Abscisic acid modulates differential physiological and biochemical responses to cadmium stress in Brassica napus

ABSTRACT

The plant hormone abscisic acid (ABA) has been proved to be a key protector against abiotic stresses at appropriate concentrations. This study aimed to investigate the role of ABA in alleviating cadmium (Cd) stress in two Brassica napus of oil-vegetable dual-purpose (Youfei 1 and Xiangyou 787). Cd stress disturbed the normal growth of rapeseed, however, specific ABA concentrations could alleviate the effects of Cd stress in B. napus. The results confirmed that exogenous ABA mitigates the negative effects of Cd-induced plant toxicity in B. napus by increasing growth traits, enhancing pigment molecules, enhancing gas exchange in leaves, as well as regulating antioxidation and the expression levels of genes related to Cd stress. This study indicated that ABA played an important protective role in regulating cadmium resistance in Brassica napus, and provided basic data for its application in actual production.

KEYWORDS:

• Antioxidants
• Brassica napus
• cadmium stress
• exogenous abscisic acid
• physiological responses

1. Introduction

Heavy metal pollution has increasingly become an issue of global concern. This type of pollution primarily comes from industrial sources and the application of agricultural fertilizers with high cadmium (Cd) content. Large amounts of pollutants are readily discharged into the environment, which greatly endangers the stability of the ecological environment and human health [1,2]. Cd is of great concern to the World Health Organization as a food pollution source and is also listed as one of the top carcinogens in humans, animals, and plants [3]. Although research on remediation of heavy metal contaminated soil is increasing, typical soil remediation methods are not effective in remediation of polluted areas, and additional exploration is still needed, leafy vegetables grown in Cd-contaminated soils accumulate higher concentrations of Cd [4,5]. Cadmium affects the growth and development of crops, with excessive levels leading to plant dwarfism, a significant decline in biomass, and other deficiencies [6,7]. Previous research has shown that a high concentration of cadmium significantly reduces the plant height, root length, and biomass of tobacco [8], the germination rate and root elongation rate of barley seeds [9], and root branches and leaf photosynthesis of winter wheat [10]. The heavy metal cadmium ion can damage the structure of plant chloroplasts and affect photosynthesis. With the increase of cadmium concentration, the activity of pigment biosynthesis enzyme in Chlorella vulgaris is inhibited and the content of chlorophyll and carotenoid, therefore, is reduced [11]. Cadmium inhibits the growth of tobacco at different stages following transplantation, with the growth index decreasing by more than 10% due to the increase of cadmium concentration in the soil, the photosynthetic pigment and photosynthetic characteristics of tobacco leaves significantly decrease while antioxidant enzyme activity increases [12]. In addition, the use of cadmium frequently reduces chlorophyll a and b concentrations in strawberry varieties [13]. The interactive effect of potassium and cadmium affects photosystem II and reduces the electron transfer rate in tomato plants [14]. Therefore, it is important for crop improvement and human health to develop methods to reduce cadmium content in edible plant tissues and stress-tolerant plants to cadmium stress.

Phytohormones are synthesized by specific tissues or cells in plants and have significant effects on physiological processes [15]. Exogenous hormone application is one of the most common ways in which to regulate the abiotic stress tolerance of plants [16]. Among various plant hormones, abscisic acid (ABA) is a vital plant growth inhibitor that plays an active role in resistance to plant stress [17,18]. It is a trace hormone in plants where a concentration of 5 µmol/L of ABA can effectively remove active oxygen of purple flowering stalk and alleviate Cd toxicity by promoting antioxidant enzyme activity and accumulating more Cd in roots to improve the osmotic adjustment ability [19], As a critical regulating factor, ABA directly induces stomatal closure and decreases the transpiration rate. Exogenous ABA (1 μM) can significantly decrease the transpiration rate of two Sedum alfredii ecotypes under Cd stress and the decreased stomatal length and density are closely coupled with ABA levels [20]. Exogenous ABA can also reduce the accumulation of sodium ions (Na⁺) in plant cells [21]. The antioxidant enzyme system of plants will change with the changes in the external environment. A previous study demonstrated that spraying ABA (5, 10, or 15 μM) on mung bean leaves could mitigate the toxic effects of Cd by restoring the antioxidative enzyme activity and levels [22]. The increase in ABA content can reduce the accumulation of malondialdehyde in sweet potato plants, improving the photosynthetic ability and the activity of superoxide dismutase (SOD), to enhance the viability [23]. In addition, lower ABA concentrations (0.5, 1, and 10 μM) can enhance catalase (CAT), SOD, and peroxidase (POD) activity in Platycladus orientalis under high salt stress, reduce the content of malondialdehyde and hydrogen peroxide in plant cells [24].

Two varieties of Brassica napus cultivals (Youfei 1 and Xiangyou 787) are important dual-use crops for oil and vegetable in China. With the rapid industrial developments, cadmium pollution is becoming increasingly serious in the soil due to the discharge of factory wastewater and the use of pesticides and fertilizers [25]. The development of high quality and yield cultivation of B. napus under heavy metal stress is of high importance. The previous research showed that the growth of B. napus under Cd stress had a certain inhibition, which could be alleviated by the application of exogenous ABA [26]. The current study explored the underlying mechanisms of exogenous ABA regulation in the growth and development of B. napus under cadmium stress and aimed to explain how exogenous ABA regulates photosynthesis, antioxidant systems, cadmium uptake, and cadmium-related genes in these two varieties. This research can aid in revealing the putative physiological mechanisms of exogenous ABA regulating plant growth and development under cadmium stress and to further understand the synergistic regulation of environmental and hormone signals relative to plant traits.

2. Material and methods

2.1. Plant collection and growth conditions

Seeds of two B. napus cultivars (Youfei 1 and Xiangyou 787) used in this experiment were collected from the Key Laboratory of Economic Crops Genetic Improvement and Integrated Utilization, Xiangtan, China.

The chemicals (ABA and CdCl₂ 5/2H₂O) used in this study were both analytical grade and their purity was 95% and 98%, respectively. B. napus seeds of each variety were sterilized in 95% ethanol and placed in a constant temperature incubator. The seeds were then germinated on moistened filter paper in trays for 5 days under 23 ± 1°C, 70% relative humidity and a 14 h light/10 h dark cycle (light intensity of 900 lx). The germinated seedlings were placed in hydroponic experimental tanks (30.7 × 21.2 × 8.7 cm in size) and cultured in a controlled culture chamber. Hoagland nutrient solution was replaced every 3 days to keep adequate nutrition. The nutrient solutions contained the following ingredients (each presented in µmol/L): K₂SO₄ 3488.51, NH₄H₂PO₄ 1000, MgSO₄ 4108.33, FeNa-EDTA 44.32, FeSO₄ 18.82, Na₂B₄O₇ · 10H₂O 11.80, MnSO₄ 14.11, CuSO₄ 0.31, ZnSO₄ 1.37, (NH₄)₂SO₄ 0.15, and Ca(NO₃)₂·4H₂O 4004.24.

2.2 Cd and ABA treatments

When the plants reached the five-leaf stage, they were divided into six groups. Group one used the control and maintained only with the Hoagland solution. The remaining five groups were treated for 1 week adaptation period with Hoagland solution with 10 µmol/L Cd. After 1 week, the five groups were supplemented with 0, 0.5, 1, 5, or 10 µmol/L ABA, these groups are abbreviated as CK, Cd, Cd+A1, Cd+A2, Cd+A3 and Cd+A4. This experimental treatment lasted for 2 weeks, after which the physiological indices were measured. Each treatment was repeated in triplicate and each replicate consisted of 20 plants.

2.3 Cd content

After 2 weeks of exposure, three replicate samples were collected after three rinses with deionized water, dried, and then the levels of Cd content in roots and shoots of the two B. napus varieties were measured by IPC-MS (X Series II, Thermo Scientific, USA) [27].

2.4 Measurements of growth characteristics

Two weeks after the establishment of six treatment groups, the freshly harvested plants were washed with tap water and dried after the plant height and root length were measured using digital calipers. The fresh shoot and root biomass of each plant were measured with an electronic digital balance immediately after harvest.

2.5 Measurement of photosynthetic parameters

A portable photosynthetic apparatus (LI-6400XT, Li-COR Inc., USA) was used to determine the photosynthetic parameters of each fifth fully expanded leaf between 9 and 11 am. The measurements included the plant net photosynthesis rate (Pn, μmol CO₂ m⁻² s⁻¹), intercellular CO₂ concentration (Ci, μmol CO₂ mol⁻¹), conductance to H₂O (Cond, mol H₂O m⁻² s⁻¹), and transpiration rate (Tr, mmol H₂O m⁻² s⁻¹), which are photosynthetic physiological indicators. Repeated measurements for 3 days at an irradiance of 1,000 μmol/(m²·S), 450 μmol/mol CO₂ in the air, 500 μmol/s of flow, and leaf temperature of 25°C.

2.6 Chlorophyll and carotenoid content

About 0.2 g of fresh leaf tissue from the same part was taken for measurement of chlorophyll and carotenoid content according to Wu et al. [28]. The leaves were cut into long strips with scissors and placed into a 50 ml tube. The photosynthetic pigment was extracted from leaf tissue with 95% ethanol for 24 h in a dark room until the leaf color completely disappeared. The extract volume was adjusted to 25 ml. Chlorophyll a, chlorophyll b, and carotenoid content were measured using a UV752N spectrophotometer at the wavelengths 665, 649, and 470 nm, respectively. The content of photosynthetic pigments was calculated according to the formula presented by Wu et al. [28].

2.7 Malondialdehyde (MDA), glutathione (GSH) content, and enzyme activities

A total of 0.1 g of fresh leaves and roots in each treatment was ground into a homogenate by adding 900 µl extraction phosphate buffer solution (PBS), and then centrifuged at 4°C and 12,000 r/min for 15 minutes. The collected supernatant was diluted to 10% of the tissue homogenate and stored at 4°C for the next measurements. Soluble protein concentration was determined by Coomassie brilliant blue staining [29]. Malondialdehyde (MDA, nmol/mgprot) was measured according to the thiobarbituric acid (TBA) method and glutathione concentration (GSH, mg GSH/gprot) were analyzed according to the macromethod. Total superoxide dismutase (T-SOD), POD, total antioxidant capacity (T-AOC), and catalase CAT activity were assayed according to the hydroxylamine, colorimetric, and molybdate methods. All the above measurements were made by the determination kits purchased from Nanjing Jiancheng Bioengineering Institute NJBI (Nanjing).

2.8 Gene expression analysis

Total RNA was isolated from leaves using a plant RNA extraction kit (Tiangen, Beijing, China) for quantitative real-time polymerase-chain reaction (qRT-PCR). The isolated RNA was converted to cDNA using an RT6 reagent kit (Qingke, Beijing, China) and then diluted five times. The expression levels of six genes related to cadmium content were determined using Hieff® qPCR SYBR Green Master Mix (Yeasen, Shanghai, China) and specific primers. The sequences of primer pairs designed for qRT-PCR are presented in Table 1. β-Actin was used as an internal standard gene and the relative expression levels were calculated according to the methods presented in Livak and Schmittgen [30].

Table 1. Primer sequences used for qRT-PCR.

Gene	Reference Sequence	Primer sequences (5′ to 3′)	Product size (bp)
BnaPCS1	XM_013850984.3	F: GGTCCTGGCGAGGCAGAAGG R: AGCAGCTGAAGTTGGCGTCG	299
BnaGSH1	XM_013882194.1	F: CGCACAGGAATGCTACCGTTTGT R: AGCTGGAAGGGCGCAGAGTC	300
BnaCCS	XM_013822408.2	F: CCCGTTTCCGATCGTAATCTCCGT R: GCCACTGCAGCCGAGACCAA	287
BnaCAT3	XM_013882469.2	F: ACGGTGGTGCTCCAGTCTCG R: ACGCTCGTGAACGACGGTGG	272
β-Actin	NM_001316010.1	F: TCCATCCATCGTCCACAG R: GCATCATCACAAGCATCCTT	249

F: forward primer; R: reverse primer.

2.9 Statistical analysis

The results are presented as mean values ± standard deviation (SD) and calculations were performed in Excel 2010 (Microsoft, Redmond, Washington, USA). Statistical analyses were conducted using one-way ANOVA and Duncan’s test with SPSS Statistics 26 (SPSS Inc., Chicago, USA). At P = 0.05, the means were calculated using the least significant difference (LSD) test and the differences between the values (means ± SD) were considered statistically when P < 0.05. Furthermore, the graphical representations were carried out using Origin 2021 software (Origin Lab, USA).

3. Results

3.1 Effects of ABA on the growth of two B. napus varieties under cadmium stress

The changes in biomass accumulation and growth indices of two B. napus cultivars under Cd stress with the application of different concentrations of ABA (0.5, 1, 5, and 10 µmol/L) were determined (Figure 1). The results showed that Cd treatment significantly inhibited the growth and biomass of plants compared with the control. In Youfei 1, plant height and root length decreased by 27.29% and 26.93% (P < 0.05), while shoot weight and root weight decreased by 35.35% and 38.10% (P < 0.05), respectively. In Xiangyou 787, plant height, root length, shoot weight, and root weight was reduced by 18.64%, 36.49%, 17.08%, and 27.78% (P < 0.05), respectively. The application of ABA significantly improved growth characteristics in both cultivars. The addition of 5 µmol/L ABA improved Youfei 1 biomass through increased plant height and root length by 20.48% (P < 0.05) and 11.46% (P > 0.05), respectively, when compared with the treatment of Cd alone. This treatment was more effective than the 0.5 or 10 µmol/L ABA application. At the 0.5 µmol/L ABA concentration, plant height increased by 16.22% (P < 0.05), but the change in root length was not significant (P > 0.05). When the ABA was supplied at 10 µmol/L, the root length was further decreased by 36.52% (P < 0.05) compared with the Cd treatment without adding ABA. In Xiangyou 787, except that the change of root length was not significant (P > 0.05) after adding ABA, the other three indices increased at various degrees.

Figure 1. Effects of ABA on biomass accumulation in B. napus under Cd stress. (A) The plant phenotype under various treatments, above is the variety of Youfei 1 and below is the variety of Xiangyou 787, (B)Plant height, (C)Root length, (D)Shoot fresh weight and (E) Root fresh weight in two varieties. Values represent the means of three replicates (n = 3) ±SD in the experiment and different letters indicate a significant difference between treatments at P < 0.05. CK: control, nutrient solution alone; Cd: 10 μmol/L Cd was added into the nutrient solution; A1: 0.5 μmol/L ABA; A2: 1 μmol/L ABA; A3: 5 μmol/L ABA; A4: 10 μmol/L ABA.

3.2 Effect of ABA on leaf photosynthetic parameters of B. napus cultivars under Cd stress

The results of leaf photosynthetic-related elements that include net photosynthetic rate (Pn), conductance to H₂O (Cond), intercellular CO₂ (Ci), transpiration (Tr), and photosynthetic pigments such as chlorophyll a, chlorophyll b, and carotenoids are presented in Figures 2 and 3. The results demonstrated that Cd treatment noticeably decreased the content of the three pigments in both B. napus varieties (Figure 2A, B and C). Notably, 0.5 µmol/L ABA supplementation combined with Cd improved the chlorophyll content by 21.22% and 26.43% (P < 0.05), chlorophyll b by 8.76% and 10.12% (P > 0.05), and carotenoids by 20.13% and 28.80% (P < 0.05) in the Youfei 1 and Xiangyou 787 seedlings, respectively, compared to the Cd treatment alone. However, with the increase of ABA concentration to 10 µmol/L, the content of each pigment decreased compared with the Cd-only treatment group.

Figure 2. Effects of Cd alone or in combination with ABA, in two B. napus cultivars on pigment content. (A) The content of chlorophyll a in two varieties, (B) The content of chlorophyll b in two varieties, and (C) The content of carotenoid in two varieties. Values represent the means of three replicates (n = 3) ±SD in the experiment and different letters indicate a significant difference between treatments at P < 0.05. CK: control, nutrient solution alone; Cd: 10 μmol/L Cd was added into the nutrient solution; A1: 0.5 μmol/L ABA; A2: 1 μmol/L ABA; A3: 5 μmol/L ABA; A4: 10 μmol/L ABA.

Figure 3. Effects of ABA application on photosynthetic parameters under Cd stress. (A) Photosynthetic rate, (B) Conductance to H₂O, (C) Intercellular CO₂ concentration and (D) Transpiration rate in two varieties. Values represent the means of three replicates (n = 3) ±SD in the experiment and different letters indicate a significant difference between treatments at P < 0.05. CK: control, nutrient solution alone; Cd: 10 μmol/L Cd was added into the nutrient solution; A1: 0.5 μmol/L ABA; A2: 1 μmol/L ABA; A3: 5 μmol/L ABA; A4: 10 μmol/L ABA.

The leaf gas exchange responses in the two Brassica cultivars exposed to Cd and ABA are presented in Figure 3. Compared with the control treatment, the results demonstrated that Cd-induced heavy metal stress in Youfei 1 caused a severe decline in net photosynthetic rate, Pn (34.31%), conductance to H₂O, Cond (14.19%) (P < 0.05). The effect on transpiration rate (Tr) was not significant (P > 0.05) while the intercellular CO₂ concentration (Ci) increased by 5.59% (P < 0.05). In addition, ABA application also reduced the parameters of gas exchange attributes except for photosynthetic rate. Its effect was more significant with the increase in ABA concentration. In Xiangyou 787, the values of the Cd stress group decreased Pn by 37.27%, Cond by 43.57%, and Tr by 35.54% (P < 0.05) compared with the control. Compared with the single cadmium treatment group, photosynthesis under Cd stress was significantly enhanced after ABA application, however, still lower than the control group. Cond, Ci, and Tr were inversely proportional to ABA concentration. Furthermore, a significant decline was identified under Cd stress combined with 10 µmol/L ABA in Cond by 38.59%, Ci by 28.72%, and Tr by 51.28% (P < 0.05), compared with the Cd-only treatment.

3.3 Effects of ABA treatment on Cd absorption in B. napus cultivars

Following the supplementation of ABA, the treatments decreased the Cd content in the root and shoot tissues of B. napus cultivars compared with the 10 µmol/L Cd alone and the effects of different ABA concentrations on the Cd content of roots and shoots were varying (Figure 4). In Youfei 1, the content of Cd in both roots and shoots was reduced by ABA treatment. Compared with the treatment of Cd without ABA, the Cd content decreased by 20.45%, 24.06%, 23.12%, and 35.42% (P < 0.05) after adding 0.5, 1, 5 and 10 µmol/L ABA in the roots, respectively. Meanwhile, the Cd content of shoots significantly decreased by 33.42%, 48.21%, 52.96%, and 48.47% (P < 0.05), respectively, compared with the treatment of Cd alone. Additional ABA (5 and 10 µmol/L) was added to the treatment groups with the lowest Cd content in the roots and leaves, respectively. However, in Xiangyou 787, the content of Cd in the root increased by 19.57% (P < 0.05) after the addition of 0.5 µmol/L ABA while at other ABA concentration (1, 5, and 10 µmol/L) treatments, the Cd content significantly decreased. Following the addition of 10 µmol/L ABA, the Cd content in roots and shoots decreased by 49.00% and 17.33% (P < 0.05), respectively. Under the same conditions, a small amount of ABA (0.5 µmol/L) promoted Cd uptake in the roots of Xiangyou 787.

Figure 4. Effects of ABA on the Cd content of two B. napus cultivars under Cd stress conditions. (A) Cd contents in Youfei 1 shoots and roots, (B) Cd contents in Xiangyou 787 shoots and roots. Values represent the means of three replicates (n = 3) ±SD in the experiment and different letters indicate a significant difference between treatments at P < 0.05. CK: control, nutrient solution alone; Cd: 10 μmol/L Cd was added into the nutrient solution; A1: 0.5 μmol/L ABA; A2: 1 μmol/L ABA; A3: 5 μmol/L ABA; A4: 10 μmol/L ABA.

3.4 Effects of ABA treatment on MDA and GSH content in B. napus cultivars

The results demonstrated that Cd-treated B. napus substantially contained an increased MDA content in the roots (Figure 5A, B). These findings also showed that ABA application reduced MDA content in the roots. However, when the ABA concentration reached 10 µmol/L, MDA content in roots increased again. In detail, under Cd toxicity, the level of MDA in the roots decreased by 36.65% in Youfei 1 and 20.11% in Xiangyou 787 (P < 0.05), after the addition of 5 µmol/L ABA, compared to the Cd-only treatment group. In addition, compared with the control group, the MDA levels of shoots of Youfei 1 and Xiangyou 787 seedlings under Cd stress decreased by 73.63% and 33.45% (P < 0.05), respectively. The MDA content increased with the addition of trace ABA (0.5 or 1 µmol/L). However, when 10 µmol/L ABA was applied, the MDA content in the shoots of Youfei 1 was equal to that of the Cd-only treatment.

Figure 5. Effects of ABA treatment on MDA and GSH content in B. napus cultivars. (A) MDA contents in Youfei 1 shoots and roots, (B) MDA contents in Xiangyou 787 shoots and roots, (C) GSH contents in Youfei 1 shoots and roots and (D) GSH contents in Xiangyou 787 shoots and roots Values represent the means of three replicates (n = 3) ±SD in the experiment and different letters indicate a significant difference between treatments at P < 0.05. CK: control, nutrient solution alone; Cd: 10 μmol/L Cd was added into the nutrient solution; A1: 0.5 μmol/L ABA; A2: 1 μmol/L ABA; A3: 5 μmol/L ABA; A4: 10 μmol/L ABA.

Cadmium exposure had a remarkable impact on GSH content (Figure 5C, D) via increased accumulation. The roots under Cd stress maintained significantly high GSH levels (3.98-fold and 5.06-fold, compared to the control) in the two cultivars which were important to sustaining balanced redox status to reduce the oxidative stress damage induced by Cd. A similar trend was also evident in the shoots of Cd-treated plants. Following the addition of ABA, GSH content in all treatments decreased compared with the Cd-only treatment. A significant decrease in the GSH pool was also observed in Youfei 1 shoots following the ABA addition. In the shoots of Xiangyou 787, the GSH content first increased and then declined with the increase of ABA concentration. The shoots of this cultivar demonstrated the maximum increase in GSH activity (1.97-fold compared to the Cd-treated group) when the ABA concentration was 10 µmol/L.

3.5 Effects of Cd and ABA on antioxidant enzymes activities in B. napus cultivars

The activity of T-SOD, POD, CAT, and T-AOC under Cd treatment was also measured with or without the application of different concentrations of ABA in the two B. napus cultivars (Figure 6). Except for T-AOC, the activity of the other three antioxidant enzymes decreased in the root tissues when plants were under the Cd stress. The observed trend in the shoots was similar. The T-AOC content demonstrated an opposite trend under Cd stress. Under Cd toxicity, the addition of ABA increased T-SOD activity in the roots of the two varieties. An elevated ABA concentration led to the enzyme levels first increasing and then decreasing (Figure 6A). However, the change of T-SOD in shoots of both of the cultivars first decreased and then increased with the increasing ABA concentration, which was contrary to the results in roots.

Figure 6. Effects of Cd and ABA on antioxidant enzyme activity in B. napus cultivars. (A) T-SOD activity, (B) POD activity, (C) CAT activity and (D) T-AOC activity in two varieties shoots and roots. Values represent the means of three replicates (n = 3) ±SD in the experiment and different letters indicate a significant difference between treatments at P < 0.05. CK: control, nutrient solution alone; Cd: 10 μmol/L Cd was added into the nutrient solution; A1: 0.5 μmol/L ABA; A2: 1 μmol/L ABA; A3: 5 μmol/L ABA; A4: 10 μmol/L ABA.

The activity of POD in the roots of Youfei 1 under Cd stress initially increased and then decreased with increased ABA concentration. However, POD activity in the leaf increased in all treatment groups. There was no significant difference between adding 0, 0.5, or 10 µmol/L ABA (Figure 6B). However, POD activity in the roots of Xiangyou 787 slightly increased with the increased ABA concentration compared to the Cd treatment group. POD activity in the shoots first decreased and then increased under different ABA concentrations (Figure 6B).

CAT activity in the two varieties under various treatments displayed no significant differences (P > 0.05) (Figure 6C). For example, in comparison with the control, Cd stress significantly decreased CAT activity in the roots and shoots of the two cultivars. When compared with the Cd treatment, the CAT activity in the roots and leaves was further decreased with the addition of different ABA concentrations. CAT activity was the lowest when the concentration of ABA was 1 µmol/L, compared with the control group. Furthermore, it decreased by 67.08% and 52.64% (P < 0.05) in the roots and shoots of Youfei 1 and by 61.79% and 43.23% (P < 0.05) in the roots and shoots of Xiangyou 787, respectively. CAT activity then increased in the two treatments with 5 or 10 µmol/L ABA.

T-AOC refers to the total antioxidant level of various antioxidant substances and antioxidant enzymes. The T-AOC activity significantly increased in Youfei 1 and Xiangyou 787 under Cd stress by 40.40% and 40.33% (P < 0.05) in the root tissues and by 57.3% and 22.6% (P < 0.05) in the leaf tissues, respectively, compared with the CK (Figure 6D). T-AOC activity decreased at 0.5, 1, and 5 µmol/L ABA and increased at 10 µmol/L ABA. T-AOC activity was lowest under Cd treatment with 5 µmol/L ABA and there was no significant difference (P > 0.05) compared with the control group in the roots of Youfei 1. Furthermore, T-AOC activity in Youfei 1 shoots was lowest under Cd treatment with 1 µmol/L ABA and there was no significant difference (P > 0.05) compared with the control group. After the addition of ABA, T-AOC activity decreased at 0.5, 1, and 5 µmol/L ABA concentrations in the roots of Xiangyou 787. T-AOC activity also decreased at 0.5 and 1 µmol/L ABA but then increased after the addition of 5 and 10 µmol/L ABA in Xiangyou 787 shoots (Figure 6D). However, when ABA concentration reached 10 µmol/L, T-AOC activity in roots and leaves was highest, reaching 17.55 and 25.99 U /mg protein, respectively.

3.6 qRT-PCR analysis of Cd stress-related gene expression

To explore the possible mechanisms between reactive oxygen species (ROS) and Cd detoxification, the expression of some antioxidant enzymes and metal detoxification-related genes from leaves of Youfei 1 and Xiangyou787 was determined. The results revealed that under Cd treatment the transcript levels of phytochelatin synthase gene BnPCS1 and gamma-glutamylcysteine synthetase gene BnGSH1 increased by about 1.21 and 1.85-fold, respectively, compared with the control, and the expression of these two genes in the ABA-treated group was significantly lower than in the Cd-treated group in Youfei 1 (Figure 7A, B). In addition, the Brassica napus catalase-3 (BnCAT3) gene expression level was decreased in all treatment groups, compared to the control, except when treated with 10 umol/L ABA (Figure 7D). These results were almost consistent with CAT enzyme activity (Figure 6C). Furthermore, the expression level of the copper chaperone for the superoxide dismutase gene (BnCCS) in the Cd treatment was also lower than in the control (0.61-fold). The transcription level of BnCCS in Youfei 1 treated with 0.5, 1, or 5 µmol/L ABA increased significantly with the increase in ABA concentration. When ABA concentration reached 5 µmol/L, the transcript levels of BnCCS increased by approximately 3.96-fold compared with Cd-only stress treatment (Figure 7C). BnPCS1 and BnGSH1 expression levels were also significantly increased under Cd stress in Xiangyou 787. The addition of 0.5, 5, or 10 µmol/L ABA decreased the expression of these two genes compared with the Cd-only stress treatment. However, when the ABA concentration was 1 µmol/L, the expression level of these two genes in Xiangyou 787 was 1.95 and 1.33-fold higher than that in the Cd-stressed group, respectively (Figure 7A, B). Moreover, there was no significant difference in BnCCS expression between the Cd-treated or the control group. When the concentration of ABA was 1 µmol/L, BnCCS expression significantly increased to approximately 2.14 times higher than that of the Cd-treated group (Figure 7C). Similar to Youfei 1, BnCAT3 expression decreased under Cd stress, but 0.5 and 1 µmol/L ABA significantly decreased the transcription level of BnCAT3. When ABA concentration reached 10 µmol/L, the expression level of this gene was 2.55-fold higher than that of the Cd stress group (Figure 7D).

Figure 7. qRT-PCR analysis of relative expression of A (BnaPCS1), B (BnaGSH1), C (BnaCCS), and D (BnaCAT3) genes in the leaves of two B. napus cultivars under Cd stress and their modulation by ABA supplementation. Values represent the means of three replicates (n = 3) ±SD in the experiment and different letters indicate a significant difference between treatments at P < 0.05. CK: control, nutrient solution alone; Cd: 10 μmol/L Cd was added into the nutrient solution; A1: 0.5 μmol/L ABA; A2: 1 μmol/L ABA; A3: 5 μmol/L ABA; A4: 10 μmol/L ABA.

4. Discussion

Cadmium pollution reduces the growth, yield, and quality of crops and vegetables. Crops contaminated with cadmium constitute major global food safety and public health concerns [25]. The results of this study demonstrated that under Cd stress, the plant height, root length, shoot fresh weight, and root fresh weight all decreased compared with the control group of two B. napus cultivars (Figure 1). ABA regulates numerous physiological processes and participates in the tolerance of plants to Cd stress [31]. Previous studies have shown that exogenous ABA can alleviate the inhibition of plant growth of Arabidopsis thaliana [32], mung bean [33], Populus euphratica [34], and wheat [35]. For example, the biomass and plant height of Bidens pilosa decreased following the application of 10 µmol/L exogenous ABA compared with their respective controls, while the foliar applications of 10 or 20 μM ABA significantly promoted the root number and fresh weight in mung bean seedling explants [33,36]. The results of the current study showed that ABA treatment of 0.5–5 µmol/L alleviated the toxic effects of Cd in two B. napus varieties. Nonetheless, when the concentration of ABA was increased to 10 µmol/L, the difference in plant height and shoot fresh weight of the Youfei 1 variety was not significantly different compared to the Cd treatment group. The reduction of root length and weight however was intensified, this result was not observed in the Xiangyou 787 variety possibly because the optimum concentration of ABA varies within the B. napus varieties.

Photosynthesis is one of the most important metabolic processes in plants and Cd ions can cause disturbances of photosynthesis at different structural or functional levels [37]. In this study, Cd exposure disrupted plant pigment synthesis and resulted in leaf chlorosis (Figure 1A). Furthermore, the photosynthetic and gas exchange elements (chlorophyll a, chlorophyll b, carotenoids, Pn, and Tr) were significantly reduced in Cd-treated B. napus plants of both varieties (Youfei 1 and Xiangyou 787) compared with the control. Nevertheless, ABA supplementation improved these indices under Cd toxicity (Figures 2 and 3). The content of three pigments decreased in the two cultivars exposed to 10 µmol/L Cd stress, while the pigment content of B. napus with a combined 0.5, 1, or 5 µmol/L ABA along with Cd increased to varying degrees compared with those treated only with Cd. Recent studies have found that Cd inhibits the synthesis of photosynthetic pigments and photosynthetic-related proteins ultimately affecting CO₂ fixation in lettuce [38], which is consistent with our results. However, the pigment content in the group with 10 µmol/L ABA and Cd-treated plants was lower than that of the Cd-only treatment, which may be due to the damage to chloroplast structure caused by the high ABA concentration. Previous research has shown that Cd-stress and ABA treatment results in increased Pn and decreased Cond, Ci, and Tr in lettuce [38]. Similar results were obtained in Xiangyou 787, which demonstrated that ABA could alleviate the inhibition of photosynthesis induced by Cd stress. The photosynthetic rate of Youfei 1 generally decreased, except for the group treated with 0.5 µmol/L ABA and 10 µmol/L Cd, which may be the result of stomatal closure [39].

The degree of Cd stress was in direct proportion to its accumulation. The reduction of the transport and accumulation of Cd in plants is vital for crop growth and human safety [40]. Our results showed that the addition of ABA reduced Cd content in the shoots and roots of Youfei 1 (Figure 4), but the specific pathway by which ABA reduced Cd uptake in Brassica species requires further investigation. Similar findings also have been found in Arabidopsis and rice where exogenous ABA alleviates their organ damage from Cd toxicity by reducing Cd uptake, translocation and accumulation, and promoting Cd complexation and efflux. The possible mechanisms by which ABA reduces Cd uptake and transport in plants are that exogenous ABA reduces the fixation of Cd at the root cell wall by reducing hemicellulose content and concomitantly it decreases the transcription level of genes related to Cd uptake and transport (such as IRT1, HMA2, HMA4, ZIP1, and other genes), increases the level of genes related to Cd sequestration, efflux and accumulation inhibition (such as AIT1 and PDR8), and Cd transport could be reduced by decreasing the transpiration rate [41–43]. Therefore, exogenous ABA can reduce crop Cd accumulation and is an effective agronomic approach to restore crop growth.

Cd stress causes damage to plant cell membranes and accumulation of MDA [38]. Cd stress increased MDA content in the roots of two B. napus varieties (Figure 5A, B), indicating Cd stress-induced membrane lipid peroxidation. The addition of ABA (0.5, 1, or 5 µmol/L) reduced MDA content in the roots, thus reducing the damage of membrane lipid peroxidation to plant cells of two cultivars. However, the 10 µmol/L ABA also caused lipid peroxidation, demonstrating that ABA plays an important role in protecting the two B. napus cultivar cell membranes from ROS damage under Cd stress. As an antioxidant in plants, GSH plays a protective role in peroxidant damage [44]. In the present study, Cd treatment increased GSH content (Figure 5C, D), with similar results demonstrated in a previous study that demonstrated that Cd stress increased GSH content in mung bean seedlings [45]. The results showed that 0.5 and 1 µmol/L ABA reduced oxidative damage in the roots and shoots of the two B. napus cultivars under 10 µmol/L Cd stress. This may be because ABA resists oxidative damage caused by Cd stress at specific concentrations by increasing GSH content in roots and shoots of Brassica varieties [46]. One of the modes in which ABA acts as a buffer is related to oxidative stress causing stomatal closure in the guard cells [18]. T-SOD, POD, and CAT content in the two Brassica cultivars decreased under Cd stress, suggesting that Cd-induced the high accumulation of ROS. T-SOD and POD activity in shoots and roots of different cultivars increased after adding different concentrations of ABA. Therefore, ABA may indirectly eliminate ROS accumulation by increasing SOD and POD activity in Cd-stressed B. napus, which may be partly responsible for abating the oxidative damage induced by Cd stress. In barley seedlings, total SOD activity is reduced under Cd stress due to the decrease of manganese superoxide dismutase (Mn-SOD, SOD2) activity [47]. ABA is no response to increasing CAT activity and CAT enzyme-related gene expression was probably inhibited in this study. The increase of T-AOC activity under Cd stress causes oxidative damage to seedlings by ROS, which improves the antioxidant capacity to use bioactive substances in Medicago sativa [48]. The supplement of moderate amounts of ABA in Hoagland solution could reduce this damage, but when ABA concentration was increased to 10 µmol/L, the increase of T-AOC activity indicated that the oxidative damage of cellular components was intensified.

The glutathione-dependent phytochelatins (PCs) play a vital role in Cd accumulation and detoxification through PC-conjugated vacuolar sequestration [49,50]. GSH1 and PCS1 are involved in GSH and PCs synthesis and co-overexpression of GSH1 and PCS1 increases tolerance and accumulation of Cd in Arabidopsis thaliana [51]. In our study, the transcription levels of both GSH1 and PCS1 genes were upregulated under Cd stress, whereas their expression levels decreased following the addition of different concentrations of ABA except for 1 µmol/L ABA in Xiangyou 787 (Figure 7A, B). The possible explanation of these results may be partly due to the addition of ABA that induces chelation of Cd in B. napus roots resulting in a decrease in the synthesis and distribution of plant-chelating protein PC in leaves. GSH1 is primarily expressed in pea roots and the reduction of Cd toxicity may be related to Cd sequestration and Cd translocation in the root [52]. A previous study demonstrated that WRKY12 directly targets GSH1 and indirectly represses PC synthesis-related gene expression to negatively regulate Cd accumulation and tolerance in Arabidopsis [49]. The two SOD enzymes that are regulated by the supply of copper are iron superoxide dismutase (FeSOD) and copper/zinc superoxide dismutase (Cu/ZnSOD, SOD1) in plant chloroplasts [53]. SOD1 is a key antioxidant enzyme that scavenges ROS from cells by catalyzing the redox cycle of copper ions provided by a copper chaperone for Cu/Zn superoxide dismutase (CCS) [54]. CCS is the only candidate gene for SOD copper chaperone in the A. thaliana genome, which is closely related to the regulation of SOD activity [55]. Cat1, Cat2, and Cat3 genes located in the peroxisome, which converts hydrogen peroxide into the water to reduce oxidative damage in plant cells, are all catalase (CAT) genes that simultaneously or synergistically contribute to the detoxification of hydrogen peroxide in peroxisomes [56]. The expression of CCS and CAT3 related to oxidative response in Youfei 1 leaves significantly decreased under Cd stress. However, the addition of ABA increased CCS transcription, while CAT3 expression was the opposite, showing that ABA could promote the expression level of CCS and then regulate the SOD level in Youfei 1. When the ABA concentration was 1 µmol/L, BnaPCS1, BnaGSH1, and BnaCCS expression significantly increased, suggesting that this concentration had a unique effect on Cd stress in Xiangyou 787. However, CAT3 expression was suppressed by ABA in Youfei 1, which was contrary to the previous results in Arabidopsis [57]. But when the concentration was increased to 10 µmol/L, BnaCAT3 expression was significantly induced in Xiangyou 787. In A. thaliana, treatment with 100 µmol/L ABA for 2 hours induced CAT3 expression, but at the sixth hour, the expression was found to be reduced [58]. CAT3 may not actively participate in Cd tolerance under normal conditions but CAT2 promotes catalase activity and plays an essential role under stress [59]. Considering these results, the downregulation of CAT3 may be due to the variations in the regulation of CAT1, CAT2, and CAT3 under different abiotic stresses and developmental stages.

To better understand the mechanism of exogenous ABA in mitigating Cd toxicity in Brassica napus, we developed a model to explain it (Figure 8). Under Cd stress, ABA regulates cadmium-induced oxidative stress, Up-regulation of GSH1 and PCS1 promoted the chelation and degradation of Cd, and the transpiration rate decreased, resulting in the inhibition of Cd uptake and accumulation in root and Cd transport to shoot, the concentration of Cd in the whole seedling was reduced, which eventually reduced the Cd concentration in the whole seedlings and the toxic effects of Cd on Brassica napus was relieved, thus the biomass was increased.

Figure 8. Schematic model for ABA-mediated Cd detoxification in Brassica napus.

5. Conclusion

In conclusion, this study focused on the physiological responses of two B. napus varieties to Cd stress and the beneficial effects of ABA application in alleviating Cd toxicity. The results showed that ABA established redox homeostasis through antioxidant system in Brassica napus and stimulated tolerance signal pathway to mediate remission mechanism. This study may help to elucidate the physiological responses of ABA in relieving heavy metal Cd stress in B. napus and provide new methodologies and insights for phytoremediation of heavy metal contaminated soil. The molecular mechanism of plant adaptation to stress induced by this hormone needs further study. In the future, a wider range of species will need to be studied to understand the prevalence of this pattern.

Author Contributions

Conceptualization, L.L. and M.L.; methodology, Y.Q., M.L., and L.L.; figure and table analysis, Y.Q., S.W., and Y.T.; investigation, J.F., D.G., Y.Q., H.L., and Y.T.; writing—original draft preparation, Y.Q., C.J., and L.L; writing—review and editing, L.L., D.W., and M.Y. funding acquisition, L.L. All authors have read and agreed to the published version of the manuscript.

Disclosure statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Additional information

Funding

This study was funded by National Natural Science Foundation of China (32071965).