by diabetic mice can be considered as diabetes symptoms of polyphagia and polydipsia, while increased consumption of food and water by fasted mice can be explained as behaviors to overcome the sharp decline in the nutrition and water in the body during fasting hours.

It was reported that diabetes causes different histopathological changes in hepatocytes [35]. A previous research had demonstrated that diabetes could result in histopathological changes in the liver, including lipid droplet accumulation, lymphocytic infiltration, high fibrous content, dilated and congested portal vessels, and an increase in bile duct proliferation [36]. In addition, diabetes elevates the level of hepatic enzymes aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, and pseudo-cholinesterase. Accordingly, this elevation in the level of hepatic enzymes is a sign of hepatotoxicity induced by diabetes [36]. This study showed similar findings to what was reported previously by Zafer et al [36], where livers of diabetic non-fasted mice showed several pathohistological alterations including dilatation in blood sinusoids, and the appearance of inflammatory leukocyte infiltrations. In addition, our results showed that diabetes activated Kupffer cells, and caused a dilatation of the central vein in the lobule and portal area in the liver.

It has been found that fasting does not affect the histology of the liver [11]. Additionally, it has been found that fasting protected against hepatic and renal impairments [37]. Furthermore, our results showed similar findings to the previous study [11], that fasted mice have a normal appearance of hepatic tissues. Additionally, we found in this study that the livers of diabetic mice that fasted for 17 hours had a normal histological appearance and were comparable to the livers of normal mice. This finding indicates that fasting has a protective effect against diabetes-induced hepatotoxicity which might be related that fasting reduces the oxidative stress on the liver [36], or it might due to that fasting reduced the blood glucose level and hence reduced the hepatotoxicological effects of hyperglycemia.

Some researches revealed that individuals with hepatic dysfunction had lower gene expression and DMEs activity [38,39]. Additionally, it has been reported that hepatic diseases, including cirrhosis and sepsis, decreased the gene expression of hepatic DMEs [40]. Interleukin, an inflammatory mediator generated following hepatic damage, has been shown to reduce the expression of phase I, and phase II DMEs, and drug transporters [41]. We reported previously that there is a negative correlation between the level of inflammatory mediators and the expression of hepatic DME [39]. The pathohistological analysis in this study showed that there is an infiltration of inflammatory cells in the liver of diabetic non-fasting mice, while these inflammatory cells were absent in the liver of diabetic fasting mice. These findings may indicate that the downregulation of DME genes in the liver of diabetic mice is due to the damage and induction of inflammation in the liver, and intermittent fasting ameliorated the damage and inflammation and hence the downregulation of DME in the liver of diabetic mice.

We found in this study that intermittent fasting upregulated significantly the expression of mouse cyp3a11 and cyp2d9 in the liver of non-diabetic and diabetic mice, in comparison with the control mice. Although fasting protected against diabetes-induced hepatoxicity, the upregulation of cyp3a11 and cyp2d9 genes might be due to that fasting activates pregnane X and constitutive androstane receptor transcriptional factors that regulate the mRNA expression of cyp3a11 and cyp2d9, respectively [42,43], or it might be due, at least partially, to the protective effect of fasting against diabetes on the liver which could ameliorate the mRNA expression of major DMEs to be in comparable levels with the normal non-diabetic liver.

Lastly, there are some limitations in this study: first, the mRNA expression of other DMEs such UGT enzymes were not be analyzed in this study. Second, this study did not analyze the protein expression of the major drug-metabolizing cyp450s. Although several studies had been shown that there is a positive correlation between the mRNA and protein expression of cyp450 enzymes [44,45], there are other studies showed that the protein expression might be in a discordance with the mRNA expression [46,47].

5. Conclusion

In conclusion, this study investigated the effect of two factors, diabetes and intermittent fasting, on the expression of hepatic major cyp450s and related the molecular findings with the pathohistological analysis. Intermittent fasting protects the liver against diabetes-induced hepatotoxicity and the downregulation of DME genes in the diabetic liver. These findings suggest that fasting has a beneficial effect on the diabetic liver, although it can upregulate the mRNA expression of some cyp450 genes. These results can explain, at least partly, the inter-individual variation in the drug response during practicing fasting. However, clinical studies are needed to confirm our findings on the experimental animals.

Acknowledgments

The authors would like to thank Al-Zaytoonah University of Jordan for supporting this research.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

The authors would like to extend their appreciation to Al-Zaytoonah University for funding this project.