Seedling growth and photosynthetic response of Pterocarpus indicus L. to shading stress

ABSTRACT

In tropical forests, the shade provided by tree canopies and extreme climate causes inhibition of plant seedling growth due to the lack of light. However, the plants can acclimate to such environmental stress by generating specific responses. The present study aimed to investigate the effects of shading conditions on ecophysiological performance of Narra seedlings (Pterocarpus indicus L.) via a mesocosm experiment. A pot experiment was conducted for 20 weeks in a greenhouse with different shading treatments, 75% (control), 25%, and 4% of full sunlight (FS). As a result, the photosynthetic rate (P_N), Rubisco enzyme activity, maximum carboxylation rate (V_Cmax), and maximum electron transport rate (J_max) in 25% FS treatment were higher or similar to those in control after three weeks of the beginning of shade treatment, whereas the highest values after ten weeks were observed in control. In contrast, the photosynthetic pigments were highest in control after three weeks, while the values were highest in 25% FS treatment after ten weeks. The growth parameters, such as biomass and leaf area, were highest in 75% FS treatment. The expression of Rubisco, phosphoglycerate kinase, glyceraldehyde-3-phosphate dehydrogenase, and fructose-1,6-bisphosphatase were up-regulated in 4% FS treatment compared to control after ten weeks, contributing to tolerating the shade stress. Our findings indicated the capacity of P. indicus seedlings to tolerate and acclimate low light conditions causing shade stress by generating specific physiological and morphological responses, especially Rubisco enzyme activity as well as gene expression related to photosynthetic activity. The present study will improve our understanding of the tolerance mechanism of Narra plant under light-deficient conditions, thereby providing a better strategy for efficiently growing seedlings of this species in tropical rainforests.

KEYWORDS:

• Tropical legume tree
• light deficiency
• Rubisco enzyme activity
• photosynthetic genes
• shade tolerance

Introduction

Sunlight is the most crucial natural resource for plant growth and survival. However, in the terrestrial ecosystem, varying spectral environments can modify the quantity and quality of light, contributing to vegetation diversity and abundance. In tropical rainforests, competition in the absorption of light resources among plant species commonly occurs due to differences in their height. Such unintended blockage of light by the canopy of tall plants can cause abiotic stress (i.e., shade) to the plants with a lesser height, which is partly responsible for tree mortality.¹ As per the estimations of Hiromi et al.² and Kenzo et al.,³ there were significant differences in irradiance between canopy layer (1,800 μmol m⁻² s⁻¹) and understory (5–10 μmol m⁻² s⁻¹) in the tropical rainforest. Because of sunlight block caused by the canopy of tall trees, plants with a lesser height present in the dim understory rely on sun flecks for their survival, which accounts for up to 60–90% of the total daily photon flux density.⁴ In addition, the sun fleck can be responsible for up to 65% of the total daily carbon gain via photosynthesis, albeit not always constant.⁴

Photosynthesis is a crucial factor that regulates plant growth and productivity. Light governs the rate of photosynthesis in leaves and also regulates the structure and function of the photosynthetic apparatus.⁵ Light deficiency caused by shade restricts the capacity of plants to capture sunlight and in turn reduces the photosynthetic capacity, thereby degrading the whole plant growth processes from germination and seedling development to florescence.⁶ A decrease in PSII quantum efficiency and reaction center, electron transport, and ATPase and Rubisco activities etc. due to shade stress is strongly associated to the low photosynthetic capacity and efficiency.^7,8 Additionally, the abiotic stress causes photoinhibition or photodamage of PSI or PSII, resulting in the loss of carbon gain in plants.^4,9 To acclimate to inappropriate light conditions, therefore, plants adjust the photosynthetic apparatus by altering carbon reduction cycle-related enzymes, electron transport components, proteins, and pigments⁸, thereby obtaining as much light energy as needed to fix CO₂ and accumulate carbohydrates.^10,11 In addition to physiological response, the ability of plants to acclimate to insufficient light environment can display with morphological or genetic responses to enhance the efficiency of light capture and maximize carbon gain via photosynthesis.^12–15 However, it varies greatly with plant species traits and environmental conditions.¹⁴ So far, to determine such plant performance in low light environment, various parameters of morphology, anatomy, physiology, phenology, and genetics have been assessed in many studies to improve understanding of shade-tolerant mechanism in plants.^5,9,14 However, most of these previous studies had been conducted for short-term or under field conditions primarily affected by diverse environmental factors. Hence, for a more precise understanding of each tree species, a long-term study on how plant seedlings acclimate to shade stress in the environment where edaphic and biotic factors are controlled is required.¹⁶

Narra plant (Pterocarpus indicus L.) is native to tropical and temperate Asia, including the Philippines, India, Borneo, and the Pacific region, Celebes, New Guinea, and the Caroline Islands.^17,18 However, there has been a significant decline in its habitat distribution due to deforestation, illegal logging, and cutting¹⁸ as well as climate change.¹⁹ Currently, this species is listed as endangered on the IUCN Red List of Threatened Species, thus P. indicus is gaining attention for reforestation projects in several tropical countries, including Philippines.²⁰ In particular, the Narra plants have a capacity to store nitrogen and other major nutrients in soil,¹⁸ contributing to improvement of forest soil quality and forest ecosystem sustainability. There is also a high interest in cultivating this species due to its high market value as a timber.^21,22 Thus, such benefits are expected to contribute to the conservation of tropical forests and the revival of the timber industry through afforestation of this species. However, in the forest environment, blocking sunlight by tree canopies and extreme climate impact induce a decrease in the viability of plant seedlings, affecting the efficiency of tree farming and reforestation. According to previous studies, such tropical plant species, particularly at the seedling stage, require the least quantity of light via the photosynthetic apparatus under a shaded environment for their survival and fitness,^23,24 and this phenomenon can be explained by irradiance altering the physiological and biochemical responses, gene expression, and biomass of plants.²⁴ Therefore, it is necessary to study the environmental (i.e., shading) and biological variables that are inappropriate for seedling growth not only for genetic conservation and management, but also for commercial purpose. This study aimed to examine the acclimation ability of P. indicus seedlings to different shaded treatments via physiological responses, including photosynthesis, the performance of Rubisco enzyme activity, and biomass, and identify gene expressions related to the photosynthetic mechanism and potential acclimation capacity under different shade environments.

Material and methods

Mesocosm study

A pot experiment was performed in a greenhouse at the University of Seoul from spring to early autumn. For this study, one three-year-old seedling of Narra (P. indicus), a nitrogen-fixing species, was planted in each pot (diameter: 15.5 cm and height: 19.8 cm). All pots were filled with artificial soil that consisted of perlite, vermiculite, and peat moss (1:1:1 = v:v:v). The soil substrates contained ammonium (NH₄–N: 150 mg L⁻¹), nitrate (NO₃–N: 200–350 mg L⁻¹), and phosphate (PO₄–P: 200–350 mg L⁻¹). Before shading treatment, the plants were allowed to acclimate to the surrounding environment of the glasshouse for a week. Net houses (height: 2 m, length: 6 m, width: 1.5 m, spectral range: 400–700 nm) covered with black shade net were installed in the glasshouse.

The shading treatments were set up depending on the thickness of the shade net: 75% (control), 25%, and 4% of full sunlight (FS) irradiance levels. The variations of photosynthetic photon flux density (PPFD) in accordance with the seasonal effect and shading treatment were measured using an LI-190SA sensor; the recorded data for PPFD are shown in Table 1. During the plant growth period (five months), water was supplied every two days. Also, the temperature in the glasshouse was maintained between 25°Ϲ and 35°Ϲ over the period. Each treatment consists of five replicate pots.

Table 1. Temporal difference in values of photosynthetic photon flux density (PPFD; μmol m⁻² s⁻¹) depending on different light intensities of full sunlight (FS) for 20 weeks cultivation in a glasshouse.

Treatment	3rd week	10th week	20th week
75% FS	778	979	379
25% FS	253	343	120
4% FS	33	64	23
Natural sunlight^a	1,298	1,180	461

^aIntensity of full sunlight outside the glasshouse (considered as 100%).

Photosynthesis rate

The net photosynthetic rate (P_N), stomatal conductance (G_s), transpiration rate (T_r), and water use efficiency (WUE) were measured using an XT LI-6400 portable photosynthesis system equipped with a leaf chamber fluorometer (Li-Cor Inc., Lincoln, NE, USA). The fully expanded leaves from each plant’s middle to upper parts were randomly selected and measured at three different times: three, ten, and twenty weeks from the beginning date of shading treatment. Before measurements, the leaves were acclimated for 2 min at each PPFD, including 0, 20, 40, 60, 80, 100, 300, 500, 800, 1200, 1500, and 2000 μmol mol⁻¹. The ambient CO₂ concentration (C_a) and vapor pressure deficit were set up as 380 μmol mol⁻¹ and 2.0 ± 0.4 kPa, respectively. The photosynthetic WUE was calculated as follows:²⁵ WUE = P_N (μmol CO₂ m⁻² s⁻¹)/T_r (mmol H₂O m⁻² s⁻¹).

Photosynthetic pigments

Chlorophyll (Chl) and carotenoid (Car) in the leaves after three, ten, and twenty weeks from the beginning date of the shade treatment were determined quantitatively. The fresh leaves (0.1 g) of P. indicus seedlings were sampled at each time point and placed in a glass tube containing 10 mL of 80% acetone. The tube was stored in a refrigerator at 4°C for seven days, and the extract was measured at three different wavelengths (663, 645, and 480 nm) with a UV spectrophotometer (Shimadzu UV–160A, Shimadzu Co., Japan). Chl a, Chl b, Chl (a + b), Chl a:b, Car, and Chl (a + b)/Car were estimated by the following formula:²⁶

Chl. a = 12.7×A₆₆₃ – 2.69×A₆₄₅

Chl. b = 22.9×A₆₄₅ – 4.68×A₆₆₃

Total Chl (a + b) = 20.29×A₆₄₅ + 8.02×A₆₆₃

Chl a/b = Chl a/Chl b

Total Car = (1,000×A₄₇₀ – 1.82×Chl a – 85.02 × Chl b)/198

Leaf gas exchange measurement

To estimate the photosynthetic capacity of P. indicus seedlings, the net carbon fixation (A/C_i) was calculated with P_N to intercellular CO₂ assimilation (C_i) detected using an XT LI-6400 infra-red gas analyzer equipped with a leaf chamber fluorometer (Li-Cor Inc., USA). The ambient conditions were similar to the Philippines environment as described by Baek and Woo:²⁷ temperature (25 ± 1°C), humidity (68%), and CO₂ concentration (380 ppm). The fourth and sixth leaves selected from the upper part of each plant were clamped for 10–15 min at 50 µmol mol⁻¹ CO₂ to achieve maximum stomatal conductance before the measurement. The P_N in the leaves was measured for 2 min at different intercellular CO₂ concentrations, including 0, 50, 100, 150, 200, 400, 600, 800, and 1000 µmol mol⁻¹. Rubisco maximum carboxylation rate (V_Cmax) and daytime respiration (R_d) were calculated by nonlinear regression from the data of the P_N-C_i curve for 0 < C_i <200 µmol mol⁻¹, and maximum electron transport rate (J_max) was calculated from the P_N-C_i curves by fitting the equation given below to a near-plateau (C_i > 600 µmol mol⁻¹) based on Farquhar et al.²⁸ The values of Γ*, K_c, and K_o at the measured leaf temperatures were calculated with the temperature dependence equations and parameters from Bernacchi et al.²⁹ and Onoda et al.³⁰ R_d was assumed to be 0.02 of V_Cmax.³⁰

$A_{\mathrm{c}}=\frac{V_{\mathrm{C}\mathrm{m}\mathrm{a}\mathrm{x}}\left(C_{\mathrm{i}}-{\mathrm{\Gamma }}^{\ast }\right)}{\left(C_{\mathrm{i}}+K_{\mathrm{c}}\left(1+\frac{O}{K_{\mathrm{o}}}\right)\right)}-R_{\mathrm{d}}$

$A_{\mathrm{j}}=\frac{J_{\mathrm{m}\mathrm{a}\mathrm{x}}\left(C_{\mathrm{i}}-{\mathrm{\Gamma }}^{\ast }\right)}{\left(4C_{\mathrm{i}}+8{\mathrm{\Gamma }}^{\ast }\right)}-R_{\mathrm{d}}$

Where A_c is the P_N limited by Rubisco activity (µmol m⁻² s⁻¹)

C_i is the intercellular CO₂ concentration (µmol mol⁻¹)

K_c and K_o indicate Michaelis – Menten constants of Rubisco activity for CO₂ and O₂, respectively (K_c = 405 µmol mol⁻¹, K_o = 278 mmol mol⁻¹)

O is the intercellular O₂ concentration (mmol mol⁻¹)

Γ* is the CO₂ compensation point (42.8 µmol mol⁻¹)

R_d = 0.02*V_Cmax

A_j is the P_N limited by RuBP regeneration (µmol m⁻² s⁻¹)

Rubisco enzyme activity

Rubisco enzyme in the leaves was extracted with a modified method of Kasai (2008)³¹ and Lu et al. (2009)³². Fresh leaves (0.1 g) of P. indicus seedlings were collected after three and ten weeks during the pot experiment. The leaves were homogenized with liquid nitrogen in a mortar and pestle. The extraction was carried out with a buffer solution (1.5 mL) containing 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 10 mM MgCl₂, 1% (w/w) polyvinyl pyrrolidine, 12% (v/v) glycerol, and 0.1% (v/v) β-mercaptoethanol. After centrifugation at 15,000 $\underset{\_}{\mathrm{X}}$ for 15 min at 4°C (Micro 17TR, Hanil Science Ltd., Korea), an assay buffer containing 50 mM HEPES-KOH (pH 8.0), 1 mM Na₂-EDTA, 2.5 mM DTT, 10 mM NaHCO₃, 20 mM MgCl₂, 5 mM creatine phosphate, and 0.15 mM NADH was added into the homogenate, followed by storage for 10 min at 25°C. Then, a response buffer [10 unit PGK, 10 unit GAPDH, and 10 unit phosphocreatine kinase] was added. To measure Rubisco enzyme activity, change or decrease in absorbance at 340 nm during the initial 90 s was monitored using a UV 160A spectrophotometer.

$\mathrm{R}\mathrm{u}\mathrm{b}\mathrm{i}\mathrm{s}\mathrm{c}\mathrm{o}\mathrm{a}\mathrm{c}\mathrm{t}\mathrm{i}\mathrm{v}\mathrm{i}\mathrm{t}\mathrm{y}\left(\mu m\mathrm{o}\mathrm{l}{\mathrm{g}}^{-1}{\mathrm{s}}^{-1}\right)=\frac{A\times TV\times F}{\epsilon \times d\times SV\times SG\times T}$

Where A = ∆ (Absorbance at 340 nm)

TV = Total assay volume (µL)

F = Dilution factor from sample preparation

Ɛ = Extinction coefficient for NADH at 340 nm (6.3 µmol⁻¹ cm⁻¹)

d = Light path (cm)

SV = Sample volume (µL)

SG = Sample weight (g)

T = ∆Time

Plant growth parameters

Following five months of cultivation, all plants were harvested to measure their growth. The leaves, shoots, and roots were separated. Various plant growth parameters were recorded as follows: fresh weight (FW), dry weight (DW), leaf area (LA), specific leaf area (SLA; the ratio of leaf area to leaf dry mass), leaf mass ratio (LMR; total leaf mass to the entire plant biomass), and root mass ratio (RMR). Before DW measurement, the samples were oven-dried for three days at 85°C.

RNA extraction, cDNA synthesis, and quantitative RT-PCR

The total RNA was extracted from the fifth leaves from the top side of P. indicus seedlings sampled in the tenth week (summer season) after acclimating to shading treatments (75%, 25%, and 4% FS) using the cetyltrimethylammonium bromide (CTAB) method modification (Kim and Hamada 2005)³³. First-strand cDNA was synthesized from 1 µg of total RNA using reverse transcriptase (MMLV Reverse Transcriptase, Clontech, USA) and oligo dT primer. After the RT reaction was performed for 2 h at 42°C, 1 µL of RT reaction mixture was used as a template in 50 µL PCR-amplification reaction mixture composed of SYBR Green Master Mix (Takara, Japan), and 10 pmol of each primer. The tubulin gene was used as control and the primers used for RT-PCR analysis are listed in Table 2. The PCR reaction was run for 35 cycles of 30 s at 94°C, 30 s at 60°C, and 1 min at 72°C, with a 5 min final extension at 72°C. The amplified PCR products were visualized by electrophoresis on 1% agarose gel.

Table 2. Forward and reverse primers of P. indicus for photosynthesis-related genes such as Rubisco, FBPase, GAPDH, PGK, and tubulin (control).

Gene	Primer	5’→3’
Rubisco	Forward Reverse	CTTCTTCATATCCATCGTGCAA CAGGTAGAGAAACCCAATCCTG
FBPase	Forward Reverse	AAAGGGCTAACATTTCCAACCT GCTGTAGATCCCAAAGATGGAC
GAPDH	Forward Reverse	TCCAAGACCCTTCTCTTTGG CTCTGGCTTGTACTCGTGGCT
PGK	Forward Reverse	AATCCTTGTTGGAGAAGGTT ATCCATCCATCTGGGATACT
Tubulin	Forward Reverse	GATTCCCTGGTCAACTCAAC ATGGCAGAAGCAGTAAGGTA

Protein extraction and 2-dimensional gel electrophoresis

The leaf protein of P. indicus seedlings was extracted with Mg/NP-40 buffer, including 0.5 M Tris-HCl (pH 8.3), 2% v/v NP-40, 20 mM MgCl₂, 5% β-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, and 1% (w/v) polyvinyl polypyrrolidone and fractionated with polyethylene glycol (PEG) 4000 after twenty weeks (autumn season). The protocol for in-gel digestion and MALDI TOF-MS followed that provided by Kim et al. (2007).³⁴

Statistical analysis

The data for plant physiological parameters were statistically analyzed using a SAS software package (Systat 9.13, Systat Software Inc., Richmond, USA), with one-way analysis of variance (ANOVA) and Fisher’s least significance difference (LSD) post-hoc test to identify differences in the parameters among shade treatments (p < 0.05).

Results

Photosynthesis parameters in response to shading treatments

After three weeks of shading, the maximum rate of photosynthesis (P_Nmax) at a saturating light intensity of 2,000 μmol m⁻² s⁻¹ was highest in 25% FS treatment (6.46 μmol m⁻² s⁻¹), followed by 75% and 4% FS treatments (Figure 1). On the other hand, after ten weeks, the highest P_Nmax was found in 75% FS (5.87 μmol m⁻¹ s⁻¹), followed by 25% and 4% FS treatments. Indeed, over ten weeks, the P_Nmax value increased in control while decreasing in shade treatments of 25% and 4% FS treatments. After twenty weeks, there was no difference in the P_Nmax values among all the treatments.

Figure 1. Variation of the net photosynthesis rates (P_N) of P. indicus upon photosynthetic photon flux density (PPFD) among different shade treatments including 75%, 25%, and 4% of full sunlight (FS). The P_N was measured at the 3rd week, 10th week, and 20th week from the beginning of shading treatment. Data represent the mean of the P_N values at each PPFD ± standard errors (n = 6).

The G_s values of P. indicus seedlings grown in 75% and 25% FS treatments after three weeks were 0.04 and 0.05 mmol m⁻² s⁻¹, respectively, and higher than that in 4% FS treatment (p < 0.05; Table 3). Likewise, the G_s value was similar for the 75% and 25% FS treatments after ten weeks. On the other hand, there was no significant difference in the G_s value among different shade treatments after twenty weeks (p > 0.05).

Table 3. Differences in photosynthetic parameters, such as stomatal conductance (G_s), transpiration rate (T_r), and water use efficiency (WUE), in leaves of P. indicus at different light intensities including 75%, 25%, and 4% of full sunlight (FS) during the pot experiment. Values in brackets represent standard errors of the means (n = 6). Same letters within each measurement time indicate no significant difference among the shade treatments (LSD, p < 0.05).

Parameter	Treatment	3rd week	10th week	20th week
Gs (mmol m^−2 s^−1)	75% FS	0.04 (0.01)^a	0.06 (0.02)^a	0.04 (0.02)^a
	25% FS	0.05 (0.02)^a	0.05 (0.01)^a	0.05 (0.01)^a
	4% FS	0.03 (0.01)^b	0.03 (0.01)^b	0.05 (0.01)^a
Tr (mmol H2O m^−2 s^−1)	75% FS	0.44 (0.37)^b	1.11 (0.33)^a	1.06 (0.32)^a
	25% FS	1.02 (0.50)^a	1.20 (0.25)^a	0.82 (0.33)^a
	4% FS	1.11 (0.33)^a	0.82 (0.19)^b	1.13 (0.29)^a
WUE (µmol CO2 mmol^−1 H2O)	75% FS	0.33 (1.85)^a	0.20 (1.64)^a	1.86 (7.33)^a
	25% FS	1.60 (5.92)^a	0.43 (1.50)^a	0.43 (0.90)^a
	4% FS	0.55 (1.43)^a	0.18 (0.86)^a	0.49 (0.80)^a

The transpiration rate (T_r) of P. indicus seedlings was higher in 25% FS than in 75% and 4% FS treatments after three weeks (p < 0.05; Table 3). After ten weeks, the T_r value was similar for 75% and 25% FS treatments, accounting for over 1.1 mmol m⁻² s⁻¹. Overall, the T_r values of the seedlings after ten weeks were higher than those after three weeks. After twenty weeks, there was no significant difference in the T_r value among the three shade treatments (p > 0.05). Unlike the P_N, G_s, and T_r trends, WUE had no significant difference in shade treatments during the experiment (Table 3).

Variation of pigment contents

There was a similar trend that the concentrations of Chl (a + b) and Car did not differ among the shade treatments after three weeks, whereas those in 25% FS were higher than those in other treatments after ten weeks (p < 0.05; Figure 2). The highest ratio of chlorophyll a to b was found in 75% FS treatment after three and ten weeks (Figure 2). On the other hand, the highest ratio of chlorophyll to carotenoid was in 4% FS, followed by 25% and 75% FS treatments after three weeks (Figure 2). As with the ratio of Chl a/b, the lowest ratio of Chl (a + b)/Car was in 25% FS after ten weeks. In general, after twenty weeks, there were no significant differences in those values related to photosynthetic pigments from the three shade treatments (p > 0.05).

Figure 2. Concentrations of photosynthetic pigments in leaves of P. indicus at different light intensities including 75%, 25%, and 4% of full sunlight (FS) during the pot experiment: chlorophyll (chl) (a+b), carotenoid (car), chl a/b ratio, and chl (a+b)/Car ratio. Values indicate the mean ± standard errors (n = 6). Same letters represent no significant difference among different shade treatments of each season (LSD, p < 0.05).

Photosynthetic carbon assimilation

For the concentration of intercellular CO₂, a clear difference among different shade treatments was observed after ten weeks, but not three and twenty weeks (Figure 3). Compared to two shade treatments, the plants in 75% FS as control had an elevated value of the C_i when measured after ten weeks (Figure 3). On the other hand, after three and twenty weeks, the C_i values of plant leaves in 75% and 25% FS treatments were similar but higher than that in 4% FS treatment (Figure 3).

Figure 3. Variation of the net photosynthetic rate (P_N) of P. indicus upon different intercellular CO₂ levels (C_i) among different light intensities including 75%, 25%, and 4% of full sunlight (FS). The P_N was measured at the 3rd week, 10th week, and 20th week from the beginning of shade treatment. The C_i concentrations were ranged from 0 to 1,000 [μmol CO₂ mol⁻¹]. Data represent the means of the P_N value at each C_i concentration ± standard errors (n = 6).

Rubisco enzyme activity

Depending on light intensity and shading duration, Rubisco enzyme activity varied (Figure 4). The highest values of Rubisco activity were found in 75% FS after ten weeks. In addition, the value of Rubisco enzyme in leaves sampled after ten weeks was higher than after three weeks. Over time, the Rubisco enzymatic activity increased 2.8, 1.3, and 2.5 times in 75%, 25%, and 4% FS treatments, respectively.

Figure 4. Rubisco activity of P. indicus leaves under different light intensities including 75%, 25%, and 4% of full sunlight (FS) at the 3rd week and 10th week from the beginning of shade treatment. Values indicates the means ± standard errors (n = 3). Same letters of each season represent no significant difference among the shade treatments (LSD, p < 0.05).

The V_Cmax and J_max in the leaves of P. indicus seedlings grown at different light intensities are shown in Table 4. The values of V_Cmax and J_max varied by shading duration. Both values in 75% and 25% FS treatments increased from the 3rd week to 10th week but decreased at the 20th week. Overall, both values at the third and twentieth weeks were similar, but there was a significant difference among the treatments (p < 0.05). On the other hand, after ten weeks, the V_Cmax and J_max considerably differed by light intensity. In particular, V_Cmax responded highly to the degree of light intensity after ten weeks (Table 4).

Table 4. Differences in the maximum rate of RuBP carboxylation capacity (V_Cmax), the maximum electron transport rate driving RuBP regeneration (J_max), and the ratio of J_max to V_Cmax (J/V) in leaves of P. indicus at different light intensities including 75%, 25%, and 4% of full sunlight (FS) during the pot experiment. Values in brackets indicate standard errors of the mean (n = 3). Same letters within each measurement time and column represent no significant difference among the shading treatments (LSD, p < 0.05).

Parameter	Treatment	3rd week	10th week	20th week
VCmax (µmol m^−2 s^−1)	75% FS	35.1 (2.1)^b	71.3 (3.0)^a	31.2 (2.3)^a
	25% FS	35.3 (2.1)^a	48.7 (2.0)^b	25.8 (1.6)^ab
	4% FS	35.1 (6.1)^b	28.8 (1.3)^c	20.3 (1.5)^b
Jmax (µmol m^−2 s^−1)	75% FS	62.7 (3.4)^b	93.6 (5.1)^a	69.9 (1.5)^a
	25% FS	72.9 (3.4)^a	91.0 (2.6)^a	63.6 (1.3)^a
	4% FS	62.7 (4.4)^b	41.2 (2.0)^b	51.1 (2.3)^b
J/V	75% FS	1.8 (1.0)^a	1.3 (<0.1)^b	2.2 (1.1)^a
	25% FS	1.3 (0.1)^a	1.9 (0.1)^a	2.5 (0.1)^a
	4% FS	1.8 (<0.1)^a	1.4 (0.1)^b	2.5 (0.1)^a

Plant growth characteristics

The growth of P. indicus seedlings was affected by shade treatments (Table 5, Figure 5). The values of FW, DW, and LA in 75% FS were higher than those in 25% and 4% FS treatments (p < 0.05). The three growth factors decreased with a decrease in light intensities, but there was no significant difference between the shading treatments (p > 0.05). Such a tendency was found in LMR. Meanwhile, SLA showed an opposite trend; it increased with a decrease in light intensities (Table 5). The SLA in 4% FS was higher by around 85% than in 75% FS treatment. RMR did not significantly differ among the three shading conditions (p > 0.05). The plant height of P. indicus seedlings decreased with a decrease in light intensities (Figure 5). The height was higher (about 32%) in 75% FS than in 4% FS (p < 0.05), while the diameter representing no significant difference among all treatments (p > 0.05).

Figure 5. Height and diameter of P. indicus seedlings grown in 75%, 25%, and 4% of full sunlight (FS). Bars indicate means ± standard errors (n = 6). Same letters of each parameter represent no significant difference among the shade treatments (LSD, p < 0.05).

Table 5. Growth characteristics of P. indicus seedlings grown for 20 weeks under different light treatments, including 75%, 25%, and 4% of full sunlight (FS). Values in blankets indicate standard errors of the means (n = 9). The variables include fresh weight (FW), dry weight (DW), leaf area (LA), specific leaf area (SLA), leaf mass ratio (LMR), and root mass ratio (RMR). Same letters in each column indicate no significant difference among the treatments (LSD, p < 0.05).

Treatment	FW (g)	DW (g)	LA (cm^2)	SLA (cm^2 g^–1)	LMR (g g^–1)	RMR (g g^–1)
75% FS	257 (30)^a	118 (26)^a	46.27 (<0.01)^a	0.41 (0.10)^b	0.23 (<0.01)^a	0.22 (<0.01)^a
25% FS	153 (9)^b	55 (6)^b	29.58 (<0.01)^b	0.55 (0.10)^ab	0.20 (0.10)^ab	0.25 (0.10)^a
4% FS	142 (6)^b	41 (16)^b	27.38 (<0.01)^b	0.76 (0.30)^a	0.15 (<0.01)^b	0.24 (<0.01)^a
F value	12.3	20.7	45.5	3.27	2.97	0.31
p value	0.0080	0.0004	0.0001	0.0857	0.1025	0.7425

Photosynthetic gene and proteome expression

The results of key photosynthesis-related genes expression pattern under different shade treatments are shown in Figure 6. The most shaded treatment, 4% FS, had higher levels of Rubisco, PGK, GAPDH, and FBPase by 117%, 202%, 96%, and 82%, respectively, compared to 75% FS after ten weeks. The changes in the identified leaf proteins of P. indicus seedlings grown in different shade treatments were observed (Supplemental Figure S1). We compared the expression difference in the total photosynthetic proteome extracted from 2-DE in the different shade treatments. Ten proteins were identified (see Supplemental Table S1); four expressed spots (#1, #2, #3, and #4) were predominantly expressed in 75% FS. Another four expressed spots (#5, #6, #7, and #8) were found in 25% FS, and the other two spot numbers (#9 and #10) were prominent in 4% FS.

Figure 6. Transcription analysis of photosynthesis related genes including tubulin (control), ribulose 1, 5-bisphosphate carboxylase/oxygenase (Rubisco), 3-phosphoglycerate kinase (PGK), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and fructose 1, 6-bisphosphate aldolase (FBPase) by semiquantitative RT-PCR. Total RNA was isolated from P. indicus leaves at the 10^th week from the beginning of shade treatments including 75%, 25%, and 4% of full sunlight (FS).

Discussion

In this study, the difference in light intensities by shade treatment varied its impacts on the physiological response of three-year-old seedlings of P. indicus. Also, the effect of these difference in light intensity on plant characteristics tended to become more pronounced along the shading duration. Photosynthesis is strongly associated with light intensity, contributing to photosynthetic performance and plant production.³⁵ In this study, with an increase in light intensity, the P_N of unshaded seedlings alone increased after ten weeks (Figure 1). This indicated that lower intensities of the light via shade treatment resulted in the limitation of carbon gain in the leaves of P. indicus and that the amount of photon quantum yields in PSII might be decreased.³⁶ However, a higher value of P_N was observed after shade treatment of 25% FS than 75% FS at the third week, suggesting that the plants acclimation to the moderate shade conditions might be attributed to enhanced photosynthetic adaptation triggered by high carbon acquisition.^37,38 A similar observation was reported by Boardman³⁹ and Krause et al.,⁴⁰ where the shade conditions enhanced the electron transport capacity and photon yield within the chloroplasts for increasing enzyme activity related to photosynthetic response. Moreover, under moderate shade H₂O in the leaves is essential in fixing CO₂ uptake by exporting carbon for photosynthetic induction, resulting in a quick stomatal opening within shading leaves.⁴¹ This is in agreement with the reports of the present study, where stomatal conductance and transpiration rate were higher in 25% FS than in 75% FS treatment after three weeks (Table 3). Likewise, the WUE was higher under the shaded condition maybe due to the maintenance of water capacity to compensate for photosynthesis damage.³⁶ On the other hand, the lower WUE under natural sunlight of 75% FS is attributed to reductions in G_s and T_r (Table 3),⁴² limiting CO₂ uptake and water consumption within stomata. The results indicated that, under shade conditions, carbon gain and water consumption of P. indicus leaves might be balanced by enhancing tolerance to the abiotic stress.

The effect of enhanced tolerance to shade stress was found in photosynthetic pigments, in particular, after ten weeks (Figure 2). Such an effect in the pigments, i.e., total Chl (a+b), occurred in the moderate shade treatment, indicating that P. indicus could increase chlorophyll pigments at low irradiance, leading to maximizing light-harvesting capacity.^5,42,43 The shade leaves of P. indicus seedlings have different chlorophyll concentrations depending on the light intensity; the thinner shade leaves contain more significant amounts of chlorophyll.⁴⁴ Carotenoid and Chl a/b ratio, which are indicators of the photosynthetic activity of the plant leaves,⁴⁵ have several physiological functions associated with abiotic stress.⁴⁶ In this study, we found an enhanced Car content in the shaded leaves of P. indicus seedlings, particularly in 25% FS (Figure 2). Such an increase in the pigment molecule in response to shade stress may be attributed to the expansion of the light-harvesting capacity of the antenna of the photosystem ІІ (P680) in the chloroplast.^47,48 As such, the Car status in the plant leaves has been considered as an essential index for shade tolerance ability.^49,50 On the other hand, the low ratio of Chl a/b in the shade treatment was related to an increase in Chl b content, indicating that leaves of P. indicus seedlings might optimize light absorption by enhancing electron transport efficiency.¹³ and increasing the light harvest complex (LHC ІІ) proteins in the reaction center.⁵¹ An increase in carotenoid content in the leaves is correlated with an increase in the chlorophyll a/b ratio.⁴⁶ Furthermore, the results for the chlorophyll (a+b): carotenoid ratio showed that leaves grown in 4% FS possessed a higher value ratio in comparison with 75% and 25% FS after three and ten weeks, respectively (Figure 2). This result can be explained by the P. indicus leaves in complete sunlight treatment having fewer light-harvesting chlorophyll proteins and a more significant number of reaction center pigment proteins, such as CPa and CP I, on a total chlorophyll basis compared with the shaded leaves.^51,52 The lower ratio of Chl/Car in FS also reflects that a higher proportion of carotenoids might protect the chlorophyll damage from either photooxidation or ultraviolet radiation.⁵³

The high levels of photosynthetic parameters, such as G_s, T_r, V_Cmax, and J_max in plants grown in 25% FS shading treatment after three weeks were found, indicating that the tree species can have an acclimation of photosynthesis to the moderate shade stress (Tables 3, 4). Ten weeks after, V_Cmax and J_max tended to increase in 75% and 25% FS treatments but decrease in 4% FS, suggesting a significant shade stress impact. In addition, the V_Cmax and J_max values where decreased in all the shade treatments at the 20th week (Table 4), indicating that the autumn temperature may affect the photosynthetic and leaf biochemistry dynamics.⁵⁴ Such decrease in V_Cmax and J_max by shading and seasonal cold effects can limit P_N, leading to a decrease in nitrogen partitioning to Rubisco.^55,56

Rubisco in plants play a crucial role in carbon acquisition in the “light-independent reactions” of photosynthesis and photorespiratory oxygen consumption.^57,58 However, Rubisco content in plants is considerably reduced during shade acclimation, together with alterations in leaf’s area, chlorophyll, and nitrogen content.⁵⁹ Likewise, in this study, the shaded leaves of P. indicus had lower Rubisco activity than the unshaded leaves (Figure 4). In general, the amount of Rubisco enzyme and light-saturated photosynthesis in leaves have a co-relationship.⁶⁰ Hence, when P. indicus seedlings were grown in FS, the RuBP regeneration and phosphorylation regeneration capacity in the Calvin cycle could have high light energy efficiency via ATP and NADPH electron transports in the thylakoid membrane of the chloroplast.^61,62 On the other hand, in shaded treatments, the amount of ATP and NADPH contributing to Rubisco enzyme activity and the availability of CO₂ assimilation might decrease in the Calvin cycle.⁶² Additionally, the lower Rubisco content in shaded leaves may be derived from low investment in photosynthetic protein yield and a low light-saturated P_N.⁶³ In particular, a greater reduction in Rubisco activity caused by shading treatment was found after ten weeks when the intensity of sunlight was strong across the present experiment (Figure 4), accordingly influencing overall plant growth and characteristics.

Plants can respond to change in light intensity by adjusting morphological characteristics. In this study, 75% FS treatment, the highest light intensity, resulted in higher values in the growth parameters, such as FW, DW, and LA, than the other two shading treatments (Table 5). Additionally, the higher the light intensity, the higher LMR can be explained by the leaves grown in full sunlight having thicker leaves, a higher P_N, and a higher quantum yield capacity than shaded leaves.⁶³ A similar pattern in those was found in Australian rainforest species.⁶⁴ On the other hand, the lowest value of RMR was observed in control, and it tended to have an inverse relationship with LMR (Table 5). Generally, an increased LMR in a high irradiance environment correlates with the reduced biomass allocated toward root mass, resulting in water limitation.^64,65 Salgado-Luarte and Gianoli⁶⁶ explained that shaded leaves have a small amount (number) of branches, longer internodes, and petioles, and the leaf blade is horizontally stretched. Furthermore, the results in relation to height and the constant value of diameter are in accordance with Kelly et al.⁶⁴ and Zhao et al.⁶⁷ An increase in shoot height has a positive co-relationship with an increase in light intensity,^68,69 contributing to an increase in P_N, active strength of plants, and high CO₂ assimilation rate in full sunlight condition.^67,69,70 However, under light-deficient conditions plants can be stimulated to have a light harvest capacity by enlarging their leaf size for higher photosynthesis.^63,71,72 Among the growth parameters, SLA is considered as an index of morphological response, including leaf structure, thickness, and mechanical tissues, to changing light conditions.^73,74 As reported by Liu et al.,¹⁴ plants grown in shaded condition have a higher SLA, which aids improve the efficiencies of light capture and carbon gain. Likewise, SLA of P. indicus seedlings increased as the light intensities decreased in this study (Table 5). Similarly, Lichtenthaler et al.⁴⁵ demonstrated that higher SLA in leaves of ash, hornbeam, maple, and linden trees on the lower canopy compared to those on the upper canopy.

We also found the molecular response of P. indicus seedlings to shade stress. The expression of photosynthetic genes, including Rubisco, GAPDH, FBPase, and PGK, differed by light intensities (Figure 6). All genes in the leaves of P. indicus seedlings were up-regulated in the most shaded treatments of 4% FS compared to the other two treatments. This suggests that this tree species can have a high tolerance against shade stress, by facilitating the Calvin cycle with increased gene activation related to Rubisco, GAPDH, and FBPase at least. Similar to this study, Hu et al. (2012)⁷⁵ reported that the PGK gene of maize (Zea mays L.) seedlings was increased in dim-light conditions. Also, ginseng (Panax ginseng L.) plants grown under shaded conditions, similar to the light intensity of 4% FS (30 µmol m⁻² s⁻¹) in this study, exhibited upregulation of photosynthesis-related genes, including PGK and GAPDH.⁷⁶ On the contrary, the highest light intensity of 75% FS treatment revealed downregulation of gene expressions despite the high enzyme activity of Rubisco at the tenth week as shown in Figure 4. According to Uematsu et al.,³⁸ saturated photosynthetic response under excessive light conditions during long periods limits regeneration of RuBP and phosphorylation and photoinhibition. Downregulation of photosynthetic genes is related to increased carbohydrate accumulation, reducing photosynthetic enzyme activities, including Rubisco, GAPDH, and FBPase.^37,77 Also, the downregulation in Rubisco gene due to light stress has been reported by Escoubas et al.⁷⁸ and Erickson et al.⁷⁹

Moreover, plant acclimation to light stress for long periods induces changes in photosynthetic gene expressions, inhibiting photosynthetic proteins and protein synthesis.^80,81 It has been demonstrated that plants exposed to high light intensity, like 75% FS at the tenth week, exhibited photoinhibition affecting the loss of O₂-evolving activity and facilitating the synthesis of D1 polypeptide.⁸² On the other hand, it is possible that photosynthetic genes of Rubisco, GAPDH, and FBPase provided the leaves with essential storage proteins, sucrose, and starch under low irradiance.^38,83 This study identified spots indicating different proteins from the 2-DE gel tests (Supplemental Figure S1). As a result, higher Rubisco proteome levels in the seedlings grown under high and moderate light intensities (75% and 25% FS) enhanced Rubisco enzyme activity. However, Rubisco protein was not found in the low light of 4% FS. This may be due to the shade stress leads to oxidative damage and D1 protein degradation by generating active oxygen species,^57,84 decreasing Rubisco enzyme activity. Meanwhile, in the leaves of P. indicus seedlings grown in 4% FS, ferric leghemoglobin reductase (FLBR) and glycine dehydrogenase were up-regulated compared to other treatments. FLBR is an essential protein inhabiting the root nodules of legume crops that binds to O₂ for maintaining O₂ concentration and improving N₂-fixing bacteroids in a microaerobic environment.^85–87 FLBR allows O₂ respiration in the root nodules, protecting them from disease, and is a defense against biotic stresses.^88,89 Although the leaves in 4% FS had shaded stress in the absence of the Rubisco proteome, the roots of P. indicus seedlings in the low light may have stress tolerance by increasing FLBR. Glycine dehydrogenase is usually decreased under abiotic stresses, including chilling (cold) and heavy metal exposure, which results in low photorespiration efficiency in the leaves.⁹⁰ Contrary to this, Lee et al.⁹¹ reported that glycine dehydrogenase was up-regulated in the roots of rice (Oryza sativa L.) seedlings under abiotic stress. Glycine dehydrogenase may regulate electron transport to prevent photoinhibition under a stressful environment.⁹² A higher level of glycine dehydrogenase could generate higher energy for coping with abiotic stress.⁹¹ In this study, the upregulation of glycine dehydrogenase in the leaves grown in dark conditions of 4% FS may positively affect the generation of shading stress tolerance.

Conclusion

In tropical forests where sunlight is blocked due to canopy and climate change, securing shade tolerance is the most essential factor for the survival of tree seedlings. Our findings obtained from this mesocosm experiment demonstrated that P. indicus seedlings were capable to tolerate and acclimate to the low light environment. Albeit the adverse effect of shading treatment on biomass production was clear, the Narra seedlings showed an acclimation ability to shading stress during the 20-week experiment, via generating specific responses that modulate physiological (e.g., photosynthesis, pigments, Rubisco enzyme activity, and biomass), morphological (e.g., specific leaf area), and molecular (e.g., photosynthetic genes, such as Rubisco, GAPDH, EBPase, and PGK) characteristics. Although the acclimatory responses of Narra seedlings varied considerably with light intensity and shading duration, it seems that this species was able to maintain their viability under harsh light conditions through an enhanced tolerance mechanism to the abiotic stress. These results in the present study will improve our understanding of the ecophysiological response traits of Narra seedlings under light-deficient conditions and provide a better strategy for efficiently growing seedlings of this species in tropical rainforests.

Abbreviations

Ac	=	the photosynthetic rate limited by Rubisco activity
Aj	=	the photosynthetic rate limited by RuBP regeneration
Ca	=	ambient CO2 concentration
Ci	=	intercellular CO2 concentration
Chl	=	chlorophyll
Car	=	carotenoid
DW	=	dry weight
FBPase	=	fructose 1,6-bisphosphate aldolase
FLBR	=	ferric leghemoglobin reductase
FS	=	full sunlight
FW	=	fresh weight
GAPDH	=	glyceraldehyde 3-phosphate dehydrogenase
Gs	=	stomatal conductance
Jmax	=	the maximum electron transport rate
Kc	=	Rubisco Michaelis-Menten constant for CO2
Ko	=	Rubisco Michaelis-Menten constant for O2
LA	=	leaf area
LMR	=	leaf mass ratio
PN	=	the net photosynthetic rate
PNmax	=	tthe maximum rate of light-saturated photosynthesis
PPFD	=	photosynthetic photon flux density
PGA	=	D-phosphoglyceric acid
PGK	=	3-Phosphoglycerate kinase
Rd	=	day respiration
Rubisco	=	ribulose 1,5-bisphosphae carboxylase/oxygenase
RMR	=	root mass ratio
RT-PCR	=	reverse transcription polymerase chain reaction
SLA	=	specific leaf area
SMR	=	shoot mass ratio
Γ*	=	the CO2 compensation point
Tr	=	transpiration rate
VCmax	=	the maximum rate of Rubisco carboxylation
WUE	=	water use efficiency

Author contributions

Conceptualization: K-AL, SYW. Formal analysis and investigation: K-AL, VK, Y-NK. Writing – original draft preparation: K-AL, VK. Writing – review and editing: Y-NK, YBL. Supervision: SYW. All authors read and approved the final manuscript.

Disclosure statement

No potential conflict of interest was reported by the authors.

Data availability statement

The original datasets presented in the study are available from the corresponding authors.

Supplementary material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/15592324.2023.2245625

Additional information

Funding

This work was supported by the 2023 Research Fund of the University of Seoul.