Trans-cinnamaldehyde loaded chitosan based nanocapsules display antibacterial and antibiofilm effects against cavity-causing Streptococcus mutans

ABSTRACT

Background

Dental caries is a multifactorial disease, and the bacteria such as Streptococcus mutans (S. mutans) is one of the risk factors. The poor effect of existing anti-bacterial is mainly related to drug resistance, the short time of drug action, and biofilm formation.

Methods

To address this concern, we report here on the cinnamaldehyde (CA) loaded chitosan (CS) nanocapsules (CA@CS NC) sustained release CA for antibacterial treatment. The size, ζ-potential, and morphology were characterized. The antibacterial activities in vitro were studied by growth curve assay, pH drop assay, biofilm assay, and qRT-PCR In addition, cytotoxicity assay, organ index, body weight, and histopathology results were analyzed to evaluate the safety and biocompatibility in a rat model.

Results

CA@CS NC can adsorb the bacterial membrane due to electronic interaction, releasing CA slowly for a long time. At the same time, it has reliable antibacterial activity against S. mutans and downregulated the expression levels of QS, virulence, biofilm, and adhesion genes. In addition, it greatly reduced the cytotoxicity of CA and significantly inhibited dental caries in rats without obvious toxicity.

Conclusion

Our results showed that CA@CS NC had antibacterial and antibiofilm effects on S. mutans and inhibit dental caries. Besides, it showed stronger efficacy and less toxicity, and was able to adsorb bacteria releasing CA slowly, providing a new nanomaterial solution for the treatment of dental caries.

KEYWORDS:

• Streptococcus mutans
• dental caries
• chitosan
• cinnamaldehyde
• nanocapsules
• antibacterial agents
• antibiofilm

Introducion

Dental caries (tooth decay) is an oral disease characterized by the chronic and progressive destruction of teeth, and it is caused by multiple factors and seriously endangers the oral health of people all over the world [1]. And it is sometimes painless, which makes it easy for most people to ignore it. If dental caries spreads to the dental pulp, it will occasionally lead to serious systemic diseases such as severe opportunistic infection and sepsis [1,2]. According to available studies, more than 2.0 billion people worldwide suffer from dental caries, which imposes a significant economic burden [3–5]. Biofilms are generated by the dysregulation of oral microbiota homeostasis, host factors, diet, and other factors. It is a dynamic microbial community immersed in a self-produced extracellular matrix, of which the main component is extracellular polysaccharides, which can protect the biofilm from saliva and agents [1]. Therefore, the prevention of biofilm formation is essential for the prevention of several oral diseases, including dental caries. Streptococcus mutans (S. mutans) is one of the major cariogenic bacteria in the oral cavity, and it forms most of the biofilm [6,7]. Moreover, bacterial quorum sensing (QS), and the mechanism by which bacteria regulate related genes expression in accordance with population density, further promotes biofilm and virulence production. All of these causes lead to further demineralization of the teeth, resulting in caries [8–10]. Traditional treatments suggest taking a certain amount of fluoride, but this may not fundamentally inhibit the growth of bacteria and biofilm formation in the oral cavity. In addition, inappropriate fluoride exposure may have adverse consequences in some high fluoride areas for certain special populations [11,12]. More and more research has focused on the role of microorganisms in the pathogenesis of caries, but oral bacterial resistance to newly developed antibacterial drugs is another concern. It is urgent to develop new drugs that inhibit bacterial QS and biofilm formation for antibacterial to prevent dental caries.

In recent years, nano-drug delivery systems have been widely used in various fields. Nanoparticles can be designed to stimulate the release of drugs in different situations so that drugs are not affected by pH, enzymes, and other factors. They have also been used in the field of the oral cavity, such as hydroxyapatite platform nanoparticles for repairing caries [13], silver nanoparticles (Ag NPs) or zinc oxide nanoparticles (ZnO NPs) for treating periodontitis and oral ulcer [14,15], the iron oxide particle-based system for treating caries [16], etc. However, the toxicity caused by their accumulation in other organs is still controversial. The off-target effect and toxicity of these nanoparticles need to be further studied and verified [17,18].

Chitosan (CS), a product of deacetylation of chitin, has the advantages of good biocompatibility, antibiosis, and promotion of enamel remineralization, and is declared by US FDA to be GRAS (Generally Recognized as Safe) [19,20]. Lots of studies have shown that CS can inhibit the formation and adhesion of dental plaque and biofilm. Its positive potential groups can disrupt the bacterial cell membrane, thereby effectively inhibiting bacterial growth [19,21]. CS has been widely used in skin hydrogels, mouthwashes, and toothpaste, showing excellent antibacterial effects and enamel protection [20]. On the other hand, more studies showed that chitosan-based nanoparticles have higher antibacterial performance than pure chitosan due to the increase of specific surface area, which has better adhesion and can play an important role in the prevention and treatment of dental caries [19,21,22]. Cinnamaldehyde (CA), as a natural extract, has anti-inflammatory and broad-spectrum antibacterial effects. It could be a potential anti-caries drug due to its strong effect of inhibiting S. mutans [23–26]. However, its application is limited due to its low water solubility. Therefore, multifunctional nanosystems with high-concentration CA loaded need to be designed to inhibit S. mutans, to achieve the purpose of preventing dental caries.

Herein, a novel anti-caries nanosystem was prepared by loading CA into CS-based nanocapsules (Scheme 1). Due to the oily core and sustained release properties, the CS NC can load more CA while reducing toxicity. The slow release of CA@CS NC not only inhibited the acid production and biofilm formation of bacteria but also down-regulated the QS system, exhibiting strong anti-caries activity through rat caries model, as demonstrated from both in vitro and in vivo studies.

Scheme 1. (a) CA@CS NC has a positively potential surface and continuously releases CA. (b) CA@CS NC can inhibit dental plaque to protect teeth. (c) At the same time, it can adsorb S. mutans through electrostatic interaction and slowly release CA, thereby inhibiting bacterial growth, acid production, biofilm formation and other risk factors leading to dental caries.

Materials and methods

Materials

CA (Table S1) and CS were purchased from Macklin Biological Co., Ltd. (Shanghai, China), the average molecular weight of CS is 3.0 × 10⁵ Da, and the degree of deacetylation is about 10%. Soy lecithin was purchased from Pengrui Biomedicine Co., Ltd. (Pizhou, China). Hematoxylin and eosin (HE) dye solution, neutral gum, and CCK-8 kit were purchased from BioSharp Co., Ltd. (Hefei, China). Miglyol 812N was purchased from Beijing Fengli Jingqiu Pharmaceutical Co., Ltd. (Beijing, China). Phosphate buffered solution (PBS) solution was prepared with NaCl, KCl, Na₂HPO₄, and KH₂PO₄. The pH value of PBS was adjusted with hydrochloric acid and sodium hydroxide to 7.4, and the concentration of PBS is 0.1 M. The model strain of S. mutans (UA159) was donated by the stomatology laboratory of Zunyi Medical University, and human oral epithelial cells (HOECs) were derived from the cell-sharing platform of Zunyi Medical University. Sprague-Dawley rats were purchased from Zhuhai BesTest Bio-Tech Co., Ltd. (Zhuhai, China).

Preparation of nanocapsules and nanoemulsions

Chitosan-based nanocapsules and nanoemulsions were prepared according to previous methods with slight modifications [27,28]. The nanoemulsions (NE) were prepared using an identical protocol as for the CS NC, but the aqueous phase consisted only of deionized water. To prepare the CA loaded CS NC (CA@CS NC) and NE the protocol was identical as for the blank systems, but, 10 mM ethanolic CA stock was mixed with 10 mL ethanol and added in the organic phase.

Physicochemical characterization of nanomaterials

The ultrastructure of the nanomaterials was investigated by TEM using a RuliTEM (Hitachi, Japan). Add an appropriate amount of water in a ratio of 1:10 diluted nanocapsules and nanoemulsions, then use a Ζetasizer NanoZS (Malvern, UK) equipped with 4 mW helium/neon laser (λ = 633 nm) and detection was at an angle of 173° to scan the size and ζ-potential determined by dynamic light scattering (DLS). In addition, ζ-potentials of 1:10 dilutions of CA@CS NC and S. mutans were measured. After that, the two were mixed 1:1 and measured the ζ-potential.

Measurement of encapsulation rate and cumulative release

To measure the prepared CA@CS NC, 6 mL suspension of the prepared nanocapsules after dialysis was transferred into a dialysis bag (1000 Da) and immersed into 300 mL PBS (pH = 7.4) at room temperature. Then 3 mL of the solution at varied time intervals were taken from the dialysates to measure the concentration of released CA by monitoring the absorption peak located at 280 nm by UV – Vis spectrometry. After the sampling solution was taken, 3 mL fresh PBS was added back to keep the total volume of the test solution constant.

Bacterial strain and growth curve assay

S. mutans (UA159) was grown in Brain Heart Infusion Broth (BHI) at 37°C. S. mutans (1 × 10⁸ CFU/mL) cultured overnight to mid-log phase strain was added to a 96-well plate. To explore the effect of different components of CA@CS NC on bacterial growth, the final concentrations of groups corresponded to those of the CA@CS NC group. The concentration of CA and CS in the CA@CS NC group was 1 mM (132 μg/mL) and 100 μg/mL, respectively. Thus, CA was 1 mM in the CA group and CA@ NE group, and CS was 100 μg/mL in the CS group and CS NC group. The NE did not contain CS and CA. To verify the effect of other potential components on bacteria, the dilution method of NE group was referred to CA@CS NC group, so that the concentration of components with potential antibacterial effects such as lecithin, Miglyol 812N, et al corresponded to CA@CS NC. In addition, kanamycin (KANA) was used as a positive control. The optical density at 600 nm (OD₆₀₀) was measured every 2 h throughout the incubation using a Multiskan SkyHigh (Thermo Scientific, USA). Every treatment was performed in duplicate in at least three different experiments.

Glycolytic pH drop assay

The effect on acid production by S. mutans was determined by the method of the previous study with an appropriately extended measurement time [26,29]. S. mutans were harvested in the mid-log phase, centrifuged (4°C, 5000 rpm, 5 min), and washed with saline solution (50 mM KCl +1 mM MgCl₂). Thereafter, CA@CS NC was added to BHI to a final concentration of 1 mM, and the remaining groups were added to a final concentration of 1% (w/v) glucose as in the above experiment, and the initial pH of the mixture was adjusted to about 7.3 with KOH. The pH reduction was monitored over an 8 h period. The results correspond to three experiments independently.

CLSM analysis

Biofilms were formed on circular glass slides in a 24-well plate. Specifically, S. mutans (UA159) in the logarithmic growth phase was adjusted to a final density of 2 × 10⁶ CFU/mL with BHI medium supplemented with 1% sucrose. 12 h after biofilm formation, the circular glass slides were removed and placed in another new 24-well plate for treatment. The glass slides were washed three times (1 min/time) with PBS (pH = 7.4), and then CA@CS NC or other drugs were added into corresponding wells. After 10 min treatment, the glass slides were washed three times with pH 7.4 PBS and then transferred into a new 24-well plate containing fresh BHI medium supplemented with 1% sucrose. This treatment regimen was administered every 12 h for a total of 3 times. Thereafter, L7012 LIVE/DEAD BacLight bacterial cells (OR, United States) containing SYTO 9 dye and propidium iodide were stained in the dark for 30 min for confocal laser scanning microscopy imaging (Leica, Germany).

CCK-8 assay

HOECs were cultured in high-glucose medium in an incubator at 37°C, 90% relative humidity, and 5% CO₂. First, the cultured cells were seeded onto 96-well plates for 24 h, 100 μL per well, and the cell density was about 5000 cells/well, and repeated three times. CA@CS NC and CA were added to different wells. After culturing for 6 h, 10 μL CCK-8 reagent was added, and the growth was continued for 12 h. The culture medium was washed with Hanks solution, and 200 μL high-glucose medium was added to measure the optical density of the solution at 450 nm (OD₄₅₀) with a Multiskan SkyHigh. The results correspond to three experiments independently.

RNA isolation and quantitative real-time PCR (qRT-PCR)

To study the effect of CA@CS NC on the expression of genes of S. mutans, we contrasted the effects of CA@CS NC and blank groups on the genes of S. mutans at equal concentrations. Among the genes studied (Table 1), there are 5 genes involved in QS regulation (comB, comE, comS, comA and comR), 1 gene involved in biosynthesis and adhesion (gbpB), 1 gene involved in two-component signal transduction system and bacterial virulence (vicR), 3 genes involved in extracellular polysaccharide synthesis (gtfB, gtfC, gtfD) [26,30–33]. The organism was treated with CA@CS NC and cultured in medium for 12 h. Cells were harvested by centrifugation from 15 mL centrifuge tube and then incubated by lysozyme (20 mg/mL) at 37°C for 25 min. Total RNA was extracted from cells using Trizol reagent (Solarbio, China) according to the manufacturer’s instructions. Purified RNA was dissolved in 30 µL of DEPC-treated water and stored at −80°C until required for cDNA labeling. cDNA was generated with HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, R323–01). The cDNA samples were stored at −20°C until used.

Table 1. Nucleotide sequences of primers used in qRT-PCR and based on S. mutans genome database (NCBI).

Gene	Description	Primer sequence (5’−3’)
16S rRNA	Normalizing internal standard	F: CCTACGGGAGGCAGCAGTAG R: CAACAGAGCTTTACGATCCGAAA
comB	Putative ComB	F: CCAGTCCAAACCGTCAGACT R: GCTGCTTTCCTTGTCTTTCG
comE	Response regulator of the competence regulon	F: GCCCTTTTCAGGGATAGCGT R: AGGACGTCTTGAAACCACCA
comS	Regulator of genetic competence ComS	F: TTTTGATGGGTCTTGACTGG R: TTTATTACTGTGCCGTGTTAGC
comA	Two-component response quorum-sensing regulator	F: ACGAGCCTAACAAGGGGATT R: CCCTGAGGCATTTGTTCAAT
comR	TetR family copper-responsive transcriptional repressor ComR	F: CGTTTAGGAGTGACGCTTGG R: TGTTGGTCGCCATAGGTTG
gbpB	Glucan binding protein	F: ATGGCGGTTATGGACACGTT R: TTTGGCCACCTTGAACACCT
vicR	Response regulator	F: TGACACGATTACAGCCTTTGATG R: CGTCTAGTTCTGGTAACATTAAGTCCAATA
gtfB	Accessory Sec system glycosylation chaperone GtfB	F: GGACAGCCGATGATTTGG R: CTTCGCTTGCAGCTCCTC
gtfC	Glucosyltransferase GtfC	F: CCATCGAAACCCTGCTTAAA R: GCGATCAGAAGCCTTCAAAC
gtfD	Glucosyltransferase-S	F: AACCGCACACCAACCAGT R: CAACGGCATCAACACGAA

The qRT-PCR analysis was carried out in 96 well plates. Reaction mixture: in a total volume of 10 µL, consisted 5 µL 2X SYBR Green PCR Master Mix, forward and reverse primers (0.2 µL each), 3.6 µL ddH₂O and 1 µL 10X diluted cDNA. Reaction procedure: the PCR conditions included an initial denaturation at 95°C for 5 min; followed by 40 cycles of denaturation at 95°C for 10 s, annealing (60°C for 20 s), extension (72°C for 1 min). The relative gene expression was analyzed using the 2^−ΔΔCt method. The results correspond to three experiments independently.

Rat caries model

The animal study was approved by the Laboratory Animal Welfare and Ethics Committee of Zunyi Medical University (ZMU21-2302-008). The rat caries model was performed using a modified method [34,35] (Scheme 2). We determined the optimal sample size of animals used based on the literature [36]. Forty of 21-day-old male SD rats were fed with diets containing carbenicillin, ampicillin, and chloramphenicol from 21 to 24 day-old before establishing oral bacterial inoculation. After 3 days, the rats were inoculated twice daily with S. mutans suspension from 24 to 29 day-old. At the same time, these rats were fed Keyes 2000 # diet until the end of the experimental period to induce severe dental caries. After the completion of bacterial solution inoculation, rats were anesthetized with isoflurane every 3 days and fed with 200 μL of the corresponding drug in each group, and the drug was dipped into a sterile cotton swab and fully smeared on the tooth surface of rats for 5 min. Moreover, general conditions such as body weight, fur color, and activity of the rats were recorded throughout the experiment. Finally, the rats were sacrificed after gas anesthesia at 45 day-olds.

Scheme 2. The scheme design of this study. To evaluate the anti-caries effects of nanomaterials and related drugs in a modified caries rat model.

Rat organ index and HE staining

The organ index method can reflect whether there is a change in organ volume and weight through the proportion of body weight in the body, which can roughly show the toxicity of drugs to different organs [37,38]. The total body weight of the rats was weighed and recorded before dissection. The heart, liver, spleen, lung, kidney, and testis were obtained by dissection, weighed, and recorded. Organ index = (organ weight/total body weight) × 100%. Then, the main organs collected were then stained with HE and observed under a microscope.

Evaluation of dental plaque and caries severity in rats

After decapitation, the jaw bone was observed under a stereomicroscope, and the dental plaque was quantitatively evaluated using the method of Shuhei Naka et al [39]. Then the skull was removed and placed in an autoclave at 121°C for 15 min. The attached soft tissue was peeled off with a scalpel, and the jaw was cleaned and dried at room temperature. All of the specimens were immersed in a 0.4% ammonium purpurate staining solution for 12 h, rinsed, and semi-sectioned along the occlusal surfaces of maxillary and mandibular molars using a diamond cutter (thickness: 0.1 mm). Caries on the rat molars were observed and evaluated under a stereomicroscope according to the caries diagnosis and scoring method reported by Keyes [39–41].

Statistical analysis

All data were expressed as mean ± standard deviation. Two-way analysis of variance (ANOVA) with the Geisser-Greenhouse correction and Tukey’s multiple comparisons test, one-way ANOVA, and Holm-Sidak’s multiple comparisons test were used to calculate the significance of differences between groups under test conditions (GraphPad Prism 8.4.0 software, United States).

Results

Nanocapsules exhibit unique physical properties and adsorb S. mutans

Firstly, Figure 1(d) shows the nanomaterials-related structures and abbreviations, which will be used to replace nanomaterials in the results. And the ζ-potential refers to the potential of the shear plane, also known as Zeta potential, which is an important index to characterize the stability of colloidal dispersions. Polymer dispersity index (PDI) is a measure of the heterogeneity of sizes of molecules or particles in a mixture [42]. Table 2 shows the sizes and ζ-potential of nanocapsules and nanoemulsions. The results showed that the prepared nanomaterials were homogeneous (PDI <0.2). And the size is mostly in the range of 210 ~ 250 nm with obvious positive potential. Figure 1(a) shows the TEM image of CS NC, which has a spherical morphology and a core-shell structure with a particle size of about 150 nm. The larger size measured by DLS is due to solvent effects in the hydrated state. On the other hand, nanoemulsions have a particle size slightly smaller than nanocapsules, mostly around 200 nm, and exhibit clear negative potential. And nanoemulsions are smaller than nanocapsules because of the lack of CS shell. These characteristics are similar to previous studies [27,43,44]. The bacteria showed negative potential, however, when S. mutans was mixed with CA@CS NC, the bacteria solution showed positive potential when combined with nanocapsules, indicating the electronic interaction between S. mutans and nanocapsules [45,46]. In addition, Figure 1(b) shows the calibration curve of CA, y = 0.0779 x − 0.008 (R² = 0.9968). Based on this curve, the encapsulation rates of 5 mM and 10 mM CA@CS NC were 81.74% and 90.59%, respectively. And Figure 1(c) shows the sustained release of 10 mM CA@CS NC, which has a slower release rate of 21.7% in the first 2 h and 27.9% in the first 12 h.

Figure 1. (a) Representative TEM images of CS NC. (b) The CA concentration standard curve. (c) The cumulative release of 10 mM CA@CS NC. (d) Schematic representation of the nanomaterials and related agents with abbreviations.

Table 2. Size and ζ- potential of nanomaterials and S. mutans. And the changes of 5 mM CA@CS NC bound with S. mutans.

Group	Size (d. nm)	PDI	ζ-potential (mV)
10 mM CA@CS NC	215.1 ± 6.6	.103 ± .016	35.0 ± .643
5 mM CA@CS NC	211.2 ± 3.3	.046 ± .038	23.0 ± 1.447
NC	239.3 ± 4.7	.104 ± .070	19.0 ± .700
10 mM CA@ NE	183.4 ± 3.3	.131 ± .020	−26.6 ± 1.217
5 mM CA@ NE	204.3 ± 2.5	.138 ± .019	−28.1 ± 1.290
NE	208.8 ± 2.5	.138 ± .047	−25.6 ± .252
S. mutans	1487.0 ± 114.9	.244 ± .015	−6.9 ± 1.721
5 mM CA@CS NC + S. mutans	762.3 ± 70.4	.246 ± .020	12.7 ± .981

CA@CS NC can effectively inhibit the growth and biofilm formation of S. mutans, down-regulate the expression of related genes

Figure 2(a) shows the growth inhibition of S. mutans by the nanomaterials and the related drugs. According to the result in Figure S1, the Minimum Inhibitory Concentration (MIC) of CA against S. mutans UA159 was 500 μg/mL (about 3.7 mM), which was much higher than the concentration (1 mM) set in this study. After 12 h of bacterial culture, 1 mM CA@CS NC (OD₆₀₀ = 0.198 (±0.035)) significantly inhibited the bacteria, and the inhibitory effect was better than that of 1 mM CA (OD₆₀₀ = 0.469 (±0.009)). According to the results in Figure 1, CA@CS NC can sustained-release about 30% CA (0.3 mM) within 12 hours at a concentration below 1 mM CA. In the comparison of OD₆₀₀ values, CA@CS NC showed a better effect than CA at lower concentrations. At the same time, it was found that floccule was formed after the addition of nanocapsules. Therefore, we carried out microbiological turbidimetry and the results (Figure S2) also showed that CA@CS NC showed better effects than CA.

Figure 2. (a) Effects of composition of different drugs on the growth curve of S. mutans. (b) Effect of different drugs on acid production. (c) 1 mM CA@CS NC regulate the expression of genes related to S. mutans. (d) Inhibitory effect of different drugs components on biofilms of S. mutans.

Dental demineralization caused by acid production by bacteria such as S. mutans is an important factor leading to caries. Inhibition of acid production by cariogenic bacteria such as S. mutans can prevent caries. Figure 2(b) shows the effect of the drugs on acid production by S. mutans. According to the above results, the sustained release of CA@CS NC was approximately 30% within 8 hours. At this time, the effective CA concentration in the CA@CS NC group was approximately 0.3 mM. Compared with the pH value of the blank group (4.200 ± (0.010)), the acid production of bacteria in the other drug treatment groups was inhibited except NE (4.263 ± (0.015)). In summary, CA@CS NC exerted a similar effect as 1 mM CA with a sustained release of 0.3 mM CA concentration. In addition, CS also inhibited acid production, suggesting a synergistic effect of CA@CS NC on the inhibition of acid production in S. mutans.

To understand the expression of genes related to QS, virulence, biofilm and adhesion of S. mutans, the effect of CA@CS NC on S. mutans was quantitatively studied by qRT-PCR. The results in Figure 2(c) showed that the CA@CS NC successfully down-regulated QS, virulence, adhesion, biofilm-related, and extracellular polysaccharide synthesis gene expressions.

Figure 2(d) shows visually the inhibitory effect of nanomaterials and CA on the biofilm formation of S. mutans by CLSM assay. As can be seen from the results of the nanomaterials, a comparison between nanocapsules and nanoemulsions, the electrostatic interaction of nanocapsules plays an important role in significantly inhibiting biofilm formation by bacterial aggregation. In addition, the biofilm formation was strongly inhibited by CA loaded nanomaterials compared with the unloaded nanomaterials. In conclusion, CA@CS NC could absorb S. mutans and slow release of CA, significantly inhibit biofilm formation through the combination of CS and CA.

The nanocapsules showed no obvious toxicity in vivo and in vitro

Figure 3(a) shows the cytotoxicity of CA@CS NC and CA to HOECs by CCK-8 assay. The results showed that the cytotoxicity of CA@CS NC was significantly lower than that of CA at same concentration. When the concentration of CA@CS NC was 0.25 mM, the cell survival rate was 102.703 (±23.682)%, while the cell survival rate of the same concentration of CA was only 60.566 (±19.382)%. The above results showed that the slow release of CA from CA@CS NC reduced the cytotoxicity.

Figure 3. (a) In vitro cytotoxicity assay of CA@CS NC and CA. (b) Rat body weight changes and (c) Organ index in the rat model. (d) HE stained sections of rat liver, stomach and submandibular gland.

In the rat model, we weighed the rats and recorded fur color, diet, and activity. During the experiment, the rats were generally in good condition, and there was no significant difference in body weight among the groups (Figure 3(b)). In addition, organs were weighed after sacrifice, and there was no significant difference in organ index (P > 0.05) as shown in Figure 3(c) too. In this study, drugs were administered by smearing on the teeth and did not enter the bloodstream. To evaluate the condition of the organs, we prepared pathological HE stained sections of potentially damaged organs. From the results in Figure 3(d), the pathological specimens of liver, stomach, and submandibular gland showed a small amount of inflammatory cells infiltrate the tissue, and there was no obvious organ damage which could be observed.

CA@CS NC showed excellent inhibition of dental plaque and caries in the rat model

Due to the antibacterial, acidogenic, and anti-biofilm formation effects of CA@CS NC in vitro, we further evaluated its anti-caries effect in a rat model. Figure 4(a) shows the dental plaque and caries (sulcal lesions) of the rats; macroscopic observation showed that the CA@CS NC group had significantly reduced plaque, and its plaque was similar to that of the NaF group. According to the results of tooth section staining, the teeth in the CA@CS NC and NaF groups showed lighter coloration after staining, indicating that S. mutans could cause initial lesions after drug treatment. However, other groups showed dark red or reddish-brown colorations, indicating moderate or even severe lesions.

Figure 4. (a) the smooth surface of the tooth after plaque staining, and the section of the tooth after Keyes score staining. (b) Dental plaque staining in rats. (c) Comparison of the lesion of caries between CA@CS NC and CA (d) Effect of CA concentration in the nanocapsules system on Keyes’ scores.

To further comprehensively evaluate the caries, we evaluated the dental plaque (Figure 4(b)) and caries lesions results (Figure 4(c,d)) by plaque score and Keyes’ score, respectively. As shown in Figure 4(b), the score of CA@CS NC group (1.700 (±0.326)) was similar to that of NaF group (1.800 (±0.371)), which showed significant less plaque compared with other drug treatment groups.

According to the depth of caries, the caries classification was divided into different lesions (E, Ds, Dm, and Dx). Due to the strong cariogenic ability of the modified rat model, a large number of superficial caries were produced in each group, and the anti-caries effect was not obvious among the drug treatment groups. However, for moderate and severe lesions (Ds, Dm, and Dx), significant differences were observed among groups. Figure 4(c) compared the caries lesions of CA@CS NC and CA, and it can be seen that the effect of CA@CS NC group in inhibiting Ds, Dm and Dx lesions was significantly better than that of the CA group. On the other hand, Figure 4(d) shows the caries lesions of the nanocapsules with different CA concentrations. With the increasing concentration of CA, it showed excellent anti-caries performance. In addition, there was no significant difference (P > 0.05) between the CS NC group and the blank group, and the 5 mM CA and CS had poor anti-caries effect (Figure S3).

Discussion

The chitosan-based nanocapsules have an oil core with a size of 210 ~ 250 nm which can improve the problem of weak antibacterial effect of fat-soluble drugs caused by poor water solubility [47]. And they have CS shells with positive potential, which can adsorb bacteria through electrostatic interaction. At the same time, the loaded fat-soluble drugs can be slowly released by the mechanism of natural leakage, and the antibacterial effect can be stronger for a long time. As a biocompatible drug, chitosan-based nanocapsules have been widely used for antibacterial and anti-tumor [48–50]. For example, Capsaicin@chitosan nanocapsules (CAP@CS NC) can inhibit Escherichia coli and Staphylococcus aureus by encapsuling capsaicin. In terms of anti-tumor, curcumin loaded chitosan/perfluorohexane (CS/PFH) nanocapsules (CS/PFH-CUR-NCs) were used to treat rectal cancer by oral administration [51–53]. Thus, chitosan-based nanocapsules have great potential to combat chronic infectious diseases.

Dental caries is a multifactorial oral disease, and S. mutans and other bacteria play an important role in the occurrence of dental caries. S. mutans mainly adheres to the tooth surface to form biofilm, produce acid, and exert QS effect, which is a key factor leading to caries [54–56]. In the study, we chose a concentration below the MIC of CA (500 μg/mL). At the concentration of 1 mM (132 μg/mL), the growth of S. mutans could not be effectively inhibited by CA alone, reflecting the antibacterial property of low concentration of CA@CS NC. The positively potential CS shells adsorbed bacteria and slowly released CA, forming a relatively high concentration of CA around bacteria, inhibiting acid production and biofilm formation, and down-regulating the expression of related genes of S. mutans. As mentioned above, acid production is an important factor in the occurrence of dental caries. Based on the sustained release assay of CA@CS NC, only about 30% CA was released within 8 h. And the results of the glycolytic pH drop assay showed that CA@CS NC and CA had similar effects within 8 h, at which time the CA in CA@CS NC was not completely released. These results indicate that CA@CS NC inhibits acid production by S. mutans at a lower concentration of CA. Not only that, CA@CS NC after 8 h will continue to slowly release CA to inhibit bacterial acid production.

In previous studies, it has been recognized that chitosan-based nanomaterials have reliable biosafety [19,57]. And CA@CS NC showed excellent biological safety in the results of CCK-8 cytotoxicity assay and HE staining tissue sections to detect the toxicity of CA@CS NC. Our studies proved that the CA encapsulated chitosan-based nanocapsules not only did no obvious toxicity occur in the animal model, but greatly reduced the toxicity of CA in vitro by slow release without attenuating the antibacterial effect.

In our study, CA@CS NC downregulated the expression of S. mutans genes. Among them, gtfB, gtfC, and gtfD are related to extracellular polysaccharide synthesis, and down-regulation helps to inhibit biofilm formation. Downregulation of VicR and gbpB contributes to the inhibition of adhesion, biofilm formation, and virulence expression. In addition, ComB, ComE, ComS, ComA, and ComR are closely related to bacterial QS, and the down-regulation of these genes is of significance for inhibiting resistance. According to previous studies, QS allows bacterial groups to change behavior synchronously in response to changes in population density and species composition in nearby communities. S. mutans can use its multiple two-component QS system to resist the harsh physiological conditions of the oral environment and regulate the gene expression of multiple phenotypes [58,59]. Therefore, down-regulation of QS related genes is beneficial to interfere with the information exchange of S. mutans, regulate biofilm and virulence, and thus inhibit dental caries [60]. Alternatively, biofilm formation can protect bacteria from the action of antibiotics and is associated with bacterial resistance [61]. Biofilm formation is triggered by the bacterial QS system, and an extracellular matrix composed of polysaccharides, proteins, and extracellular DNA may prevent certain antibiotics from successfully penetrating the cell. Since QS induces deleterious properties such as biofilm formation or virulence, interfering with bacterial communication is a promising strategy to prevent the synchronization of bacterial virulence behavior [62]. In our study, CA@CS NC down-regulated QS gene, inhibited bacterial population effects such as biofilm formation and acid production, and better exerted the antibacterial effect of low-concentration CA.

Bacterial acid production, biofilm formation, and tooth demineralization and re-mineralization are the key factors in the process of caries formation [26,35]. On the one hand, plaque score can systematically quantify the number and distribution of bacteria on tooth surfaces after drug treatment. On the other hand, the Keyes scoring method is a systematic evaluation based on tooth structure, which can fully show the degree of tooth demineralization and the severity of lesions. In our results, plaque scores were significantly decreased after treatment with CA@CS NC. At the same time, the development of dental caries was inhibited in Keyes’ scores results in CA@CS NC group. CA@CS NC shows similar effects as NaF in a rat model, which provides a new idea for the future anti-biofilm and anti-caries treatment. Therefore, CA@CS NC may become a more suitable treatment option for patients with dental caries in high-fluoride areas. Keyes’ scoring system is widely used in the quantitative evaluation of dental caries, which can evaluate the depth and number of dental caries by scores. In the process of dental caries, various cells and tissues in the dental pulp, including odontoblasts, fibroblasts, stem cells, immune cells, blood vessels and nerves, recognize pathogens early and participate in various inflammatory reactions, forming a variety of different defense mechanisms [63,64]. As secretory cells, odontoblasts have immune functions. And the products of microbial proliferation and metabolism can stimulate the surrounding dental pulp through the dentinal tubules and produce the effect of repairing dentine. Mild stimulation can up-regulate odontoblasts’ activity to form reactionary dentine, while strong stimulation can cause their death and trigger a complex process involving the recruitment of dental pulp stem/progenitor cells to form reparative dentine [65]. According to previous studies, Wnt signaling and others induced this repair process, and the rat experiment showed a significant repair effect within 14 days [66,67]. In our animal results, there were no significant differences among groups for mild caries lesions (E). Based on the above theory, we speculate that the reparatory effect of odontoblasts makes the lesions that should be more severe still mild, and this effect is important for the rapid restoration of homeostasis so that the results are not different in superficial caries. In moderate and severe lesions (Ds, Dm, and Dx), the repair effect is not significant because of homeostatic imbalance caused by excessive stimulation. However, CA@CS NC inhibits the development of dental caries by virtue of its excellent antibacterial properties, and its effect is similar to that of clinical anti-caries drugs (NaF).

According to the existing results, CA@CS NC has reliable antibacterial and anti-caries performance, which is more effective than CA alone and less toxic (strictly, the performance is better in vitro, and there is no significant difference in vivo). CA@CS NC can adsorb the bacterial cell membrane through electrostatic interaction and target bacteria. By adding CA@CS NC to oral health preparations such as mouthwash and oral freshener, CA@CS NC can be combined with bacteria in the oral cavity through People’s Daily mouth washing or brushing, which can inhibit bacteria and prevent dental caries. Compared with chlorhexidine and other oral bacteriostatic agents that have produced bacterial resistance, CA@CS NC can target bacteria and inhibit bacterial growth, acid production, biofilm formation and quorum sensing at a lower concentration. It is a new method for oral antibacterial and caries prevention.

As with all studies, this study has certain limitations. The occurrence and development of dental caries is a very complex problem, which is affected by multiple factors. At the same time, antibiotics must inevitably face the assessment of their effects on normal flora. At present, the establishment models for the study of microecology and drug evaluation are mainly divided into in vivo models and in vitro models. In vitro models often involve complex biofilms derived from a single bacterium, multiple species or even human saliva [68–70]. They have the advantage of having better control over experimental variables and producing more reproducible data, but do not well mimic the real situation in vivo [71]. According to previous studies, high-throughput sequencing of the 16 S rDNA gene may be more consistent with the real situation in vitro model [68]. On the other hand, Keyes’ model is the main in vivo animal model used in studies, and the influence of saliva, chewing and eating is added. However, current in vivo models mainly rely on rodents, whose feeding patterns, saliva secretion and oral microecological structure are quite different from those of humans [72]. Nowadays, the human in situ model is considered as a method between in vitro and in vivo models, which can evaluate the real situation well and has great clinical value [73]. Nevertheless, human body model is complex and costly, and patient compliance has become a key factor for success [74]. According to the model above, choosing an appropriate model to analyze the effect of anticaries agents on the microbiota through genetic study is necessary in the future research.

In addition, the targeting effect of CA@CS NC is a relatively weak electrostatic force, which may also combine with other negatively potential enzymes and other substances in the oral cavity. And this targeting method of bacteria as a long-term treatment for dental caries depends on repeated multiple administrations. And people’s chewing, swallowing and saliva can lead to its detachment from the teeth. While the bacteria are targeted by electrostatic forces in this study, further firm targeting of the tooth surface can further enhance its effect and reduce the dependence on repeated administration. If the chemical groups of CS are modified to prepare CS derivatives to target calcium ions and other dental targets, its dental targeting can be improved, which may be one of the future development directions [75].

Conclusion

We have developed CA@CS NC with an oil-based core and a positively potential CS shell, which are able to adsorb S. mutans through electrostatic interactions and slowly release CA, strongly inhibit bacterial growth, acid production, biofilm formation and QS, thereby showing effective and safe properties in the prevention and treatment of biofilm. This strategy of chitosan-based nanocapsules for drug loading opens new avenues to improve the short duration of drug action and its application in antibacterial and antibiofilm drug development.

Author contributions

R.M. and X.Q. conceived the project and designed most of the experiments. Experiments were carried out by R.M., H.Z., X.L., Z.Z., J.J. and X.W. In addition, R.M., X.Q., H.Z. and Y.G. assisted in data analysis and discussion. R.M. wrote manuscripts. All the authors commented on the manuscript.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/20002297.2023.2243067

Correction Statement

This article has been republished with minor changes. These changes do not impact the academic content of the article.

Additional information

Funding

This study was financially supported by the National Innovative Training Program for College Students [202110661044], the National Natural Science Foundation of China [32060227], Guizhou Provincial Natural Science Foundation [QKH-ZK[2021]Y114], Science and Technology Project of Guizhou Provincial Health Commission [gzwjkj2020-1-237], Zunyi Medical University 2018 Academic New Seedling Cultivation and Innovative Exploration Special Project [QKH[2018]5772-028], the future ‘science and technology elite’ project of Zunyi Medical University [ZYSE-2021-02], as well as the Innovative Training Program for College Students of Zunyi Medical University [ZHCX202001].