PEGylation of human interferon-α2b with modified amino acids increases circulation half-life and antiproliferative activity

Abstract

Interferon-α2b (IFN-α2b) is used as a therapeutic agent against various types of cancer. In the current research, modified forms of human INF-α2b were produced to investigate the effect of amino acid substitutions on binding to the interferon receptor and antiproliferative activity. The resulting modified human IFN-α2b proteins were PEGylated to increase their in vivo circulation half-life. N-terminal PEGylation was performed using mPEG-propionaldehyde succinate (20 and 40 kDa). As a result of these modifications, IFN-α2b with modification R(23)H achieved IC₅₀ at 0.062 ng as compared to wild type IFN-α2b (0.125 ng). PEGylation of IFN-α2b and its modified forms resulted in an increase in hydrodynamic volume and serum retention time (up to 62 h) compared to wild type IFN-α2b (4 h). However, the antiproliferative activities of PEGylated IFN against HepG2 cell line were decreased (up to 4.7%) with an increase in PEGylated IFN-α2b size as compared to the wild type.

KEYWORDS:

• IFN-α2b
• polyethylene glycol
• PEGylation
• site-directed modification
• molecular docking

1. Introduction

Interferons are class II α-helical cytokine proteins secreted by lymphocytes, leukocytes, and fibroblasts that can be used in anticancer and antiviral treatments [1]. Interferons are categorized into Type I (including IFN-α, IFN-β, IFN-κ, IFN-ω, and IFN-ϵ), Type II (IFN-γ), or Type III (encompassing IFN-λ1, IFN-λ2, IFN-λ3, and IFN-λ4) based on their antigenic properties and their biological and chemical characteristics [2,3]. Type I interferons were initially discovered some sixty years ago as important factors behind viral interference. They are secreted by cells infected with virus and help to induce an antiviral state in bacterially and virally infected cells. They also prevent cell propagation and trigger the innate and adaptive immune systems. The IFN-α receptor complex, composed of IFNAR1 and IFNAR2, serves as the binding site for all 17 subtypes of Type I interferons. When this receptor complex is activated, it triggers the expression of IFN-stimulated genes, which subsequently results in the suppression of virus transcription and translation, leading to an immediate decrease in viral levels [4,5].

The United States Food and Drug Administration approved the use of interferons after recognizing their cancer and antiviral medical potential, the schematic presentation of interferon signaling and role in cancer (Figure 1) [6]. For oncological applications, Human IFN-α2b (Intron A, Schering-Plough) and human IFN-α2a (Roferon-A, Hoffmann-La Roche) have been approved so far. IFN-α2b finds its primary application in the treatment of conditions such as hairy cell leukemia, Kaposi's sarcoma associated with AIDS, melanoma, renal cell carcinoma, follicular lymphoma, and chronic myelogenous leukemia [7,8].

Figure 1. Interferon signaling and role in cancer, reproduced with permission from Ref. [6], under the terms of the Creative Commons CC BY license, 2020.

The interferon family members share a significant level of structural resemblance while simultaneously displaying distinct biological characteristics with notable specificity. Even minor changes in their structures can have a significant impact on their potency, receptor subunit affinity, and selectivity toward target cells [9,10]. Recombinant DNA technology plays an important role in production and modifying interferon proteins. In 1981, the technology was used to generate the first IFN analogue, IFN-α1/α2 [11]. Since then, many additional interferon protein analogues and mutants have been developed, expressed, and investigated. These advances have led to emergence of new interferon analogues and mutants with distinct biological properties and new potential therapeutic uses. Studies on the structure–function relationships of interferons have highlighted particular fragments on interferon genes that seem critical for interferon activity [12,13]. The region known as loop AB in both IFN-beta and IFN-alpha has been recognized as a “hotspot” for biological activity and receptor binding. For example, in previous work it was shown that alteration of amino acids at positions 27, 35 and 123 caused a reduction in the antiviral activity of interferon alpha [14]. In addition, several studies have indicated that removing the eleven C-terminal residues caused a reduction in receptor binding and a decline in biological function. Another study established that substituting a single amino acid at 3 different positions of human IFN-α2 with the IFN-α1 counterparts can improve its biological activity up to 400 times [15]. Generation of consensus interferon by merging the conserved amino acids among IFN alpha subtypes resulted in 10-fold more antiviral potency than natural IFN alpha [16,17]. Furthermore, a DNA shuffling strategy was also used to produce IFN alpha that resulted in 180 times better efficacy relative to natural IFN-α [18].

Unfortunately, the therapeutic potential of native cytokines is frequently compromised by less efficacy, high toxicity, low stability, short plasma half-life, low solubility, immunogenicity and fast renal clearance [19,20]. Recently, to address these limitations, a new class of biomolecules-second generation biomolecules-has been developed through posttranslational modification of native proteins. Examples of these biomolecules include Fc fusion proteins, which have increased serum half-life [21,22], and glycosylated proteins, which have enhanced biological activities. Another promising approach to overcoming these drawbacks is through protein-polymer conjugation. This strategy leads to improved pharmacokinetics, increased in vivo plasma half-life, reduced immunogenicity, decreased renal clearance rate, enhanced bioavailability, and increased drug targeting specificity. Various studies have demonstrated that subtle change in amino acid sequence of IFN-α2b could lead to a significant modification in receptor binding affinity, specificity, and potency [23–25].

Thus, we performed this research to develop modified human IFN-α2b forms with enhanced expression efficacy, improved potency and other novel drug attributes. We have generated 4 modified forms of human IFN-α2b by replacing amino acids at positions 22, 23 and 34 with other amino acids and PEGylating the resulting modified forms. Our study identified a novel IFN-α2b modified form of IFN-2b with significantly increased antiproliferative activity, as well as improved in vivo serum half-life.

2. Materials and methods

2.1. Materials

Modified human IFN-α2b forms were prepared and purified in-house. Activated PEGs were bought from Jenkem Technology Co., Ltd. (USA). DNA and protein markers, Q-Sephrose fast-flow resin, and Fractogel weak cation-exchange resin were bought from GE Healthcare (USA). For cloning and expression of genes, the E. coli strains DH5 and BL21-CodonPlus (DE3)-RIL (Novagen) were used. The pET-21a (+) and plasmids pTZ57R/T (Fermentas) were also used. The InsTA PCR cloning kit (Fermentas), the Gene JET Plasmid Miniprep kit (Fermentas), the QIAquick Gel Extraction kit (QIAGEN) and DNA extraction kit (Fermentas) were also used. DNA polymerase and restriction enzymes were ordered from Fermentas. Other chemicals and reagents were brought from Sigma–Aldrich, Merck (Germany).

2.2. Construction of recombinant vectors

The mega primer strategy was applied along with site-specific modification to construct the modified forms of human IFN-α2b from wild type IFN-α2b gene [26]. Modifications were made at amino acid positions 22, 23 and 34 of wild type IFN-α2b. Mega primers were synthesized by amplification of wild type human IFN-α2b gene using a collection of internal primers (F-1 (5’ggctatctctcttttctcctgcttgaaggacagagctgac3), F-2 (5’acagatgaggcatatctctcttttct3’), F-3 (5’ggctatctctcttttctcctgcttgaaggacagagctgac3’) and F-4 (5’acagatgaggcatatctctcttttct3’), reverse primer (5’aagcttcagttttcattccttacttctta3’) and forward primer (5’ctctcatatgtgtgatctgcctcaaacccacagc3’)). Codons of desired modifications were incorporated into the internal primers. The obtained mega primers including IFN-A4 (454 bp), IFN-A1 (445), IFN-A3 (445 bp) and IFN-A2 (454) had the required alterations (Table 1).

Table 1. Modified human IFN-α2b proteins with respective amino acid replacement.

Protein Name	Position 22	Position 23	Position 34
IFN-α2b wild type	R (Arginine)	R (Arginine)	H (Histidine)
IFN-1	R (Arginine)	A (Alanine)	A (Alanine)
IFN-2	R (Arginine)	H (Histidine)	H (Histidine)
IFN-3	A (Alanine)	R (Arginine)	A (Alanine)
IFN-4	H (Histidine)	R (Arginine)	H (Histidine)

The modified human IFN-α2b genes were purified from gel, digested with restriction enzymes HindIII and Nde1 and ligated into pTZ 57 R/T for transformation into Z Competent E. coli DH5α cells. Subsequently, modified human IFN-α2b genes were cloned in the double digested vector pET21a. The ligation mixtures were transformed into DH5α Z Competent cells of E. coli.

2.3. Expression and purification of human IFN-α2b modified forms

To investigate the expression patterns of each altered protein, recombinant plasmids containing purified interferon (pET-IFN-1, pET-IFN-2, pET-IFN-3, and pET-IFN-4) were introduced into E. coli BL21 codon plus (DE3) RIL competent cells. Different concentrations of inducers were also used to optimize expression conditions (0.2–1 mM lactose and IPTG). Cell biomass was generated in 1 L TB media in high yield flasks at 37°C. Inclusion bodies were solubilized in 8 M (5–10 mg per 1 ml) urea buffer containing 8 M urea, 2 M DTT, 10 mM EDTA, and 50 mM MES (pH 6.5). Solubilized inclusion bodies were added to 1L of refolding buffer (2 mM EDTA; 100 mM Tris-Cl pH 8.0; 0.5 mM cystine; 0.1 mM PMSF, and 5.0 mM cystine) in regular pulses to refold the modified proteins. The refolding buffer was membrane dialyzed at 4 °C using a 12 kDa cut off size membrane against 50 mM Tris-HCl, pH 8.0.

The modified IFNs were bound to a Q-sepharose column after biochemical refolding. The protein was eluted from the column using various NaCl concentrations (0.1–1 M) in 50 mM Tris-Cl (pH 8.0). The protein elution profile was monitored by measuring the OD at 280 nm. To maintain the quality of purification, each fraction was subjected to electrophoresis on a 12% SDS-PAGE gel. To decrease salt levels, the fractions containing the highest-purity modified IFN-α2b proteins were merged and then dialyzed using a solution of 0.1% TFA. Subsequently, the protein was freeze-dried, and the protein concentration per milligram of solid powder was determined by measuring OD at 280 nm. The purified proteins were later analyzed using 12% SDS-PAGE to assess the purity of the eluted products.

2.4. PEG conjugation and purification of human IFN-α2b modified forms

Similar to our previous studies [27], four varieties of PEG compounds were employed for the process of PEGylation. These included mPEG-Propionaldehyde with two variants, one linear at 20 kDa and the other Y-shaped at 40 kDa, along with mPEG Succinimidyl succinate, which also had two forms, one linear at 20 kDa and the other Y-shaped at 40 kDa, as depicted in Figure 2. PEGylation using mPEG-Propionaldehyde was carried out by mixing purified IFN-α2b modified variants at a concentration of 1 mg/mL with 5 mg/mL of 20 kDa (linear form) and 5 mg/mL of 40 kDa (Y-shaped form) mPEG-Propionaldehyde obtained from JenKem technology in a buffer solution containing 50 mM Na₂HPO₄, 0.2 M NaCl, and a pH of 6.0. This reaction was conducted for 18 h in the absence of light at a temperature of 37°C while utilizing 5 mM sodium cyanoborohydride. To terminate the PEGylation reaction, MES (60 mM) pH 5.0 was used. Purification of PEGylated IFNs was done using SP-Sepharose resin. Briefly, the column was equilibrated with MES (60 mM, pH 5.0), a total of 1 mg/mL PEGylated IFN proteins were loaded onto the column followed by washing with the buffer (Na₂HPO₄ 20 mM, NaCl 75 mM, and pH 5.5), and finally elution was performed using Na₂HPO₄ 5 mM, pH 6.0, and 600 mM NaCl.

Figure 2. Representation of PEGylation reaction between IFN-α2b and PEG, adopted from JenKem Technology, USA. (a) Linear 20 kDa m-PEG Succinimidyl succinate (b) Linear 20 kDa mPEG-Propionaldehyde (c) Y-shaped 40 kDa m-PEG Succinimidyl succinate (d) Y-shaped 40 kDa mPEG-Propionaldehyde.

PEGylation of modified human IFN-α2b proteins (at a concentration of 1 mg/mL) was carried out by incubating them in a 50 mM sodium borate buffer at pH 8.0 and 4°C for a duration of 2 h. This process utilized 3 mg/mL of linear 20 kDa methoxy PEG Succinimidyl succinate and 6 mg/mL of Y-shaped 40 kDa methoxy PEG succinimidyl succinate from JenKem Technology. The ratio of protein to polymer in this reaction was 1:3. After 2 h, the reaction was halted by adding glacial acetic acid to adjust the pH to 4.5. The Fractogel EMD CM-650(M) resin was employed to purify the PEGylated products by equilibrating the column with 20 mM sodium acetate buffer at pH 4.5, loading of 1 mg/mL protein, washing the column with the same buffer and finally eluting with 20 mM sodium acetate buffer, 300 mM NaCl pH 4.5. Proteins were microfiltered using 0.2 micron filters before being used in bioassays. Purified PEGylated proteins were subjected to 12% SDS-PAGE analysis to access the purity of the eluted products.

2.5. MALDI-TOF analysis

The molecular weight of modified and PEGylated IFN-α2b species was determined using MALDI-TOF analysis. 1 µg of protein sample in 5 µL deionized water was combined with 20 µL of a mixture containing 30% acetonitrile, 0.3% TFA, and 5 mg sinapinic acid. The MALDI-TOF was calibrated first using myoglobin, (16 kDa). Following the placement of 5 µL protein samples on the MALDI-TOF plate, the plate was left to dry, and a laser was used to focus on the sample spot. The time it took for the sample to travel in response to the laser targeting the spot was then measured. This measurement was carried out using the protein-containing sample mixture specifically prepared for MALDI TOF analysis.

2.6. Antiproliferative assay

A cell-based bioassay was used to assess the antiproliferative activity of proteins in the HepG2 cell line [26]. The purified human IFN-α2b products were serially diluted in DMEM from 1.0–0.001 ng in a 96-well plate. Following the addition of protein, each well was seeded with a 100 µL cell suspension containing 1000 cells and incubated in 5% CO₂ at 37 °C for 72 h. Following incubation, the medium was poured and the cells were washed with 1X PBS three times before being given 200 µL of 0.5 percent neutral red dye solution. The plate was incubated in the CO2 incubator for 3 h followed by 3X washing with 1X PBS. To extract the neutral red dye absorbed by viable cells, 200 µL acidified ethanol followed by incubation at 37 °C for 3 min. The concentration of extracted dye was determined by OD absorbance at 540 nm. A higher absorbance value suggests the existence of more viable cells, implying that the protein has a low antiproliferative function.

2.7. Pharmacokinetics analysis

A total of 18 adult female rabbits weighing between 2 and 2.5 kg were used, including 3 control animals. Each drug was tested on three animals, following European Union guidelines (CEE Council 86/609) and approved by the ethics committee at the Institute of Biochemistry and Biotechnology, University of the Punjab, Lahore, Pakistan (Approval: Reference # 2018/04/06-0044). Into each rabbit, 0.25 µg (3 MIU) of each protein per kg body weight was intravenously injected [26,28]. At time points 0.25, 0.5, 0.75, 1, 2, 4, 8, 12, 24, 36, 48, 72, and 96 h after injection, blood samples (0.4 mL) were drawn through the rear vein of ear. Whole blood was collected into EDTA-anti-coagulant containing tubes, centrifuged at 3,000 rpm for 10 min at 4°C. The concentration of IFN-α2b was measured from plasma using a Bender MedSystems^TM IFN alpha-ELISA kit. Plasma retention time of each protein was measured.

2.8. Molecular docking studies

AutoDock Vina 1.1.2 was employed to perform molecular docking between various modified forms of IFN-α2b and the receptors IFNAR1 and IFNAR2. Standard crystal structures of IFNAR1, IFNAR2, and IFN-α2b were obtained from the Protein Data Bank (PDB) with the respective IDs 3S98, and 3S9D, and 3S9D. AutoDock 4.2 was used to prepare the protein structure for docking. Cofactors, heteroatoms, and water molecules were excluded from the target protein and hydrogen atoms were added. Following minimization, a site-specific grid was created by selecting an atom from the co-crystal ligand. The internal grid dimensions in the X, Y, and Z axes were set at (X: −13.06, Y: −39.74, Z: −12.64) for 3S98 and (X: 18.55, Y: −22.09, Z: 8.01) for 3S9D.

2.9. Statistical analysis

The data obtained were analyzed offline utilizing Microsoft Excel, Origin, and GraphPad Prism software. Statistical evaluations were performed within Origin or GraphPad Prism, making use of their inherent functions. Differences that exhibited statistical significance between means (with a significance level of p < 0.05) were identified through a one-way ANOVA. The presentation of data includes means accompanied by their corresponding standard deviations (± SD).

3. Results

3.1. Construction of IFN-α2b modified forms

The type of amino acids found at loop AB and C-terminal distinguishes sub-forms of interferon alpha-2. Because both loops are essential for binding to receptors, they are significant in determining the biological activities of interferon alpha molecules. Changing even a single amino acid can have a notable effect on the bioactivity of IFN-α2b. In this research, amino acids at positions 22, 23 and 34 were selected and replaced with other amino acids using a megaprimer strategy. The resulting IFN-α2b gene variants were cloned into the pTZ 57 R/T vector using NdeI and HindIII restriction sites, and then transformed into E. coli DH5 cells. The modified IFN-α2b genes were amplified by PCR using forward and reverse primers and subjected to double restriction analysis. On an agarose gel, the existence of a 0.5 kb band indicated the presence of modified gene variants (Figures 3a and b).

Figure 3. (a) 1% agarose gel of PCR amplified fragments of modified forms of IFN-α2b from pTZ 57 R/T vector (b) double restriction analysis of modified forms of IFN-α2b ligated into pTZ 57 R/T vector with HindIII and NdeI enzymes (c) (A) 1% agarose gel of PCR amplified fragments of modified forms of IFN-α2b in pET-21a vector (d) double restriction analysis of modified forms of IFN-α2b ligated into pET-21a with HindIII and NdeI enzymes.

The 0.5 kb gene bands from double restriction gels were restricted and extracted from the gel to clone into pET-21a vector between NdeI and HindIII restriction sites. E. coli DH5α cells transformation, plasmid isolation from positive colonies, amplification of gene constructs by PCR and double restriction analysis were successfully performed afterwards (Figure 2c and d). Sequencing results also confirmed the presence of desired modifications at 22, 23 and 34 positions. Then these sequences were compared with the reference IFN-α2b (Sequence ID: AAP20099.1) and the resulting Clustal W multiple sequence alignment is displayed in (Figure 4).

Figure 4. Clustal W analysis of modified forms of human IFN-α2b with reference IFN-α2b (Sequence ID: AAP20099.1).

3.2. Expression and purification of IFN-α2b modified forms

For expression of the IFN-α2b gene variants, BL21 codon plus (DE3) RIL competent cells were transformed with recombinant vectors (pET-IFN1, pET-IFN2, pET-IFN3, and pET-IFN4). Inducer concentrations of IPTG and lactose (0.2–1 mM) showed no significant difference in expression level as shown in Figure 5 (a, b, c and d). Hence, 0.8 mM lactose was chosen for protein production, where each modified IFN protein was expressed in high-yield density flasks in 1 L bacterial culture. The recovered cell biomass was approximately 10 g/L for wild type IFN, 9.23 g/L for IFN-1, 8.57 g/L for IFN-2, 8.31 g/L for IFN-3, and 6.46 g/L for IFN-4. Proteins solubilized in Urea Buffer were incubated in chemical refolding buffer to allow the formation of correct disulfide bonds. The biochemically refolded proteins were additionally purified using Q-sepharose chromatography, where the purified protein was eluted between 0.2 and 0.4 M NaCl. Both major protein fractions were combined and analyzed via SDS-PAGE to assess purity of the IFN-α2b product (Figure 4e). The average yield was between 20 and 35 percent for each modified purified protein.

Figure 5. 12% SDS-PAGE analysis of optimization of expression conditions of modified IFNs in E. coli. BL21 codon plus (DE3) RIL (a) IFN-1 (b) IFN-2 (c) IFN-3 and (d) IFN-4 (e) 12% SDS-PAGE analysis purified modified forms of IFNs.

3.3. PEGylation and characterization of IFN-α2b modified forms

After PEGylation was completed, reaction mixtures were separated on SP-sepharose and Fractogel resins to collect mono-PEGylated proteins and analysed by 12% subsequent SDS-PAGE to verify purity (Figure 6a, b, c and d). Unmodified IFN-α2b protein was identified as a band at around 19 kDa, while IFN-α2b PEGylated species and their modified forms purified on SP-Sepharose/Fractogel also appeared as one band, suggesting high purity. In particular, the 40 kDa PEGylated interferon species appeared as a single band with an apparent molecular weight of around 60 kDa, while the 60 kDa PEGylated interferon species presented a single band with an evident molecular size of almost 100 kDa. The expected molecular weight for 40 kDa PEGylated interferons was about 39.2 and 59.2 kDa for the 60 kDa PEGylated interferons. The increase in apparent molecular weight of PEGylated IFNs on SDS-PAGE is likely due to PEG's affinity for water molecules and increased hydrodynamic radius of the PEGylated species.

Figure 6. 12% SDS-PAGE analysis of purified mono-PEGylated IFNs (a) IFN-1 (b) IFN-2 (c) IFN-3 and (d) IFN-4. MALDI-TOF Spectra for (e) IFN-1 (19243 kDa), (f) IFN-2 (19252 kDa), (g) IFN-3 (19244 kDa), (h) IFN-4 (19250 kDa), (i) IFN-Ald20 K (39269 kDa) and (j) IFN-Ald40 K (61904 kDa).

For each modified non-PEGylated and PEGylated IFN-α2b protein, MALDI-TOF results revealed the presence of a single prominent peak (Figure 6 e–j). The exact molecular weights of each modified IFN-α2b and PEGylated protein were in good agreement with the theoretically calculated molecular weights measured using the Expassy method. Instrumental errors may account for small variations in theoretical and experimental protein masses, which can be overlooked (Table 2).

Table 2. Molecular weight determination of IFNs by MALDI-TOF.

Protein type	Theoretical MW (Da)	Experimental MW (Da)	MW difference (Da)
IFN wild type	19255	19247	8
IFN-1	19188	19243	55
IFN-2	19236	19252	16
IFN-3	19188	19244	56
IFN-4	19236	19250	14
IFN-Ald20K	39252	39946	694
IFN-Ald40K	59252	61904	2652

3.4. Antiproliferative activities and pharmacokinetics

The antiproliferative activities of our modified IFNs vary significantly from human IFN-α2b wild type, as determined by IC₅₀ values in a cell growth assay. The antiproliferative activity of IFN-2 protein, with an IC₅₀ value of 0.062 ng, was marginally higher than that of IFN-α2b wild type protein (0.125 ng). The IC₅₀ value was significantly lowered than the other type of proteins. The IFN-4 variant, on the other hand, had an IC₅₀ value of 0.125 ng, which was equivalent to IFN-α2b wild type protein (0.125 ng). The antiproliferative activity of IFN-1 was significantly reduced, exhibiting an IC₅₀ value of 1 ng and significant difference in mean values was obtained when compared with the rest of type of proteins under investigation (Table 3). Similarly, antiproliferative activity of IFN-3 was lesser than that of IFN-α2b wild type protein, with an IC₅₀ value of 0.175 ng. These findings demonstrated the importance of amino acid positions 22, 23, and 34 in assessing IFN-α2b biological activity (Figure 7a).

Figure 7. (a) Assessment of the inhibitory effects of IFN-α2b, Refron, IFN-1, IFN-2, IFN-3, and IFN-4 on the HepG2 cell line's proliferation. (b) Determining the remaining antiproliferative effectiveness of both non-PEGylated and PEGylated versions of IFNs. (c) Analyzing alterations in plasma protein concentration levels after the intravenous delivery of IFN-α2b and its PEGylated variations.

In vivo results of PEGylated interferons showed an increase in circulation half-life. The plasma half-life of IFN-NHS20 K and IFN-Ald20 K was increased to 36 and 40 h, respectively, compared to non-PEGylated interferon (4 h). When compared to non-PEGylated interferon, the circulation half-life of IFN-Ald40 K and IFN-NHS40 K improved to 62 and 56 h, respectively (Figure 7c). PEGylation of IFNs with larger PEGs (40 kDa) produced PEGylated species with a molecular weight of 59.2 kDa, resulting in a sharp improvement in serum half-life of IFN-NHS40 K and IFN-Ald40 K. As a result of PEGylation, the molecular mass of the non-PEGylated interferon increased, leading to an increase in its serum half-life. Since increase in circulation half-life in vivo entirely depends on the molecular size of protein, all other IFN-α2b modified forms and PEGylated IFN-α2b modified forms were expected to show similar results. Therefore, in vivo studies were not performed on the remaining modified IFNs shown in (Figure 7b).

In order to measure antiproliferative activities of PEGylated IFNs, a single constant concentration of 1 ng/mL was used. The absorbance of each PEGylated protein was compared to that of its unmodified counterpart, and the findings were expressed as a percentage of residual antiproliferative activity in comparison to the non-PEGylated interferon. The antiproliferative activities of all PEGylated IFN proteins were lower than those of the unmodified IFN proteins, according to the findings (Figure 7c). IFN-Ald40 K had significantly lower antiproliferative activity (12%) than IFN-Ald20 K (45%). This is because of IFN-Ald40 K higher molecular weight, this can provide a robust protection against IFN-α2b and effectively block access to receptive binding sites through steric hindrance. IFN-NHS20 K had significantly lower antiproliferative activity (31%) than IFN-Ald20 K (45%). The same was true for IFN-NHS40 K (7%) and IFN-Ald40 K (12%). One possible reason for this phenomenon may be the presence of the PEGylated lysine segment on IFN-NHS20 K and IFN-NHS40 K positioned in close proximity to the active receptor binding site on IFN-α2b, resulting in a partial blockage of its ability to bind to the receptor. The similar effect was seen with modified PEGylated interferons.

Table 3. IC₅₀ values of modified interferon alpha-2b proteins.

Protein Type	IC50 (ng) Mean ± SD
Interferon alpha-2b	0.125 ± 0.001 ^a
Refron	0.125 ± 0.001 ^a
IFN-1	1.000 ± 0.025 ^b
IFN-2	0.062 ± 0.002 ^c
IFN-3	0.175 ± 0.002 ^d
IFN-4	0.125 ± 0.001 ^a

The alphabets a, b, c, d represent the significance difference, described by one way ANOVA at p < 0.05.

3.5. Molecular docking studies

The binding energies of IFN-1, IFN-2, IFN-3, and IFN-4 with IFNAR1, IFNAR2 are mentioned in Table 4. The E-value indicates the intensity of the association between protein and its receptor (IFNAR1and IFNAR2). A lower E-value means that the protein-receptor complex is more stable, implying that the protein has a high affinity for the receptor. All interferons had similar E-values to IFNAR1, suggesting a nearly identical affinity for binding to IFNAR1. Although the higher E-values for docking IFN-3 and IFN-4 with IFNAR2 indicated a low affinity for IFNAR2, Figure 8a depicts the crystal structure of all IFNs and 8b displays the final docked poses of IFNAR1, IFNAR2, IFN-1, IFN-2, IFN-3, and IFN-4.

Figure 8. (a) Crystal structure of IFN-1, IFN-2, IFN-3 and IFN-4 (b) Final docked poses of IFN-1, IFN-2, IFN-3 and IFN-4 with IFNAR1 and IFNAR2. The protein is shown in red and receptor in blue colour (c) Representation of the binding of IFNAR1 and IFNAR2 with PEGylated IFN, PEG (orange) interferon (grey), IFNAR1 and IFNAR2 (green) (d) Representative IFN-PEGx structures. IFN-α2b is shown as MSMS surface structure and PEG is shown as ball model. Key loops are colored in magenta (A-B loop) and yellow (C-terminal loop).

Table 4. E-values produced by docking.

Receptor-Protein Combination	E-Value (kcal/mol)	Receptor-Protein Combination	E-Value (kcal/mol)
IFNAR1-IFN	−895.3	IFNAR2-IFN	−865.9
IFNAR1-IFN1	−903.6	IFNAR2-IFN1	−830.9
IFNAR1-IFN2	−904.6	IFNAR2-IFN2	−864.6
IFNAR1-IFN3	−893.6	IFNAR2-IFN3	−783.5
IFNAR1-IFN4	−908.3	IFNAR2-IFN4	−782.3

Figure 8c represents the final docked poses of PEGylated IFN-α2b with its receptors (IFNAR1 and IFNAR2). IFN is represented as MSMS surface model, PEG as orange ball model and receptors (IFNAR1 and IFNAR2) as green ball models. Figure 8d represents the binding of 20 and 40 kDa PEG to IFN-α2b surface (hotspot regions) are colored by magenta (A–B loop) and yellow (C-terminal loop). As illustrated, the attachment of 40 kDa PEG with IFN-α2b has sterically hindered the hotspot regions of IFN-α2b in comparison with the attachment of 20 kDa PEG, making IFN-α2b less available for binding to the receptor. With the increase in PEG length, shielding effect on IFN-α2b is increased, thus rendering it less potent. However, this reduction in biological activity of PEGylated IFN-α2b can be compensated by enhanced bioavailability (high serum retention time).

4. Discussion

All type I interferons have similarities in their structure (161–167 amino acids) and sequence (75–99% identical) and all bind to the same IFNAR receptor. Despite these similarities, they still have different biological activities based on their affinities for IFNAR receptor subunits 1 and 2 [29]. Some studies indicate that these affinities are closely associated with the antiproliferative activities of different IFN-α subtypes [30]. Previous studies employing site-directed mutagenesis on Interferon alpha-2b have yielded diverse outcomes. For example, one study explored the impact of rare arginine codons at the mRNA 5’ end and inherent secondary structures on human IFN-α2b production in E. coli. The evaluation highlighted the intertwined influence of codon usage, SD-like sequences, and mRNA secondary structure on gene expression [31]. In another study, mutein forms of recombinant human interferon alpha-2b were assessed for adverse effects in female Swiss Webster mice over 45 days, revealing their well-tolerated nature without adverse side effects [32].

In the present investigation, the human IFN-α2b protein and four genetically modified forms (IFN-1, IFN-2, IFN-3, and IFN-4) were successfully generated. MALDI-TOF analysis of modified non-PEGylated and PEGylated IFN-α2b proteins showed a prominent single peak, consistent with calculated molecular weights obtained via Expassy method. Antiproliferative assays on the HepG2 cell line showed that the modified types differ substantially from the unmodified human IFN-α2b protein in terms of antiproliferative activity. The IFN-2 variant (with the mutation R23H) demonstrated increased antiproliferative activity with an IC₅₀ of 0.062 ng, which was significantly more potent than that of wild type IFN-α2b (IC₅₀ of 0.125 ng). On the contrary, IFN-4 (with the R22H mutation) had an IC₅₀ of 0.125 ng, equivalent to IFN-α2b wild type protein (0.125 ng). The biological activity of IFN-1 (with modifications R23A and H34R) was substantially reduced, with an IC₅₀ value of 1 ng. Likewise, in the case of IFN-3, the R22A and H34R modifications caused a reduction in biological activity as compared to the IFN-α2b wild type protein, and showed an IC₅₀ value of 0.5 ng. These findings demonstrated the importance of amino acid positions 22, 23, and 34 in assessing IFN-α2b’s biological activity. When IFN-α2b and its altered versions were subjected to docking analysis with the IFNAR1 and IFNAR2 receptors, the computed E-values fell within the range of −782 to −908 kcal/mol. Notably, IFN-2 and IFN-4 exhibited the most negative E-values among all, indicating a heightened affinity for both the IFNAR1 and IFNAR2 receptors. Antiproliferative activities revealed similar findings, with IFN-2 exhibiting a high degree of antiproliferative activity and IFN-4 exhibiting similar antiproliferative activity as measured by the IC₅₀ value in comparison to IFN-α2b wild type protein.

The process of PEGylation applied to pure human IFN-α2b and its altered versions (IFN-1, IFN-2, IFN-3, and IFN-4) led to the creation of entities that exhibited reduced abilities to inhibit cell proliferation but demonstrated extended presence in the bloodstream, as verified through in vivo investigations. The PEGylation site was found to be critical in determining the biological activity of PEGylated IFNs, while the PEG size was found to strongly influence the hydrodynamic volume and circulation half-life of PEGylated IFNs. In comparison to random PEGylation with mPEG-Succinimidyl succinate, N-terminal PEGylation with mPEG-Propionaldehyde results in more bioactive PEGylated IFNs. This is because in N-terminal PEGylation, the N-terminal is located well away from the IFN-α2b receptor binding site, while in random PEGylation, Lys134 and Lys152 are located close to the IFN-α2b receptor binding site. PEG with a large molecular weight (40 kDa) increased the serum retention time and hydrodynamic volume of PEGylated IFNs considerably while decreasing their antiproliferative activity.

Experimental findings showed that PEGylation of IFN-α2b and its modified forms can increase their hydrodynamic volumes and also increase serum retention times (up to 62 h) as compared to wild type IFN-α2b with a serum retention time of 4 h. However, antiproliferative activity assays on the HepG2 cell line indicate that activity is decreased by 49% to 7% as compared to IFN-α2b wild type. Molecular docking results also suggest losses in activity with increases in PEGylated IFN-α2b size, which is based on models of the receptor binding site on IFN-α2b being sterically shielded. In general, N-terminally PEGylated IFN-α2b proteins, resulting from selective conjugation with 20 and 40 kDa mPEG-Propionaldehyde, showed more antiproliferative effect with high serum retention time.

5. Conclusion

In conclusion, this research demonstrated that modifications to amino acid positions 22, 23, and 34 of IFN-α2b protein may have a significant impact on its biological activity and affinity for IFNAR1 and IFNAR2 receptors. Specifically, the IFN-2 variant with the R23H mutation demonstrated increased antiproliferative activity, while IFN-1 and IFN-3 with R23A and R22A mutations, respectively, exhibited reduced activity. Furthermore, PEGylation of IFN-α2b and its modified forms can decrease its antiproliferative activity but at the same time increase their hydrodynamic volumes, resulting in improved serum retention times. These findings have important implications for the development of more effective IFN-α2b-based therapies for cancer and other diseases.

Conflict of interest declaration

The authors declared no conflicts of interest promulgated by the authors.

Data accessibility statement

The data that supports the finding of this study are available in this article.

Ethical approval

No humans were used for the studies that are the basis of this research. The reported experiments on animal were performed in accordance to European Union on Animal Care and Experimentation (CEE Council 86/609) guidelines within the safety limits.

Credit authorship contribution statement

Syeda Kiran Shahzadi: Methodology, Formal analysis, Writing – original draft, Muhammad Abdul Qadir: Supervision, Review & editing, Nasir Mahmood: Review, Investigation, Methodology, Mahmood Ahmed: Formal analysis, Review & editing.

Acknowledgements

We would like to thank Prof. Dr. Muhammad Akhtar of School of Biological Sciences, University of the Punjab, Lahore-Pakistan for providing the workplace during initial research work. We are also thankful to Dr. Zafar-Ul-Ahsan Qureshi from Veterinary Research institute, Lahore, Pakistan for HepG2 cell line and assisting the in vivo assays.

Disclosure statement

No potential conflict of interest was reported by the author(s).