The role of NaHS pretreatment in improving salt stress resistance in foxtail millet seedlings: physiological and molecular mechanisms

ABSTRACT

Salt stress is a prevailing abiotic stress in nature, with soil salinization becoming a pressing issue worldwide. High soil salinity severely hampers plant growth and leads to reduced crop yields. Hydrogen sulfide (H₂S), a gas signal molecule, is known to be synthesized in plants exposed to abiotic stress, contributing to enhanced plant stress resistance. To investigate the impact of sodium hydrosulfide hydrate (NaHS, a H₂S donor) on millet’s response to salt stress, millet seedlings were subjected to pretreatment with 200 μM NaHS, followed by 100 mM NaCl stress under soil culture conditions. The growth, osmotic adjustment substances, antioxidant characteristics, membrane damage, and expression levels of related genes in millet seedlings were detected and analyzed. The results showed that NaHS pretreatment alleviated the inhibition of salt stress on the growth of foxtail millet seedlings, increased the proline content and antioxidant enzyme activities, as well as the expression levels of SiASR4, SiRPLK35 and SiHAK23 genes under salt stress. These findings demonstrated that NaHS pretreatment can enhance salt tolerance in foxtail millet seedlings by regulating the content of osmotic adjustment substances and antioxidant enzyme activity, reducing electrolyte permeability, and activating the expression of salt-resistant genes.

KEYWORDS:

• Salt stress
• H₂S
• seedling growth
• antioxidant enzyme activity
• gene expression

1. Introduction

Millet [Setaria italica (L.) Beauv.] is an annual herb plant widely planted in the temperate and tropical regions of Eurasia, with the upper and middle reaches of the Yellow River in China being the main cultivation areas. It is a typical environment-friendly crop with excellent characteristics such as drought resistance, salt tolerance, high water use efficiency, wide adaptability, tolerance to poor soil conditions, and strong yield stability.^1,2 Due to its rich nutritional and health values,^3,4 as well as the increasing demand for diversified dietary structures in contemporary society, there is a growing demand for foxtail millet. However, under the environment that crop yield and quality are affected by salt damage in China, this demand currently faces both opportunities and challenges.^5,6

Soil salinization and alkalization has become an increasingly serious global problem. According to authoritative statistics, approximately 9% to 34% of the global irrigated land has suffered from the adverse effects of salinization to varying degrees.^7,8 In China, the area of saline-alkali soil exceeds 99.13 million hm², accounting for 4.88% of the total available land.¹ Due to rapid population growth, improper irrigation practices, unreasonable use of fertilizers and pesticides, as well as global climate change, the rate of soil salinization has far exceeded expectations.⁹ Saline-alkali soils, rich in chloride and sulfate compounds, which cause salt stress on plants and severely affect their growth and development. Consequently, this leads to low seed germination rates, impaired antioxidant system, disrupted plant biochemical and molecular mechanisms, and ultimately resulting in a significant reduction in yield.^10,11 As a result, grain production in China is severely restricted, impeding sustainable agricultural development.¹²

Research has revealed that different plant species possess the ability to mitigate the detrimental effects of salt stress on crucial plant aspects such as osmotic adjustment substances, membrane permeability, chlorophyll levels, and antioxidant enzymes. This is achieved through regulating their own metabolites or exogenous substances.^13–16 Therefore, it is of great significance to further study the pathways and mechanisms of millet seedlings in response to salt stress and other signals.¹⁷

In recent years, one popular method to alleviate salt stress is the application of exogenous substances.¹⁸ As a gas signal molecule,¹⁹ H₂S plays an important role in plant growth and development as well as response to abiotic stresses.²⁰ Because H₂S and NaHS can form a dynamic equilibrium in plants, NaHS is often used as a donor of H₂S in biological research.¹⁹ Since 1990s, studies have shown that NaHS, as an exogenous regulator, can participate in the process of plant resistance to salt, cold and hypoxia. NaHS can alleviate oxidative stress in the cells by inhibiting the activity of glyceride oxidase in Arabidopsis thaliana. Moreover, it effectively modulates the accumulation of osmotic adjustment substances in cucumber seedlings under salt stress. In addition, NaHS can reduce the damage caused by salt stress through regulating antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) in rice seedlings²¹ and improve the tolerance of millet seedlings to chromium by synergizing with Ca²⁺.^22–24 Therefore, investigating the potential of the gaseous signaling molecule H₂S to alleviate salt stress in millet and understanding its underlying mitigation mechanisms holds significant guidance for enhancing millet yield and economic benefits in the future.

Abscisic acid-, stress-, and ripening (ASR)-induced proteins are a class of proteins widely found in higher plants, and are induced by many abiotic stresses such as early drying, high salt, low temperature, H₂O₂, and ABA.²⁵ The transcription level and protein level of tomato ASR1 were both up-regulated under drought and salt stress, and the transgenic tobacco heterologously expressing tomato ASR1 showed stronger drought tolerance and salt tolerance.^26,27 The KT/HAK/KUP (HAK) family is the most abundant potassium transporter family in plants and plays an important role in plant growth and environmental adaptation.^28,29 Lectin receptor-like protein kinases (LecRLKs) are the largest gene family in plants and play an important role in regulating plant growth and development, stress and disease resistance.²⁶ A large number of studies have shown that LecRLKs expression is significantly up-regulated under salt stress conditions, which can reduce the accumulation of ROS to improve the salt tolerance of plants.³⁰ In previous studies, the expression of these genes was upregulated in millet under salt stress,^31,32 however, the effect of NaHS pretreatment on the expression of these genes in millet seedlings under salt stress is still unknown.

In order to study the effects of exogenous H₂S on the growth and physiology of millet seedlings under salt stress, the growth, membrane damage, antioxidant capacity and osmotic adjustment substances of millet seedlings under salt stress were determined. The aim of this study was to reveal the physiological and molecular mechanisms of exogenous H₂S in improving salt tolerance of millet and provide theoretical basis for breeding salt-tolerant millet germplasm, cultivating millet in saline-alkali soil and improving salt tolerance of millet.

2. Materials and methods

2.1. Plant material and plant treatment

In this study, ‘Jingu 21’ was used as the experimental material. The seeds of Jingu 21 were provided by Shanxi Agricultural University.

Before the experiment, seeds with full and consistent particles were selected and disinfected with 75% ethanol solution for 1 min, rinsed with ultra-pure water for 3 times, soaked in darkness for 24 h under 25°C, seeds were evenly seeded in a tray containing seedling substrate, with 25–30 seeds in each hole. After seeding, seeds were placed in an incubator with 25°C, 60% relative humidity and darkness for 48 h. After the seed germ was exposed, the incubator was set at 16 h light/25°C and 8 h darkness/23°C for normal growth. When the seedlings have grown to two leaves, the seedlings can be treated, the NaHS solution prepared with ultra-pure water is sprayed on the leaves until the solution is fully hung on the leaves, once in the morning and once in the evening, and treated for three days. NaCl solution was prepared with ultra-pure water and the seedlings were subjected to salt stress by watering. The control group was watered with ultra-pure water and samples were taken for testing of various indexes. After 7 days of treatment, leaf samples of different treatments were collected, some fresh samples were used for plant height and fresh weight determination, some fresh samples were used for phenotypic analysis (10 millet seedlings per treatment were taken for three biological replicates for phenotypic analysis), and some samples were rapidly frozen with liquid nitrogen (frozen samples were stored in a −80° refrigerator) for physiological determination and gene expression analysis.

2.2. Determination of endogenous H₂S

After different treatments, 0.2 g millet seedling leaves were ground with 2 ml 50 mmol/L PBS (containing 0.1 mol/L EDTA and 0.2 mol/L ascorbic acid, pH 6.8), centrifuged at 10,000 g for 10 min at 4°C. Put the supernatant into a small triangular flask, put 1.5 mL EP tube added with 500 μl of 1% ZnAc into the small triangular flask, and then add 1 ml of 1 mol/L HCI to start the reaction: quickly seal the small triangular flask, place it at room temperature for 30 min, take out the EP tube in the small triangular flask, add 200 μL of 20 mmol NN-p-dimethyl-phenylenediamine and 200 μl of 30 mmol FeCl, shake it up, place it in the dark at room temperature for 15 min, and determine the absorbance value at 667 nm wavelength. Standard curve made with NaHS of different concentration.³³

2.3. Determination of soluble sugar content

Soluble sugar was determined by Bates method.³⁴ Weigh 1 g of anthrone and dissolve it in 1000 mL of dilute sulfuric acid (prepare by diluting 760 mL of concentrated sulfuric acid with distilled water to a volume of 1000 mL, with a relative density of 1.84), Transfer the solution to a brown bottle and keep it for immediate use. Plant leaves were oven dried at 110°C for 5 min and then adjusted to 70°C overnight. Dry leaves were ground into powder, 50 mg of the sample were poured it into a 10 mL graduated centrifuge tube, add 4 mL of 80% ethanol, place it in a water bath at 80°C and stir continuously for 40 min, centrifuge, collect the supernatant, add 2 mL of 80% ethanol to the residue and extract twice, and combine the supernatant. Add 10 mg of activated carbon to the supernatant, decolorize at 80°C for 30 min, dilute to 10 mL with 80% ethanol, and take the filtrate for determination after filtration. The sugar content in the extract was determined by the standard curve.

2.4. Determination of proline content

Proline content was determined according to the method of Shams.³⁵ Weigh and cut 0.2 g of fresh millet leaves, add 5 mL of 3% sulfosalicylic acid solution, extract in boiling water bath for 10 min, after cooling, absorb 2 mL of supernatant, add 2 mL of glacial acetic acid and 2 mL of 2.5% acidic ninhydrin color developing solution, react in boiling water bath for 1 h, after cooling, add 4 mL of toluene solution, fully oscillate to extract red substance, stand still for stratification, absorb the upper toluene layer, compare the color under wavelength 520 nm, check the proline content corresponding to the standard curve, and calculate the proline content in millet leaves.

2.5. Determination of antioxidant enzyme activity

Accurately weigh 1 g of leaves to be tested and put them into a mortar, add 5 mL of precooled phosphate buffer solution with pH 7.8, grind them into homogenate in ice bath, transfer them into a 10 mL centrifuge tube, centrifuge at 12,000 r/min⁻¹ for 20 min at 4°C, and collect the supernatant as the crude extract of enzyme. Photochemical reduction method of nitrogen blue tetrazolium is used to determine SOD,³⁵ add 1.5 mL phosphate buffer solution, 0.3 mL methionine solution, 0.3 mL NBT nitroblue tetrazolium solution, 0.3 mL EDTA-Na₂ solution, 0.3 mL riboflavin (200 μmol/L⁻¹), 0.1 mL enzyme solution, and 0.2 mL distilled water into a centrifuge tube in turn. After completion of the reaction, the absorbance value was measured at a wavelength of 560 nm. SOD activity was calculated according to the formula. POD activity was determined using the guaiacol method.³⁶ Pipette 20 μL of enzyme extract and 3 mL of POD reaction solution into a cuvette, and use the buffer solution used for preparing enzyme solution as blank control to determine the absorbance value at 470 nm wavelength. Read every 30 s, and use the absorbance change value per minute to express the enzyme activity. Determination of CAT activity using visible light colorimetry, pipette 0.1 mL of enzyme extract and 2.9 mL of CAT reaction solution into a cuvette, measure the absorbance value at the wavelength of 240 nm, read it every 10 s, and express the enzyme activity with the absorbance change value per minute.

2.6. Determination of reactive oxygen species (ROS)

The production rate of superoxide anion radical (O₂.⁻) and that content of hydrogen peroxide (H₂O₂) were determined by Ingler method.^37,38 Take 0.5 mL of the supernatant, add 1.5 mL of 65 mM phosphate buffer (pH 7.8) and 0.5 mL of 10 mM hydroxylamine hydrochloride, mix well, and perform a thermostatic water bath at 25°C for 20 min, then add 2 mL of 17 mM sulfanilic acid and 2 mL of 7 mM α-naphthylamine, perform a thermostatic water bath at 30°C for reaction for 30 min, measure the absorbance value at the wavelength of 530 nm, and check the standard curve to obtain the production rate of O₂.⁻, production rate (nmol min⁻¹ g⁻¹ FW) = 2 × (NO₂⁻) × V × N × W⁻¹ × T⁻¹. V: Volume of reaction solution (mL); N: dilution factor; W: fresh weight of sample (g); T: reaction time (min); NO₂⁻: NO₂⁻ concentration (nmol/mL⁻¹). Weigh about 0.1 g tissue for ice bath homogenate, take the supernatant and place it on ice for detection, take 200 μL of reaction solution and place it in a 96-well plate, measure the absorbance at 415 nm, and calculate the content of hydrogen peroxide according to the formula.

2.7. Determination of malondialdehyde (MDA) content and electrolyte leakage (EL)

According to Bollivar’s description, the content of MDA in foxtail millet leaves was determined.³⁹

Weigh 0.5 g leaves, add 2.5 mL PBS buffer solution, grind and homogenize in ice bath, add 2.5 mL PBS, mix well, centrifuge at 10,000 r/min⁻¹ for 15 min at 4°C, and the supernatant is crude enzyme extract. Take 1 mL of enzyme extract, add 4 mL of 20% trichloroacetic acid (TCA) solution (containing 0.5% TBA), put it in boiling water for 20 min, cool it with ice water, centrifuge it at 4000 r/min⁻¹ for 10 min, take the supernatant to determine the absorbance value at 450 nm, 532 nm and 600 nm, and calculate the MDA content. The relative conductivity method was used to determine the electrolyte leakage of leaves.²¹ Take 10 leaves with equal length and width for each treatment, and three repetitions were conducted for each treatment; Use 10 mL distilled water bubble, put it in a shaker at 28°C for 2 h, measure the conductivity EC1 with a conductivity meter at this time, cool it in a boiling water bath at 100°C for 15 min, and measure the conductivity EC2. Calculation formula: electrolyte permeability (%) = EC1/EC2 × 100%.

2.8. Total RNA extraction and qRT-PCR detection

In order to detect the gene expression level, the leaves of foxtail millet seedlings of different treatment groups were put into liquid nitrogen and fully ground, and the total RNA was extracted by RNA extraction kit (Tianmo Biological, used in combination with TRIZOL). RNA concentration was determined by measuring optical density at 260 nm using ultramicro high precision ultraviolet spectrophotometry (ND2000, USA), while RNA integrity was tested by 1% agarose gel electrophoresis. Reverse transcription kit (TaKaRa) was used to obtain cDNA, and the specific operation method was carried out according to the instructions. The PCR products were labeled with TB Green® Premix Ex Taq^TM 11 (Tli RNaseH Plus) fluorescence quantitation kit (Takara). The analysis was performed by Applied Biosystems 7500 Fast Real-Time PCR System and StepOnePlus Real-Time PCR System. Primers used for qRT-PCR are listed in Table 1.

Table 1. The sequences of genes and their primers used for qRT-PCR.

Gene Name	Forward Primer Sequence (5‘−3’)	Reverse Primer Sequence (5‘−3’)
SiHAK23	CCCCCACATCTTCTCCCACT	CTTGTACCCGTACCTCGCCA
SiRLK35	AAATAGTTGGGTAGACGAGG	TACGCAGATGATTGACAGAT
SiASR4	ACCACCACCACGACAAGAACAAG	CTGCGACGGCACCGACCT

2.9. Data statistics and analysis

The experimental data were sorted and calculated by Microsoft Excel 2020 software, and one-way ANOVA was performed by IBM SPSS Statistics 27 software, with P <.05 as the standard to test the significance of the difference. Figures were drawn with Origin 64. Each datum is represented as the mean standard deviation of 3 replicates.

3. Results

3.1. Effects of different concentrations of NaHS on the growth of millet seedlings under salt stress

Salt stress will affect the carbon assimilation of plants, resulting in reduced plant growth and development. As can be seen from Figure 1a, the application of various concentrations (25, 50, 100, and 200 μM) of sodium hydrosulfide led to a noticeable improvement in plant height compared to the 100 mM NaCl treatment group, demonstrating a mitigating effect of NaHS. Notably, the 200 μM NaHS treatment group exhibited the most remarkable improvement, displaying the highest plant height among all treatment groups. In conclusion, 200 μM NaHS could alleviate the effect of salt stress on plant height of millet seedlings. As shown in Figure 1b, compared with the control, salt stress significantly reduced the fresh weight of millet seedling leaves, indicating that salt stress did harm to the growth of millet seedlings, but the fresh weight of millet seedlings increased under treatment with different NaHS concentrations. As shown in Figure 1b, 200 μM NaHS significantly increased the fresh weight of millet leaves under salt stress. From Figures 1a & 1b, it can be seen that 200 μM NaHS pretreatment can notably increase the plant and leaf fresh weight of millet seedlings under salt stress. Therefore, we selected 200 μM as the final treatment concentration in the subsequent experiments. The growth state of plants is the most intuitive external representation, and plants will show different external forms under different environmental conditions. According to the observation and comparison of Figure 1c, it can be seen that: the millet seedlings in control group were in good growth condition, the leaves were stretched, emerald green, and the leaf margins were smooth and complete; after treatment with 100 mM NaCl, seedlings showed the symptoms of salt stress. The growth quantity and growth rate of millet seedlings decreased, leading to the death of some seedlings. The leaves became shriveled and withered, and dark brown spots and burned leaf tip and edge appeared on the leaves, and there was evidence of deciduous leaves. Compared with the salt stress group, the 200 μM NaHS pretreated group showed a tendency to reduce the salt stress symptoms, the growth volume and growth rate of millet seedlings increased, which led to an alleviation of chlorosis, leaf shrinkage, wilting, and spot symptoms. Thereby, the frequency of leaf drop was significantly reduced.

Figure 1. Effects of different concentrations of NaHS on the growth of millet seedlings under salt stress. a: plant height; b: leaf fresh weight, c: growth phenotypes. Each value is the mean of three biological replicates, with different lowercase letters indicating significant differences between treatments (P＜.05). 1-C shows the phenotype of different groups after 7 days of treatments.

3.2. Effects of NaHS on endogenous hydrogen sulfide content in leaves of millet seedlings under salt stress

Compared with CK, an advance of endogenous H₂S content was observed in seedlings under salt stress. Moreover, the results showed that the endogenous H₂S content in millet seedling leaves increased by 33.7% with pretreatment of 200 μM NaHS compared with the group of 100 mM NaCl. (Figure 2).

Figure 2. Effect of NaHS on endogenous hydrogen sulfide content of millet seedlings under salt stress. Each value is the mean of three biological replicates, with different lowercase letters indicating significant differences between treatments (P＜.05).

3.3. Effect of NaHS on chlorophyll content of millet seedling leaves under salt stress

As an important photosynthetic pigment, chlorophyll participates in the uptake, transmission, and transformation of light energy in the process of photosynthesis in higher plants. The results can be seen in Figure 3a, the mean concentration of chlorophyll a in the control group (CK) was 3.15 mg/L, while the average chlorophyll a content in the treatment group exposed to 100 mM NaCl was 2.41 mg/L. Notably, in the group treated with 200 µM NaHS +100 mM NaCl, the mean chlorophyll a content was 2.79 mg/L. As can be seen from Figure 3b, the average content of chlorophyll b was 1.21 mg/L, 0.83 mg/L, and 0.75 mg/L in control group, 100 mM NaCl treatment group and 200 µM NaHS +100 mM NaCl treatment group, respectively. Under salt stress, chlorophyll b content of millet seedlings decreased, but NaHS pretreatment did not alleviate the decrease of chlorophyll b content caused by salt stress. As evidenced by Figure 3c, the total chlorophyll content of millet seedling leaves in CK was 4.4 mg/L; Compared with CK, the total chlorophyll content was 2.2 mg/L under 100 mM NaCl treatment, which was significantly decreased by 49.4%; Compared with 100 mM NaCl treatment, the total chlorophyll content of millet seedling leaves increased by 1.6 times under 200 µM NaHS +100 mM NaCl treatment.

Figure 3. Effects of NaHS on chlorophyll a content and chlorophyll b content of millet seedlings under salt stress. a: chlorophyll a content; b: chlorophyll b content; c: chlorophyll a + b content. Each value is the mean of three biological replicates, with different lowercase letters indicating significant differences between treatments (P＜.05).

3.4. Effects of NaHS on leaf membrane damage of millet seedlings under salt stress

In order to study the effects of exogenous H₂S on MDA and EL in millet seedling leaves under salt stress, MDA content and electrolyte permeability of three groups of millet seedling leaves were determined. Compared with CK, the content of MDA in the leaves of foxtail millet seedlings treated with 100 mM NaCl was significantly higher than that of CK, which was 1.5 times of that of CK. The MDA content of millet seedling leaves treated with 200 μM NaHS +100 mM NaCl increased by 24% compared with CK, and the MDA content of millet seedling leaves treated with 200 μM NaHS +100 mM NaCl decreased significantly by 13.3% compared with 100 mM NaCl group (Figure 4a). Compared with CK, the relative electrical conductivity of foxtail millet seedlings treated with 100 mM NaCl increased by 47%. Compared with the treatment of 100 mM NaCl, the relative electrical conductivity of foxtail millet seedlings treated with 200 μM NaHS +100 mM NaCl decreased significantly by 23% (Figure 4b).

Figure 4. Effect of NaHS on the damage degree of leaf membrane of millet seedlings under salt stress. a: content of MDA; b: EL. Each value is the mean of three biological replicates, with different lowercase letters indicating significant differences between treatments (P＜.05).

3.5. Effects of NaHS on active oxygen species in millet seedlings leaves under salt stress

Reactive oxygen species (ROS) are chemically reactive substances with strong oxidative capacity and are natural by-products of the normal metabolism of oxygen. The degree of membrane lipid peroxidation of millet seedlings under salt stress was determined by measuring the production rate of O₂.⁻ and the content of H₂O₂ in the leaves of millet seedlings. Compared with CK, 100 mM NaCl treatment increased the production rate of superoxide anion-free radicals by 40.4%. Compared with 100 mM NaCl treatment, 200 μM NaHS +100 mM NaCl treatment decreased the rate of superoxide anion radical production in millet seedling leaves by 17.6% (Figure 5a). The H₂O₂ content in the leaves of foxtail millet seedlings of control group was the lowest (8.4 mmol/g). Compared with CK, the H₂O₂ content of 100 mM NaCl treatment was significantly increased to 16.1 mmol/g, which was 1.9 times higher than that of CK. The H₂O₂ content of 200 μM NaHS +100 mM NaCl treatment group was higher than CK, but lower than 100 mM NaCl, which was 10.80967 mmol/g, indicating that 200 μM NaHS significantly alleviated the increase of H₂O₂ content caused by salt stress (Figure 5b).

Figure 5. Effects of NaHS on ROS in millet seedlings under salt stress. a: rate of oxygen radical production; b: H₂O₂ content. Each value is the mean of three biological replicates, with different lowercase letters indicating significant differences between treatments (P＜.05).

3.6. Effects of NaHS on antioxidant enzyme activities in millet seedlings leaves under salt stress

The activity of antioxidant enzymes in plants is an effective way to improve plant stress resistance,⁴⁰ and the activities of SOD, POD, and CAT in millet seedlings under three different treatments were determined. As shown in Figure 6a–c, compared with CK, the activities of SOD, POD, and CAT decreased by 44.5%, 18.4%, and 31.6% under 100 mM NaCl treatment, respectively. SOD, POD, and CAT activities of seedlings under 200 μM NaHS +100 mM NaCl treatment increased by 1.5 times, 1.3 times and 1.4 times, respectively, compared with 100 mM NaCl treatment, indicating that 200 μM NaHS could increase SOD, POD, and CAT activities under salt stress (Figure 6a–c).

Figure 6. Effect of NaHS on antioxidant enzyme activity of millet seedlings under salt stress. a: SOD activity; b: POD activity; c: CAT activity. Each value is the mean of three biological replicates, with different lowercase letters indicating significant differences between treatments (P＜.05).

3.7. Effects of NaHS on osmotic adjustment substances in leaves of millet seedlings under salt stress

Soluble sugar and proline content are important indexes for plants to resist abiotic stress. According to Figure 7a, compared with CK, 100 mM NaCl treatment decreased the soluble sugar content in the leaves of millet seedlings, and the soluble sugar content in the leaves of millet seedlings decreased significantly after spraying 200 μM NaHS. It can be seen from Figure 7b that compared with CK, both of the Pro content of millet seedling leaves treated with 100 mM NaCl and 200 μM NaHS +100 mM NaCl were significantly increased. The Pro content of millet seedling leaves treated with 100 mM NaCl was significantly lower than that of 200 μM NaHS +100 mM NaCl millet seedling leaves.

Figure 7. Effect of NaHS on osmotic regulatory substances in millet seedlings leaves under salt stress. a: soluble sugar content; b: proline content. Each value is the mean of three biological replicates, with different lowercase letters indicating significant differences between treatments (P＜.05).

3.8. Effects of NaHS on the expression of related genes in leaves of millet seedlings under salt stress

To investigate the involvement of related genes in alleviating salt stress, we conducted real-time quantitative PCR verification on SiASR4, SiRPLK35, and SiHAK23. We measured the gene expression changes of SiASR4, SiRPLK35, and SiHAK23 in millet under different treatment conditions. The results demonstrated that under 100 mM NaCl treatment and 200 μM NaHS +100 mM NaCl treatment, the expression levels of SiASR4 and SiRPLK35 genes in foxtail millet seedling leaves increased by 39.7%, 59.7%, 12.8%, and 53.4%, respectively, compared to CK. Furthermore, compared to CK, the expression level of the SiHAK23 gene in millet seedling leaves decreased by 19.1% under 100 mM NaCl treatment and increased by 41.4% under 200 μM NaHS +100 mM NaCl treatment.

4. Discussion

Studies have found that the plants growth and physiology were significantly affected by the content of salt ions in soil, and excessive salt content will disturb the metabolism of plants.⁴¹ Therefore, the study of the impact of salt stress on plant phenotype has always been one of the most basic research fields of plant stress physiology. The research of Mukami et al. showed that under the condition of salt stress, the growth of plants was severely inhibited, resulting in significant changes in the morphology and structure of the seedling height, leaf, and root length, which was manifested as a slowdown in the growth rate of seedling height, shrinkage, and yellowing of the leaves.⁴² In severe cases, the leaves will wilt and wither, and the growth of the root system will be hindered, which may even lead to premature aging or death of the plant. The researches of Haider et al. and Liu et al. showed that under the condition of salt stress, the growth physiological indicators of plants such as growth height, leaf number, root biomass, root-shoot ratio, and aboveground biomass all showed a downward trend.^43,44 In this study, millet seedlings in 100 mM NaCl solution treatment exhibited reduced growth, resulting in plant stunting and the occurrence of withered leaves (Figure 1). The pretreatment of 200 μM NaHS increased the plant height of millet seedlings under salt stress. Exogenously applied NaHS effectively alleviated the damage of salt stress on millet photosynthetic system of millet, leading to increased chlorophyll content in leaves and enhanced accumulation of dry matter. Consequently, the plant height and fresh weight of millet seedlings subjected to salt stress were significantly augmented (Figure 1).

As an important photosynthetic pigment, chlorophyll participates in the uptake, transmission and conversion of light energy in the photosynthesis process of higher plants, and the strength of plant photosynthesis is closely related to the content of chlorophyll.⁴⁵ In this study, it can be seen from Figure 3 that the content of chlorophyll a and chlorophyll b in millet seedlings decreased under salt stress, which is consistent with the research results of Zai et al.⁴⁶ In our results, the content of chlorophyll a in seedlings sprayed with 200 μM NaHS increased by 15.77% compared with salt-treatment group, while the content of chlorophyll b in seedlings sprayed with 200 μM NaHS decreased by 9.64% compared with salt-treatment group. Nevertheless, our analysis of the total chlorophyll content, comprising chlorophyll a and chlorophyll b, unequivocally demonstrated that NaHS pretreatment significantly enhanced the overall chlorophyll levels in millet seedlings under salt stress (Figure 3), indicating that 200 μM NaHS could inhibit the reduction of chlorophyll under salt stress.

Raju’s et al. research showed that NaHS significantly alleviated the effect of salt stress on the relative conductivity of sweet-scented clover seedling leaves, and exogenous H₂S mitigated the effects of salt stress on plants by reducing the permeability of cell membranes damage.³⁸ The cell membrane is the interface and barrier between living cells and the environment. The impact of various adverse environments on cells often acts on the cell membrane first, MDA is the product of membrane lipid peroxidation. Salt stress leads to excessive accumulation of MDA, leading to the damage of cell membrane system and increment of electrolyte permeability.^47,48 Generally, the more serious the damage to plants, the greater the relative conductivity of leaves, otherwise the smaller it is. Research has proved that the MDA content of tomato seedlings treated with NaHS decreased under salt stress.⁴⁹ NaHS also has a significant effect on the decrease of malondialdehyde in naked oat leaves under salt stress.⁴⁶ In this study, the content of malondialdehyde in the leaves of millet seedlings significantly increased by NaCl solution treatment, but decreased with applying 200 μM NaHS, which proved that 200 μM NaHS could alleviate the damage caused by salt stress to the leaves of millet seedlings. After NaCl solution treatment, the cellular water content of millet seedling leaves was depleted, resulting in the disruption of cell membrane structure and increased membrane permeability. But the value decreased in 200 μM NaHS pretreatment group, which indicated that 200 μM NaHS could mitigate the deleterious effects caused by salt stress on millet seedling leaves (Figure 4).

As reactive oxygen species, O₂.⁻and H₂O₂ can participate in regulating the response of plants to adversity stress, but excessive accumulation of ROS will damage biological macromolecules and cause oxidative damage to plant cell plasma membrane.⁵⁰ Zhao et al. showed that salt stress would lead to the accumulation of reactive oxygen species in plants.⁵¹ Raju et al. studied the effect of NaHS on tomato growth physiology under salt stress and found that O₂.⁻ and H₂O₂ content increased significantly under NaCl stress, while decreased dramatically under NaHS pretreatment.³⁸ Results showed that the accumulation of O₂.⁻ and H₂O₂ in rice seedling leaves increased under the treatment of 100 mM NaCl, while exogenous application of H₂S could significantly inhibit the accumulation of O₂.⁻and H₂O₂ in leaves induced by salt stress.⁵² In this study, as shown in Figure 5b, compared with CK group, the production rate of superoxide anion radical in seedling leaves was greatly increased under salt stress, and markedly reduced after exogenous use of hydrogen sulfide, which was consistent with previous papers.⁵² As evident from Figure 5b, H₂O₂ content of millet seedlings increased noticeably under salt stress, and a considerable decline was observed in 200 μM NaHS pretreatment group, which was consistent with the research of A Raza et al.⁵³ This indicates that the oxidative damage was occurred in seedlings under salt stress, and the toxicity caused by salt stress could be weakened by the positive function of NaHS.

The activity of antioxidant enzymes in plants indicates the degree of oxidative damage, which is an important index to study the response of plants to abiotic stress.⁵² When plants are exposed to a high-salt environment, the dynamic balance between generation and consumption of ROS in plants will be broken, which will lead to a reduced activity of antioxidant enzymes, resulting in serious oxidative damage to plants.⁵⁴ The research of Liang et al showed that when salt stress intensified, the activity of antioxidant enzymes in plant leaves decreased and the membrane lipid peroxidation strengthened, resulting in plant damage.⁵⁴ There are also studies on rice seedlings under the condition of salt stress,⁵⁵ the activities of POD and CAT in the seedlings decreased obviously. In this study, the activities of SOD, POD, and CAT in leaves of millet seedlings were all decreased after being treated with 100 mM NaCl, on the contrary, all of them raised in 200 μM NaHS +100 mM NaCl group compared with separate salt treatment group. The results proved that 200 μM NaHS treatment could effectively alleviate the oxidative damage to millet seedlings caused by salt stress and reduce the accumulation of reactive oxygen species through enhancing the activities of antioxidant enzymes (Figure 6).

The accumulation of free proline and soluble sugar in plants is one of the important mechanisms to resist abiotic stress.⁵⁶ In the study of salt stress-induced accumulation of soluble sugar content in eggplant, it was pointed out that salt stress would induce the accumulation of soluble sugar content in eggplant, and spraying H₂S on leaves reduced the accumulation of soluble sugar under salt stress,⁵⁰ which were consistent with our results (Figure 7a). Research showed that proline content of wheat seedlings was greatly increased by high temperature and drought stress, but the increase of proline content was reduced by NaHS treatment, which indicated that H₂S played a positive role in reducing the harm of environmental stress to wheat seedlings.⁵⁷ Compared with the control group, the proline content in the leaves of millet seedlings treated with 100 mM NaCl increased substantially, while the proline content in the millet pretreated with 200 μM NaHS decreased after salt stress (Figure 7b), and the damage degree was reduced, which was basically consistent with the experimental results of Wu et al.⁵⁷

Under salt stress, Na⁺ was markedly reduced and proline content was significantly increased in transgenic tobacco compared to wild-type tobacco, indicating that tomato ASR1 plays an important role in osmotic and ionic stress.⁵⁸ SiASR4 in foxtail millet was proved to be involved in plant responses to abiotic stress through ABA signaling pathway, and played an important role in plant drought resistance and salt stress. The results showed that the heterologous expression of SiASR4 in Arabidopsis thaliana could improve the tolerance of transgenic plants to drought and salt stress, and the accumulation of reactive oxygen species in transgenic Arabidopsis thaliana was reduced under drought and salt stress. In Arabidopsis thaliana and rice, the expression of HAKs was significantly increased after salt stress, which may be involved in maintaining K⁺/Na⁺ balance in plants to cope with high salt stress.⁵⁹ The expression levels of SiHAK23 and SiHAK3 in foxtail millet under high salt stress were about 9 times and about 4 times higher than those in the control (Figure 8). The change of SiHAKs gene expression level indicated that some SiHAKs may be involved in the K⁺ uptake process in response to salt stress.^40,56 LecRLKs (Lectin receptor-like protein kinases) are the largest gene family in plants and play an important role in regulating plant growth and development, stress resistance and disease resistance.⁶⁰ A large number of studies have shown that LecRLKs expression is significantly up-regulated under salt stress conditions, which can reduce the accumulation of ROS to improve the salt tolerance of plants. PnRLK-1 is a cytoplasmic receptor-like protein kinase in Antarctic mosses. Under salt treatment, PnRLK-1 can up-regulate the expression of a series of ROS scavenging genes such as AtAPX1, AtZAT10, and AtCAT1, thereby reducing ROS accumulation and improving plant tolerance to salt stress.⁶⁰ In this study, the expression levels of SiASR4, SiRPLK35, and SiHAK23 genes in millet seedling leaves under salt stress were significantly increased after exogenous application of NaHS. We hypothesized that NaHS pretreatment could up-regulate the expression levels of SiASR4, SiHAK23, and SiRPLK35 genes in the leaves of foxtail millet seedlings, and then activate a series of antioxidant enzyme activities to reduce the accumulation of reactive oxygen species in seedlings, while maintaining the balance of K⁺/Na⁺ in plants, and finally improve the ability of foxtail millet seedlings to resist salt stress and enhance their salt tolerance (Figure 9).

Figure 8. Effects of NaHS on the expression of genes SiASR4, SiHAK23 and SiRPLK35 in leaves of millet seedlings under salt stress. Each value is the mean of three biological replicates, with different lowercase letters indicating significant differences between treatments (P＜.05).

Figure 9. The model of NaHS alleviating salt stress in millet seedlings. The model revealed how NaHS mitigated the damage of millet seedlings under salt stress. Under salt stress, on the one hand, NaHS pretreatment in advance increased the salt tolerance of millet seedlings by up-regulating the expression of SiASR4, SiHAK23, and SiRPLK35 genes, on the other hand, NaHS pretreatment significantly increased the activities of antioxidant enzymes SOD, POD and CAT, and decreased the content of ROS. In this model, the green arrows represent the trend of indicator changes in the salt-treated group compared to the control. The orange arrows represent the trend of indicator changes in the NaHS pre-treated group compared to the salt-treated group.

5. Conclusion

Our research showed that salt stress had significant adverse effects on the growth and physiology of millet seedlings. Exogenous application of 200 μM NaHS in advance could activate the expression levels of SiASR4, SiRPLK35, and SiHAK23, improve the growth and photosynthetic capacity of millet seedlings under salt stress, increase the activity of antioxidant enzymes, reduce the accumulation of reactive oxygen species, and actively regulate osmotic substances, thus enhancing the salt tolerance of millet under NaCl stress. The results showed that 200 μM NaHS could significantly alleviate the toxicity of NaCl stress on millet seedlings. This study provided a theoretical framework for the cultivation of salt-tolerant millet seedlings. We believe that it holds significant guidance for the scientific utilization of saline-alkali soil, enhancing grain yield, and improving the ecological environment.

Authors contribution

D.H. designed the entire project and X.Z. wrote the manuscript. Y.D. and M.Y. performed experiment and data analysis. A.W. revised article. All authors read and approved the manuscript.

Acknowledgments

We appreciate Dr. Junqing Gong (Beijing Forestry University) for her valuable suggestions on the structure of our paper and guidance on some experimental procedures.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This work was supported by the Basic Research Program of Shanxi Province under Grant [number 202203021222242]; the Critical Talent Workstation Project of Taiyuan under Grant [number TYSGJ202201]; and the Scientific and Technological Innovation Project of University in Shanxi Province under Grant [No.2019L0802].