ABSTRACT
The genetic and non-genetic factors that contribute to the development of chronic obstructive pulmonary disease (COPD) are still poorly understood. We investigated the potential role of genetic variants of xenobiotic-metabolising enzymes (glutathione-S-transferase M1, GSTM1; glutathione-S-transferase T1, GSTT1; microsomal epoxide hydrolase, mEH), oxidative stress (assessed by urinary 8-oxo-7,8-dihydro-2'-deoxyguanosine, 8-oxodG/creatinine), sex, ageing and smoking habits on susceptibility to development of COPD and its severity in Serbian population. The investigated population consisted of 153 healthy subjects (85 males and 68 females) and 71 patients with COPD (33 males and 38 females). Detection of GSTM1*null, GSTT1*null, mEH Tyr113His and mEH His139Arg gene variants was performed by PCR/RFLP method. Urinary 8-oxodG was determined using HPLC-MS/MS, and expressed as 8-oxodG/creatinine. We revealed that increased urinary 8-oxodG/creatinine and leucocytosis are the strongest independent predictors for COPD development. Increased level of oxidative stress increased the risk for COPD in males [odds ratio (OR), 95% confidence interval (CI): 8.42, 2.26–31.28], more than in females (OR, 95% CI: 3.60, 1.37–9.45). Additionally, independent predictors for COPD were ageing in males (OR, 95% CI: 1.29, 1.12–1.48), while in females they were at least one GSTM1 or GSTT1 gene deletion in combination (OR, 95% CI: 23.67, 2.62–213.46), and increased cumulative cigarette consumption (OR, 95% CI: 1.09, 1.01–1.16). Severity of COPD was associated with the combined effect of low mEH activity phenotype, high level of oxidative stress and heavy smoking. In conclusion, early identification of GSTM1*null or GSTT1*null genotypes in females, low mEH activity phenotype in heavy smokers and monitoring of oxidative stress level can be useful diagnostic and prognostic biomarkers.
Introduction
Chronic obstructive pulmonary disease (COPD) as a multi-factorial disease is the main cause of chronic morbidity and mortality worldwide. COPD is characterized by airflow limitation that is not fully reversible. The airflow limitation is associated with systemic and local chronic inflammation and oxidative stress Citation(1).
Increased level of oxidative stress in COPD patients derives from the increased burden of inhaled oxidants, such as cigarette smoke, and from the increase in reactive oxygen species (ROS) generated by inflammatory cells (neutrophils and macrophages) in response to environmental pathogenic factors. Oxidative stress in the lungs is involved in many of the pathogenic processes Citation(2,3). Although cigarette smoking is the most important risk factor for COPD Citation(4), only 25% of the chronic heavy smokers will develop symptoms of COPD, suggesting the influence of genetic risk factors Citation(5). Because epidemiological data indicate that genetic variants of oxidative stress-related enzymes involved in the metabolism of xenobiotics underlie the individual susceptibility to COPD (Citation6–11), we aimed to investigate the association between variants of microsomal epoxide hydrolase (mEH), two glutathione-S-transferases (GSTM1 and GSTT1) and COPD in Serbian adults.
Microsomal epoxide hydrolase is involved in biotransformation of various epoxides Citation(12). The human mEH gene is located on chromosome 1q42.1. A number of variants within the mEH gene have been identified, but only two have been found to alter the enzyme activity. The T to C transition in exon 3 changes tyrosine (Tyr) residue 113 to histidine (His), and the A to G transition in exon 4 changes histidine (His) residue 139 to arginine (Arg). Consequently, mutation in exon 3 is associated with a 40% decrease in the in vitro activity of mEH (113His variant is referred to as the “slow” allele), while mutation in exon 4 leads to increased enzyme activity of about 25% (139Arg variant is referred to as “fast” allele) Citation(13). Based on the enzyme activity, the combinations of mEH genotypes have been classified as low (His113His/His139His and Tyr113His/His139His), intermediate (Tyr113Tyr/His139His, Tyr113His/His139Arg and His113His/Arg139Arg) and high (Tyr113Tyr/His139Arg and Tyr113Tyr/Arg139Arg) activity mEH phenotypes Citation(14).
Glutathione-S-transferases (GSTs) are a superfamily of enzymes, which catalyse the conjugation of reduced glutathione with various electrophilic compounds facilitating their elimination Citation(15). GSTM1 gene is located on chromosome 1p13.3, while the GSTT1 gene is located on chromosome 22q11.2. GSTM1 and GSTT1 gene deletion is responsible for the existence of GSTM1*null and GSTT1*null alleles. Homozygous deletion of the GSTM1 and GSTT1 genes is associated with complete lack of enzyme activity Citation(16).
It has been shown that oxidative DNA damage contributes to the molecular pathogenesis of COPD Citation(17). The urinary levels of oxidatively damaged DNA products (DNA lesions) are important biomarkers of systemic effects of oxidative stress. Urinary 8-oxo-7,8-dihydro-2-deoxyguanosine (8-oxodG) has been widely studied and proposed as potentially the best biomarker of oxidative stress due to non-invasive measurement and stability during long-term storage Citation(18). The urinary excretion of the DNA lesions reflects the oxidative DNA damage, the rate of nucleic acid turnover, and activity of the repair pathways and various exonucleases Citation(18).
The aim of this study was to investigate the role of oxidative stress-related genetic and non-genetic risk factors in pathogenesis of COPD in Serbian population.
Materials and methods
Subjects and samples
This study included 71 patients suffering from COPD (33 males and 38 females) recruited from the Clinic for Pulmonary Diseases, Clinical Centre of Serbia. The control population consisted of 153 healthy subjects (85 males and 68 females), with normal laboratory test results and physical examination, carried out in Health Centre, “Stari Grad,” Belgrade, Serbia and General Hospital, Pancevo, Serbia. The exclusion of airway obstruction in control group was confirmed on the basis of anamnestic data and auscultation of the lung. Diagnosis of COPD and COPD severity in patient group was established based on medical history, physical examination and pulmonary function tests (spirometry parameters: forced expiratory volume in 1 second, % of predicted value, FEV1%; forced vital capacity, % of predicted value, FVC%; and FEV1/FVC ratio). The threshold of the ratio of FEV1/FVC that establishes airflow obstruction in patients was based on a lower limit of normal (LLN) or lower fifth percentile of a reference population, according to the recommendations of the National Health and Nutrition Examination Survey (NHANES III) Citation(19). In order to compute LLN we used prediction equation for Caucasians: for males 78.388–0.2066 × age, and for females 81.307–8.7528 × age Citation(19). Basic information (age, anthropometric data and smoking status) were collected from questionnaires completed by all participants. The study was approved by the local Ethics Committee and was carried out according to the principles of the Declaration of Helsinki.
Methods
Genotyping
Genomic DNA was extracted from whole blood using GeneJET™ DNA purification Kit (Thermo Scientific) or the cetyltrimethylammonium bromide (CTAB) method. Yield and quality of the isolated DNA were checked on 1% agarose gels. Detection of GSTM1*null, GSTT1*null, mEH Tyr113His and mEH His139Arg gene variants was performed by PCR/RPLF (Polymerase Chain Reaction Restriction Fragment Length Polymorphism), as previously described Citation(20). The following primers were used for amplification of the gene regions containing the analysed polymorph sites; mEH (Tyr113His) forward GATCGATAAGTTCCGTTTCACC and reverse ATCCTTAGTCTTGAAGTGAGGAT; mEH (His139Arg) forward ACATCCACTTCATCCACGT and reverse ATGCCTCTGAGAAGCCAT. Allele-specific primers, GSTM1 forward GAACTCCCTGAAAACCTAAAG and reverse GTTGGGCTCAAATATACGGTGG; GSTT1 forward TTCCTTACTGGTCCTCACATCTC and reverse TCACCGGATCATGGCCAGCA, were used to detect the presence or absence of the GSTM1 or GSTT1 genes. The presence of albumin gene was used as a positive control in the multiplex PCR for the GSTM1 and GSTT1 genes. Primers used for albumin gene amplification were GCCCTCTGCTAACAAGTCCTAC (forward) and GCCCTAAAAAGAAAATCGCCAATC (reverse). Identification of gene variant was based either on the presence or absence of PCR signal (GSTT1 and GSTM1) or the presence or absence of digestion products [mEH(Tyr113His) PCR product digested with EcoRV enzyme and mEH(His139Arg) PCR product digested with RsaI enzyme]. DNA fragments were separated by agarose gel electrophoresis and visualised with ethidium bromide staining and UV transillumination (mEH Tyr113His, mEH His139Arg, GSTM1 and GSTT1). For ambiguous results from ethidium bromide stained agarose gels, polyacrylamide gel electrophoresis with silver staining was used to confirm the result. Genotypes were independently scored by two observers.
Biochemical, haematological and oxidative stress parameters
Laboratory measurement of biochemical parameters was carried out in serum. Biochemical and haematological parameters were measured using chemistry and haematology analysers (Instrumentation Laboratory® ILab 650, Beckman Synchron CX9 Pro, and Coulter® HmX). Spot urinary creatinine was measured by the kinetic Jaffé method (Beckman Synchron CX9 Pro analyser). Determination of 8-oxodG/creatinine was carried in a mid-stream spot urine sample. All urine samples were centrifuged at 3500×g for 15 min, and clear urine was frozen at −80°C until analysis. The urinary 8-oxodG was determined using HPLC-MS/MS (Liquid chromatography-tandem mass spectrometry), carried out on a Thermo ACCELA (Thermo Scientific, Waltham, Massachusetts, USA) HPLC coupled to a triple quadrupole Mass Spectrometer Thermo TSQ Quantum Access Max (Thermo Scientific, Waltham, Massachusetts, USA) with heated electrospray ionisation (HESI) interface Citation(21). Level of urinary 8-oxodG was expressed as 8-oxodG/creatinine which allows the urinary analyte concentration to be appropriately adjusted for urinary creatinine.
Statistics
Normality of variables was assessed by the one-sample Kolmogorov–Smirnov test (K-S test). Independent simple t-test and one-way analysis of variance (one-way ANOVA) were used for comparison of continuous variables among the groups, while for categorical variables χ2-test was used. Deviations of genotypes distributions from Hardy–Weinberg equilibrium were assessed by χ2-test for each cohort or Fisher's exact test (if cases <5). Sex-related differences between frequencies of genotype combinations were evaluated using χ2-test. Binary logistic regression was performed to assess the impact of genetic/non-genetic factors on the likelihood of COPD development. The influence of smoking status on the level of urinary 8-oxodG in COPD patients and control, as well as the impact of one or more factors on pulmonary function, was tested using two-way between-groups ANOVA (two-way ANOVA), independent-samples t-test, and post hoc comparisons (least significant difference, LSD). Statistical analysis was performed using SPSS 17.0 software. In this study, a p value ≤ 0.05 was considered statistically significant.
Results
The main characteristics and clinical parameters of patients with COPD and control subjects are shown in . Patient population was older, with a higher frequency of former smokers, and higher cumulative cigarette consumption (expressed as pack-years) in comparison to the control group. Levels of oxidative stress (assessed by the level of urinary 8-oxodG/creatinine) and leucocytes were significantly higher in COPD population compared to the control group. In COPD patients, characteristic signs of anaemia (lower haemoglobin level with corresponding decreased erythrocytes) and lower serum creatinine levels were found than those in the control group. Influence of smoking status on the characteristics and clinical parameters in investigated groups are presented in . The impact of active and former smoking on the increased level of urinary 8-oxodG/creatinine in COPD patients in comparison to control was found in both sexes.
Table 1a. The main characteristics and biomarkers in all COPD patient groups, all control groups and in sex-related groups.
Table 1b. The main characteristics and biomarkers in sex-related COPD and control groups according to smoking status.
The influence of smoking habits and body mass index (BMI) on the excretion of urinary 8-oxodG/creatinine in the population of COPD patients and the control group was analysed using two-way ANOVA method, and results are presented in . We found statistically significant interaction between COPD status and smoking habits on the level of 8-oxodG/creatinine (p = 0.046, partial eta squared = 0.03). Influence of COPD status and BMI on the level of 8-oxodG/creatinine was very close to significance (p = 0.058, partial eta squared = 0.03). The t-test analysis revealed significantly higher level of 8-oxodG/creatinine in COPD patients than in the control group: in smokers, p < 0.001 and former smokers, p < 0.001 (). Using ANOVA method, we revealed the highest level of 8-oxodG/creatinine in the group of former smokers with COPD than in non-smokers with COPD (p = 0.048) and current smokers with COPD (p = 0.047).
Figure 1. Mean levels of urinary 8-oxodG/creatinine (nmol/mmol): a. in COPD and control groups according to smoking status; b. in COPD and control groups according to body mass index (BMI); c. in COPD group according to COPD stages. *difference between COPD and control groups (p < 0.05); #differences between former smokers with COPD group and smokers with COPD/non-smokers with COPD groups (p < 0.05); and differences between COPD with BMI < 18 group and COPD with BMI 18–25 group; §differences between very severe COPD with pack-year>30 group and severe COPD with pack-year > 30 group.
Mean level of 8-oxodG/creatinine in COPD patients was significantly higher than in the control group independently of BMI (in BMI < 18 group: p = 0.015, in BMI 18–25 group: p < 0.001; in BMI >25 group: p < 0.001) (). In the underweight group (BMI <18), the differences in the level of 8-oxodG/creatinine between COPD patients and the control group were the highest. At the same time, significantly higher levels of 8-oxoG/creatinine have been detected for underweight (BMI >25, p = 0.033) patients.
The level of urinary 8-oxodG/creatinine was associated with COPD severity (p = 0.029, partial eta squared = 0.083), and with intensity of smoking (p = 0.037, partial eta squared = 0.111) (). The highest level of 8-oxodG/creatinine was found in patients with very severe stage of COPD and a history of more than 30 pack-years of smoking, while patients with moderate stage of COPD and the same history of heavy smoking (p = 0.007) had lower levels of 8-oxoG.
Frequencies of investigated genotypes in both populations were consistent with Hardy–Weinberg equilibrium, and distribution of genotypes and gene combinations did not differ between them (). Examination of the distribution of genotypes according to smoking status revealed that the GSTM1*null genotype is associated with two times higher risk for development of COPD than the GSTM1*plus genotype in the population of smokers (p = 0.049; OR, 95% CI: 2.27, 1.00–5.19).
Table 2. Distribution of genotypes (dominant model) and gene combination of Xenobiotic-metabolising enzymes (XMEs) in all COPD patients, all control groups and in populations related to smoking status (smokers, non-smokers and former smokers).
Distributions of GSTM1/GSTT1 genotype in all COPD patient and control groups, as well as in groups according to the smoking status, are presented in . Females who carry at least one deletion in GSTM1 or GSTT1 gene in combination (GSTM1null/GSTT1null, GSTM1null/GSTT1plus, GSTM1plus/GSTT1null) were at risk for COPD development (OR 3.22, 95% CI 1.32–7.82) (), while a much higher risk was revealed in a population of female smokers (OR 7.61, 95% CI 2.11–27.44) (). Distribution of the GSTM1/GSTT1 combination with deletion in healthy female population was significantly lower (p = 0.008) than in male population (OR 0.31, 95% CI 0.13–0.75) (), as well as in a healthy population of smokers (p = 0.002; OR 0.22, 95% CI 0.08–0.60).
Figure 2. Distribution of GSTM1/GSTT1 genotype combinations (with at least one deletion and without deletion): a. in all COPD and control groups; b. in non-smokers with COPD and control groups; c. in smokers with COPD and control groups; d. in former smokers with COPD and control groups.
Tendency for sex-related differences in the distribution of GSTM1/GSTT1 combination with deletion was also observed in all the investigated COPD patients. Thus, in females, the GSTM1/GSTT1 combination with deletion was more frequent, but the results did not reach statistical significance (p = 0.09).
Binary logistic regression analysis (enter method) was performed to assess the impact of genetic/non-genetic factors on the likelihood of COPD development (). In all the investigated population, the logistic regression model as a whole explained between 57.6% (Cox and Snell R square) and 78.6% (Nagelkerke R squared) of the variance in COPD development, and correctly classified 88.9% of individuals with COPD. Sensitivity of the regression model was 95.7% in male population and 86.9% in female population. As shown in , for both sexes the significant predictors of COPD were increased level of 8-oxodG/creatinine and increased number of leucocytes. Additionally, the risk for COPD in males was associated with ageing, while in females the risk factors were higher intensity of smoking (increased pack-year) and the presence of GSTT*null and GSTM*null alleles in combination.
Table 3. Binary logistic regression model for predicting the COPD development in all investigated subjects and sex-related populations.
To examine the association between mEH activity phenotype and COPD severity risk by exposure to smoking, and oxidative stress, we stratified patients with COPD by mEH activity phenotype, smoking habits and level of oxidative stress. A two-way between-groups ANOVA (two-way ANOVA) was conducted to explore the relationship between high level of oxidative stress, heavy smoking, mEH activity phenotypes (low vs. intermediate and high) and pulmonary function in COPD patients, assessed by spirometry parameters FEV1% of predicted value and FVC% of predicted value (). High level of oxidative stress was assessed as values ≥98th percentile for the urinary 8-oxodG/creatinine in the control group, estimated cut-off was 3.5 nmol/mmol. Heavy smoking is defined as smoking history of 30 pack-years or more. The strongest decline of pulmonary function was observed in heavy smokers (pack-year >30) with low mEH activity phenotype, and with increased level of oxidative stress (8-oxodG/creatinine >3.5 nmol/mmol). Precisely, when FEV1 was a dependent variable, the interaction between oxidative stress, heavy smoking and mEH activity phenotype was significant, F (Citation2,60) = 4.13, p = 0.021 (eta squared value of 0.12 indicates a large effect size), as well as in case of FVC, F (Citation2,60) = 3.63, p = 0.032 (eta squared values of 0.11 indicate a large effect size).
Figure 3. Combined effect of high oxidative stress (urinary 8-oxodG/creatinine > 3.5 nmol/mmol), heavy smoking (pack-year > 30) and mEH activity phenotype (L-low, I-intermediate and + H-high) on the pulmonary function assessed by: a. FEV1%; b. FVC%. * difference compared to the group of COPD patients with low mEH activity phenotype, high level of oxidative stress and heavy smoking habits (>3.5 + >30).
Using post hoc comparisons, we revealed that patients—heavy smokers with low mEH activity phenotype and increased oxidative stress—had significantly lower mean score of FEV1 than non-heavy smokers and patients who had lower level of oxidative stress, as well as patients who had a combination of these two risk factors, and with the same phenotype (p < 0.05, FEV1: 29.1 ± 6.7, 50.4 ± 6.3 and 68.9 ± 6.7, respectively). Similarly, mean score of FVC in heavy smokers with low mEH activity phenotype and increased oxidative stress (57.1 ± 6.9) was significantly lower than in patients with a combination of these two risk factors, p < 0.05 (57.1 ± 6.9 and 94.7 ± 6.9, respectively). In the group of COPD patients with intermediate and high mEH activity phenotypes, we did not observe the influence of these risk factors on lung function decline.
Discussion
As a complex disease, COPD is influenced by multiple gene–gene and gene–environment interactions. Potential contribution of SNPs of the genes encoding enzymes in several xenobiotic pathways to the risk of COPD has been studied extensively. Despite the fact that the respiratory tract is able to metabolise many foreign compounds, it is susceptible to injury caused by exogenous or endogenous oxidants. It is well established that oxidative stress plays an important role in the pathogenesis of COPD Citation(17). The results of our study confirm the elevated level of oxidative stress (assessed by urinary 8-oxodG) in COPD patients (). In addition, the highest level of oxidative stress was measured in former smokers with COPD (), indicating the cumulative effect of smoking on the occurrence of DNA lesions even after smoking cessation. Moreover, we found that very severe stage of COPD and the history of more than 30 pack-years were associated with a very high level of urinary 8-oxodG (). The result indicates the significant role of oxidative stress caused by heavy smoking not only in development of COPD, but also in severity of COPD. On the other hand, the highest level of oxidative stress in underweight patients with COPD () may indicate the reduced level of physiological antioxidants due to insufficient availability of precursors for their synthesis. Our results agree with the results of the study by Igishi et al., Citation(22) who found that the 8-oxodG levels were significantly elevated in ex-smokers in the COPD group compared with ex-smokers in the control group, and negative correlation between levels of urinary 8-oxodG and parameters of lung function (FVC, FEV1). Given that oxidative damaged DNA lesions could be mutagenic if not repaired and consequently can lead to carcinogenesis Citation(23), measurement of urinary 8-oxodG could be potentially used as predictor of lung cancer development in patients with COPD.
In Serbian adults, we found that oxidative stress (increased urinary 8-oxodG/creatinine) and inflammation (leucocytosis) represent the strongest independent predictors for COPD development (). Interestingly, increased level of oxidative stress was higher risk for COPD in males (OR, 95% CI: 8.42, 2.26–31.28) than in females (OR, 95% CI: 3.60, 1.37–9.45). In addition, for the male population, ageing represents an independent predictor for COPD, while for the females it was the increased cumulative cigarette consumption. There is growing evidence that patients with COPD exhibit telomere shortening in circulating leucocytes and systemic manifestations of ageing (Citation24–26). However, it remains unclear whether telomere dysfunction is a cause or a consequence of COPD. Sex-related difference that was identified in telomere length Citation(27) could explain our result that ageing is an independent predictor for COPD in males. The findings that females possess longer telomeres than males suggests that for a given chronological age, biological ageing of males is more advanced than that of females.
The finding of the present study that heavy smoking represents an independent predictor of COPD in females is consistent with other studies, which obtained gender-related differences in smoking-related decline of lung function. Thus, meta-analysis performed on population-based cohort studies revealed a greater decline in lung function in female smokers than in male smokers Citation(28). Furthermore, it was shown that female current smokers have a greater extent of oxidative damage despite having higher serum levels of fat-soluble antioxidants Citation(29).
The role of genetic variations in the enzymes that detoxify cigarette smoke products such as mEH, GSTT1 and GSTM1 in pathogenesis of COPD was widely investigated, but with controversial results (Citation7, Citation9, Citation30-34). Although the investigated genetic variants were not associated with COPD in all investigated Serbian population, the GSTM1*null allele in smokers was associated with a significant risk for COPD development (). Considering that the COPD is a complex disease, it is not surprising that a single gene might have a small effect, while co-existence of several variants of different genes might be more important in the pathogenesis of this disorder. In Serbian adults, we found that sex, smoking habits and combinations of GSTM1/GSTT1 genotypes were associated with a different susceptibility for development of COPD. Therefore, combination of GSTM1/GSTT1 genotypes with at least one deletion (GSTM1*null or GSTT1*null) was a significant risk for COPD in female smokers (). Similarly, Faramawy found that carriers of GSTM1null genotype were at high risk for developing of COPD, especially when they carry GSTM1null and GSTT1null haplotype Citation(35). Moreover, using binary logistic regression model for predicting the COPD development, we revealed that females who carry at least one GSTM1*null or GSTT1*null allele have about 23 times higher risk of developing COPD than females without the gene deletion (). As mentioned before, increased cumulative cigarette smoking was identified as an independent predictor for COPD in females, but not in males. Our data could be explained by the proposed role of oestrogen in oxidative stress, which showed that female smokers are more susceptible to COPD Citation(36).
In the investigated population, distribution of mEH variants in Tyr113His or His139Arg loci, and mEH activity phenotypes did not differ between COPD patients and controls. Numerous studies have demonstrated no association between mEH exon 3 and exon 4 variants, as well as mEH haplotypes and risk of COPD (Citation32,Citation37,Citation38). In contrast, several genetic association studies showed the association between genetic polymorphisms of mEH and development of COPD. One of the first studies that reported a strong association between mEH variants with pulmonary disease showed that slow mEH activity was associated with the development of emphysema Citation(39). Also, studies conducted in China Citation(11) and Hungary Citation(10) showed a significant correlation between Tyr113His variant in exon 3 and development of COPD. These contradictory results might be explained by inadequate matching between cases and controls, and genetic heterogeneity of different ethnic populations.
The results of our study showed that distributions of mEH phenotypes with predicted low, intermediate and high activities in COPD patients (44%, 41% and 15%, respectively) and control group (39%, 42% and 19%, respectively) were similar with the distribution in six European countries (35%, 45% and 20% in patients with COPD and 36%, 43% and 20% in control group) Citation(37). Regarding the mEH activity phenotypes, we found a combined effect of high level of oxidative stress, heavy smoking and low mEH activity phenotype on the significant decline of lung function in COPD patients. Lung function in these patients is greatly reduced and the values indicate a very severe stage of COPD Citation(40), with estimated marginal mean of FEV1<30% of predicted. Patients with the same low mEH activity phenotype, but without increased oxidative stress or heavy smoking habits, had significantly better spirometry parameters. These values indicated mild or moderate COPD (50–80% of predicted FEV1 and 30–49% of predicted FEV1, respectively). Considering that mEH is responsible for rapid biotransformation of harmful reactive epoxides, subjects with low mEH activity phenotype are at potential risk for oxidative stress-related diseases such as COPD. Based on our results, we conclude that a subgroup of heavy smokers with low mEH activity phenotype, who have been exposed to other pro-oxidants in addition to tobacco smoke, and probably with ineffective anti-oxidative protection, can develop very severe stage of COPD. Interestingly, the lung function did not differ with respect to oxidative stress and heavy smoking in group of patients with intermediate and high mEH phenotype. Our data correspond with the results obtained in Lung Health Study (LHS), which included male and female smokers with spirometric signs of COPD Citation(41). The study showed the association of slow haplotype mEH (mEH His113/His139) with increased decline rate of lung function. Similar data were obtained by Park et al., Citation(8) who reported a significant dose-dependent correlation between smoking and severity of COPD in carriers of mEH 113His/His genotype. Taken together, our data suggest that low mEH activity phenotype does not represent a risk for the decline of lung function per se. In support of this, we revealed that subjects with the same low mEH activity phenotypes that were not exposed or partly exposed to at least one risk factor (high oxidative stress or heavy smoking) had better lung function. This gene–environment interaction could be clinically significant in prevention and management of severe COPD. Therefore, in early identification of COPD patients with low mEH activity phenotype, prompt smoking cessation and management with antioxidant therapy could prevent the development of a very severe form of COPD.
Conclusion
In conclusion, the increased smoking-related oxidative stress in Serbian adults is associated with development and severity of COPD. Also, the current findings suggest sex-related difference in susceptibility to development of COPD in Serbian population. In both sexes, high level of oxidative stress represents a risk for COPD development, but for males the risk was higher. Additionally, ageing was a risk for COPD development in males, while increased cumulative smoking history, and the presence of a GSTM1*null and GSTT1*null alleles were independent predictors for COPD in females.
To the best of our knowledge, this is the first report on the subgroup of patients with low mEH activity phenotype with high risk of very severe stage of COPD. Thus, severely reduced lung function was found in heavy smokers with low mEH activity phenotype and with high level of systemic oxidative stress.
Despite the limitation of this study, caused by small sample size, the obtained data may contribute to the elucidation of risk factors of COPD development and severity.
Acknowledgments
Authors thank Soskic Blagoje, Tomic Branko, Milovanovic Ljubica and Ilic Stefan for help in genotypisation, which was performed at the Institute of Molecular Genetics and Genetic Engineering, Belgrade, Serbia. Also, the authors thank Dobrivojevic Snezana from Clinical Chemical Laboratory, Health Centre, “Stari Grad,” Belgrade, Serbia, and Drca Sanja from Clinical Chemical Laboratory, General Hospital, Pancevo, Serbia, for help in collecting of samples and analysis of routine laboratory parameters.
Declaration of interest
The authors declare that there are no conflicts of interest.
Funding
This work was supported by grant 173008 from the Ministry of Education and Science, Republic of Serbia.
References
- Celli BR, MacNee W, Agusti A, Anzueto A, Berg B, Buist AS, et al. Standards for the diagnosis and treatment of patients with COPD: a summary of the ATS/ERS position paper. Eur Respir J 2004; 23:932–946.
- Hogg JC. Pathophysiology of airflow limitation in chronic obstructive pulmonary disease. Lancet 2004; 364:709–721.
- MacNee W. Pathogenesis of Chronic Obstructive Pulmonary Disease. Proc Am Thorac Soc 2005; 2:258–266.
- Lin JL, Thomas PS. Current Prospectives of Oxidative Stress and its Measurement in Chronic Obsructive Pulmonary Disease. COPD 2010; 7(4):291–306.
- Løkke A, Lange P, Scharling H, Fabricius P, Vestbo J. Developing COPD: a 25 year follow up study of the general population. Thorax 2006; 61(11):935–939.
- Castell JV, Donato MT, Gómez-Lechón MJ. Metabolism and bioactivation of toxicants in the lung. The in vitro cellular approach. Exp Toxicol Pathol 2005; 57(Suppl 1):189–204.
- Zidzik J, Slabá E, Joppa P, Kluchová Z, Dorková Z, Skyba P, et al. Glutathione S-transferase and Microsomal Epoxide Hydrolase Gene Polymorphisms and Risk of Chronic Obstructive Pulmonary Disease in Slovak Population. Croat Med J 2008; 49(2):182–191.
- Park JY, Chen L, Wadhwa N, Tockman MS. Polymorphisms for microsomal epoxide hydrolase and genetic susceptibility to COPD. Int J Mol Med 2005; 15(3):443–448.
- Cheng SL, Yu CJ, Chen CJ, Yang PC. Genetic polymorphismn of epoxide hydrolase and glutathione S-transferase in COPD. Eur Respir J 2004; 23(6):818–824.
- Penyige A, Poliska S, Csanky E, Scholtz B, Dezso B, Schmelczer I, et al. Analyses of association between PPAR gamma and EPHX1 polymorphisms and susceptibility to COPD in a Hungarian cohort, a case-control study. BMC Med Genet 2010; 11:152.
- Li H, Fu WP, Hong ZH. Microsomal epoxide hydrolase gene polymorphisms and risk of chronic obstructive pulmonary disease: A comprehensive meta-analysis. Oncol Lett 2013; 5(3):1022–1030.
- Omiecinski CJ, Hassett C, Hosagrahara V. Epoxide hydrolase—polymorphism and role in toxicology. Toxicol Lett 2000; 112–113:365–370.
- Hassett C, Aicher L, Sidhu JS, Omiecinski CJ. Human microsomal epoxide hydrolase: genetic polymorphism and functional expression in vitro of amino acid variants. Hum Mol Genet 1994; 3(3):421–428.
- Benhamou S, Reinikainen M, Bouchardy C, Dayer P, Hirvonen A. Association between lung cancer and microsomal epoxide hydrolase genotypes. Cancer Res 1998; 58(23):5291–5293.
- Hayes JD, Strange RC. Glutathione-S-transferase polymorphisms and their biological consequence. Pharmacology 2000; 61(3):154–166.
- Seidegard J, Vorachek WR, Pero RW, Pearson WR. Hereditary differences in the expression of the human glutathione transferase active on trans-stilbene oxide are due to a gene deletion. Proc Natl Acad Sci USA 1988; 85(19):7293–7297.
- Neofytou E, Tzortzaki EG, Chatziantoniou A, Siafakas NM. DNA Damage Due to Oxidative Stress in Chronic Obstructive Pulmonary Disease (COPD). Int J Mol Sci 2012; 13(12):16853–16864.
- European Standards Committee on Urinary (DNA) Lesion Analysis, Evans MD, Olinski R, Loft S, Cooke MS. Toward consensus in the analysis of urinary 8-oxo-7,8-dihydro-2'-deoxyguanosine as a noninvasive biomarker of oxidative stress. FASEB J 2010; 24(4):1249–1260.
- Hankinson JL, Odencrantz JR, Fedan KB. Spirometric reference values from a sample of the general U.S. population. Am J Respir Crit Care Med 1999; 159(1):179–187.
- Stankovic M, Nikolic A, Tomovic A, Mitic-Milikic M, Nagorni-Obradovic Lj, Petrović-Stanojevic N, et al. Association of functional variants of phase I and II genes with chronic obstructive pulmonary disease in a Serbian population. J Med Biochem 2015; 34(2):207–214.
- Topic A, Francuski D, Markovic B, Stankovic M, Dobrivojevic S, Drca S, et al. Gender-related reference intervals of urinary 8-oxo-7,8-dihydro-2'-deoxyguanosine determined by liquid chromatography-tandem mass spectrometry in Serbian population. Clin Biochem 2013; 46(4–5):321–326.
- Igishi T, Hitsuda Y, Kato K, Sako T, Burioka N, Yasuda K, et al. Elevated urinary 8-hydroxydeoxyguanosine, a biomarker of oxidative stress, and lack of association with antioxidant vitamins in chronic obstructive pulmonary disease. Respirology 2003; 8(4):455–460.
- Dizdaroglu M. Oxidatively induced DNA damage and its repair in cancer. Mutat Res Rev Mutat Res 2015; 763:212–245.
- Morlá M, Busquets X, Pons J, Sauleda J, MacNee W, Agustí AG, et al. Telomere shortening in smokers with and without COPD. Eur Respir J 2006; 27(3):525–528.
- Savale L, Chaouat A, Bastuji-Garin S, Marcos E, Boyer L, Maitre B, et al. Shortened telomeres in circulating leukocytes of patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2009; 179:566–571.
- Boyer L, Chouaïd C, Bastuji-Garin S, Marcos E, Margarit L, Le Corvoisier P, et al. Aging-Related Systemic Manifestations in COPD Patients and Cigarette Smokers. PLoS One 2015; 10(3):e0121539.
- Benetos A, Okuda K, Lajemi M, Kimura M, Thomas F, Skurnick J, et al. Telomere length as an indicator of biological aging: the gender effect and relation with pulse pressure and pulsewave velocity. Hypertension 2001; 37(2 Pt 2):381–385.
- Gan WQ, Man SF, Postma DS, Camp P, Sin DD. Female smokers beyond the perimenopausal period are at increased risk of chronic obstructive pulmonary disease: a systematic review and meta-analysis. Respir Res 2006; 7:52.
- Hakim IA, Harris R, Garland L, Cordova CA, Mikhael DM, Sherry Chow HH. Gender difference in systemic oxidative stress and antioxidant capacity in current and former heavy smokers. Cancer Epidemiol Biomarkers Prev 2012; 21(12):2193–2200.
- Chen CZ, Wang RH, Lee CH, Lin CC, Chang HY, Hsiue TR. Polymorphism of microsomal epoxide hydrolase is associated with chronic obstructive pulmonary disease and bronchodilator response. J Formos Med Assoc 2011; 110(11):685–689.
- Mehrotra S, Sharma A, Kumar S, Kar P, Sardana S, Sharma JK. Polymorphism of glutathione S-transferase M1 and T1 gene LOCI in COPD. Int J Immunogenet 2010; 37(4):263–267.
- Yim JJ, Park GY, Lee CT, Kim YW, Han SK, Shim YS, et al. Genetic susceptibility to chronic obstructive pulmonary disease in Koreans: combined analysis of polymorphic genotypes for microsomal epoxide hydrolase and glutathione S-transferase M1 and T1. Thorax 2000; 55(2):121–125.
- Lakhdar R, Denden S, Kassab A, Leban N, Knani J, Lefranc G, et al. Update in chronic obstructive pulmonary disease: role of antioxidant and metabolizing gene polymorphisms. Exp Lung Res 2011; 37(6):364–375.
- Gaspar P, Moreira J, Kvitko K, Torres M, Moreira A, Weimer T. CYP1A1, CYP2E1, GSTM1, GSTT1, GSTP1, and TP53 polymorphisms: do they indicate susceptibility to chronic obstructive pulmonary disease and non-small-cell lung cancer?. Genet Mol Biol 2004; 27(2):133–138.
- Faramawy MM, Mohammed TO, Hossaini AM, Kashem RA, Abu Rahma RM. Genetic polymorphism of GSTT1 and GSTM1 and susceptibility to chronic obstructive pulmonary disease (COPD). J Crit Care 2009; 24(3):7–10.
- Sin DD, Cohen SB, Day A, Coxson H, Paré PD. Understanding the Biological Differences in Susceptibility to Chronic Obstructive Pulmonary Disease between Men and Women. Proc Am Thorac Soc 2007; 4(8):671–674.
- Chappell S, Daly L, Morgan K, Guetta-Baranes T, Roca J, Rabinovich R, et al. Genetic variants of microsomal epoxide hydrolase and glutamate-cysteine ligase in COPD. Eur Respir J 2008; 32(4):931–937.
- Matheson MC, Raven J, Walters EH, Abramson MJ, Ellis JA. Microsomal epoxide hydrolase is not associated with COPD in a community-based sample. Hum Biol 2006; 78(6):705–717.
- Smith CA, Harrison DJ. Association between polymorphism in gene for microsomal epoxide hydrolase and susceptibility to emphysema. Lancet 1997; 350:630–633.
- GOLD. Global Strategy for Diagnosis, Management, and Prevention of COPD. http://www.goldcopd.org/guidelines-global-strategy-for-diagnosis-management.html. Updated January 2015.
- Sandford AJ, Chagani T, Weir TD, Connett JE, Anthonisen NR, Paré PD. Susceptibility genes for rapid decline of lung function in the lung health study. Am J Respir Crit Care Med 2001; 163(2):469–473.