Carcase traits, meat quality, and lipogenic gene expression in muscle of lambs fed wheat bran feruloyl oligosaccharides

Abstract

This study investigated the effects of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on carcase traits, meat quality, muscle fatty acid composition, and the expression of lipogenic genes in lambs. In a completely randomised design, 50 Dorper × thin-tailed Han lambs (20.21 ± 3.36 kg) were randomly divided into five treatments with ten replications. The lambs in the control group were fed a basal diet, while those in the experimental groups were fed the basal diet supplemented with 50, 100, 200, and 400 mg/kg FOs-FWB. The shear forces of longissimus dorsi (LD) in lambs fed 50 and 100 mg/kg FOs-FWB were significantly lower than that of the control group (p < .05). Lambs fed with 200 mg/kg FOs-FWB had higher crude protein and lower fat contents in LD muscle (p < .05), the ash content in LD muscle was increased by FOs-FWB supplementation (p < .05). Lambs fed 50 mg/kg FOs-FWB had significantly higher proportions of C18:1n − 9, C20:1, C18:3n − 3, C18:3n − 6 and total n − 3 (p < .05). The proportion of C18:3n − 6 was significantly increased by 100 mg/kg FOs-FWB supplementation (p < .05). Feeding 200 mg/kg FOs-FWB significantly decreased proportions of C14:0 and total saturated fatty acid (SFA), but increased proportions of C18:1n − 9, C18:2n − 6, total monounsaturated fatty acid (MUFA) and unsaturated fatty acid (UFA) to SFA ratio (p < .05). Moreover, increases in the proportion of C22:6n − 3 and total polyunsaturated fatty acid (PUFA) were observed in lambs fed FOs-FWB (p < .05). The relative expression levels of ACC, FAS, and SCD genes in the LD muscle of lambs fed 200 and 400 mg/kg FOs-FWB were higher than the control group (p < .05). Dietary supplementation with 100, 200, 400 mg/kg FOs-FWB significantly increased the relative mRNA expression level of LPL (p < .05). Furthermore, a decrease in the relative mRNA expression level of PPARγ was observed in lambs fed 50 mg/kg FOs-FWB (p < .05). In conclusion, dietary supplementation with FOs-FWB reduced shear force, enhanced intramuscular fat content and PUFAs proportion and stimulated lipogenic gene expression in LD muscle of lambs, especially at a level of 200 mg/kg addition.

Highlights

• Dietary FOs-FWB improved the tenderness of the meat.

• Dietary supplementation with 200 mg/kg FOs-FWB increased the content of intramuscular fat and PUFAs, as well as the ratio of UFA to SFA.

• Dietary FOs-FWB affected the expression of genes related to lipid metabolism.

Keywords:

• Feruloyl oligosaccharides
• wheat bran
• meat quality
• fatty acid
• lipogenic gene
• lamb

Introduction

Mutton is one of the most popular red meat worldwide, which can supply a range of essential nutrients in the human diet. Both sensory quality characteristics and nutritional value have strong influences on the choice of consumers for mutton products. The two important consumer drivers are linked through intramuscular fat content and composition. However, the excessive pursuit for growth rates of lambs has led to an increase of saturated fatty acid (SFA) contents and induced deterioration of the sensory quality of lamb meat (Ponnampalam et al. 2012). Many studies have reported the possibility of modifying the fatty acid profile and sensory quality of lamb meat by nutritional strategies (Scollan et al. 2017). For example, oilseeds (Aldrich et al. 1997), algae (Clayton et al. 2014), fish oils (Najafi et al. 2012) and plant extracts (Smeti et al. 2018) increased the proportion of PUFAs and sensorial attributes of lamb meat.

Ferulic acid (FA) is the most abundant phenolic acid in the cell wall of wheat bran and has been proven as a potential source of antioxidants (Mathew and Abraham 2004; Wang et al. 2019a). The dietary supplementation of FA in improved hot carcase dressing and Longissimus thoracic (LD) muscle area of lambs (Peña-Torres et al. 2022) and sensory quality and PUFAs content of steers (González-Ríos et al. 2016). Feruloyl oligosaccharides (FOs), oligosaccharide ester-linked FA, is the mainly bound forms of FA, which could be produced from feruloyl polysaccharides hydrolysis (Ou and Sun 2014; Malunga et al. 2016). It has been proven that FOs exhibit the biological activity FA and oligosaccharides, and its in vitro antioxidant capacity is stronger than that of free FA (Zhao et al. 2018). In the previous study, we found that dietary supplementation of FOs derived from fermented wheat bran (FOs-FWB) promoted growth performance, modulated rumen fermentation and increased serum antioxidant enzyme activities and GSH concentration of lambs (Wang et al. 2019b). Thus, it was hypothesised that FOs-FWB may be an effective alternative to modify the meat quality and lipid metabolism of lambs. To test the hypothesis, the effects of dietary FOs-FWB supplementation on carcase traits, meat quality, fatty acid composition and lipid metabolism gene expression of lambs were evaluated. The data collected in this study will add to our existing understanding of FOs-FWB and identify a potential feed additive for lamb production.

Materials and methods

Experimental design, animal management, and diets

The FOs-FWB preparation and animal management regimen for the present experiment have been reported previously (Wang et al. 2019b). Briefly, fifty crossbred male lambs (Dorper × thin-tailed Han) at two months old with 20.21 ± 3.36 kg body weight were used. Lambs were randomised into five dietary treatments with ten lambs each. The lambs were fed a basal diet supplemented with 0 (control group), 50, 100, 200, and 400 mg/kg FOs-FWB, respectively. The inclusion level of FOs was chosen based on our preliminary study (Wang et al. 2018). The lambs were housed in individual stalls equipped with feeders and a water source. The experimental period lasted 56 d and was preceded by an adaption period of 14 d. Lambs received the diets twice daily (at 08:00 and 18:00) to ensure 10% refusal, and had free access to fresh water. The ingredient and chemical composition of the basal diet is shown reported in Table 1. The feed was formulated based on the Feeding Standard of Meat-Producing Sheep and Goat of NY/T 816–2004 (Ministry of Agriculture of the People’s Republic of China 2004) recommendation as a pelleted mixed diet.

Table 1. Ingredient and chemical composition of basal diet (%, air-dry basis).

Item	Content
Ingredient
Chopped alfalfa hay (8 mm)	10.00
Chopped sunflower seed shells (8 mm)	20.00
Ground maize grain	43.00
Soybean meal (43% crude protein)	12.00
DDGS (27% crude protein)	10.00
Vitamin-mineral premix^a	5.00
Chemical composition
Digestible energy (MJ/day)^b	11.38
Crude protein	15.66
Ether extracts	3.48
Neutral detergent fibre	54.73
Acid detergent fibre	21.42
Ash	5.95
Calcium	0.74
Phosphorous	0.31

^aThe premix provided the following per kilogram: Ca, 130 g; P, 65 g; salt, 85 g; vitamin A, 140000 IU; vitamin D₃, 37500 IU; vitamin E, 375 mg; vitamin K₃, 25 mg; thiamine, 25 mg; pyridoxine, 25 mg; riboflavin, 75 mg; vitamin B₁₂, 0.28 mg; niacin, 300 mg; pantothenic acid, 200 mg; folic acid, 15 mg; biotin, 1.5 mg; Fe, 1300 mg; Cu, 200 mg; Zn, 1200 mg; Mn, 1000 mg; I, 9 mg; Se, 7 mg; Co, 12 mg.

^bCalculated value.

DDGS: distillers dried grains with solubles. DDGS are usually by-products produced in the production of industrial ethanol.

Slaughtering, carcase and meat sampling

At the end of the feeding trial, all lambs were slaughtered in the local abattoir using Halal methods. The lambs were fasted from feed and water for at least 12 h before slaughter. The pre-slaughter live weight and hot carcase weight were recorded, and the dressing percentage was calculated. The loin eye area was measured using a digital planimeter on the cut surface of LD muscle at the interface between the 12th and 13th rib on the left sides of the carcase. The total tissue depth (GR value) between the 12th and 13th rib, 100 mm from the midline of the spine were recorded (Ponnampalam et al. 2007). Three pieces of the left LD muscles were sampled, one piece was immediately used for meat physical characteristics measurement, the second was lyophilised and minced for chemical and fatty acid composition analysis, and the third was snap-frozen in liquid nitrogen for genes expression analysis.

Meat quality analysis

The meat quality analysis was conducted according to methods published by González-Ríos et al. (2016). Briefly, the pH value of LD muscle was detected using a pH metre (Russell CD700; Russell pH Limited, Germany) at 45 min after slaughter. Meat colour including lightness (L*), redness (a*) and yellowness (b*) was measured by an automated colorimeter (CR-300, Minolta, Osaka, Japan). Chroma (C*) was calculated by the formula: C* = (a* + b*)½ and Hue angle (H^o) using the formula: H^o = tan⁻¹ (b*/a*). For the cooking loss analysis, 120 g of LD muscle sample was cooked in a water bath until the core temperature reached 70 °C. After that, the sample was cooled, and cooking loss was calculated as a percentage of weight change before and after cooking. Subsequently, meat was cut into pieces of 1 cm × 1 cm × 2.5 cm along the direction of the muscle fibres, and the shear force was determined using a texture analyser (C-LM2, Xieli Technology Development Co., LTD, Qinhuangdao, China). The water loss rate was determined using the filter paper press method (Du et al. 2022). The LD muscle sample 1.0 cm in diameter and 0.5 cm in thickness was taken. The samples were weighed, wrapped in an 18-layer filter paper, pressed using a compression machine (YYW-2, Nanjing Soil Instrument, Nanjing, China) at a force of 35 kg for 5 min and then reweighed. The water loss rate was calculated as a percentage of weight change before and after pressing.

Meat chemical and fatty acid composition analysis

The moisture, crude protein, ether extract and ash contents of LD muscle samples were determined according to the method of the Association of Official Analytical Chemists (AOAC 2007): moisture by Method 930.15; crude protein by Kjeldahl method 984.13; ether extract by the Soxhlet method 963.15 and ash by incineration method 924.05.

The intramuscular fatty acids composition were determined according to the Determination of fatty acids in food of GB 5009.168-2016 (State Food and Drug Administration of the People’s Republic of China) using the internal standard (methyl nonadecylate, Sigma Chemicals, St. Louis, MO, USA). The lyophilised LD muscle sample (80–100 mg) was mixed with 100 μL of the internal standard. Then, 2 mL of NaOH/CH₃OH was added. The mixture was homogenised with a vortex mixer, heated for 30 min at 85 °C, and then cooled for 6–7 min. Then, 3 mL of trifluoro(methanol)boron was added. The mixture was then shaken and reheated for 30 min at 85 °C. After cooling to ambient temperature, the upper extraction layer (n-hexane) was collected. A TG-5MS (Thermo Fisher Scientific, USA) fused-silica capillary column (30 m × 0.25 mm ID × 0.25 µm film thickness) was used to separate the methyl esters, which were detected with a flame ionisation detector. The oven temperature program consisted of the following program: 80 °C for 1 min, increased to 200 °C at 10 °C/min, increased to 250 °C at 5 °C/min, increased to 270 °C at 2 °C/min, and hold for 3 min. The injector and detector temperatures were maintained at 290 °C and 280 °C, respectively. The concentrations of individual fatty acids were quantified according to the peak area and are indicated as g/100 g total fatty acid.

Gene expression analysis

Total RNA was extracted from LD muscle using the TRIzol® Plus RNA Purification Kit (Invitrogen No 12183-555). The concentration and purity of the RNA was assessed using a Bio Tek Epoch2 Microplate Spectrophotometer (Aglient Bio-Tek, USA) at 260/280 nm absorbance. The SuperScript™ III First-Strand Synthesis SuperMix(Invitrogen NO 11752-050) was used for cDNA synthesis. β-actin and glyceraldehyde phosphate dehydrogenase (GAPDH) were analysed to determine the suitable housekeeping gene. β-actin had the best gene expression stability. Therefore, the housekeeping gene β-actin was used as the internal control. Quantitative polymerase chain reaction (qPCR) was performed according to the manufacturer’s instructions (Power SYBR® Green PCR Master Mix, Roche, NO:4913914001). Forty cycles of amplification (comprising 95 °C for 15 s and 63 °C for 25 s) were performed. Amplification and melting curve analyses were then performed using the Quant Studio O3 software program (Life Technologies, USA). Amplifications were conducted in triplicate, and the relative expression level of each gene was analysed using the 2^−ΔΔCt method. Information of primer sequences for peroxisome proliferator-activated receptor γ (PPARγ), lipoprotein lipase (LPL), acetyl-coenzyme A carboxylase (ACC), fatty acid synthase (FAS) and stearoyl-coenzyme A desaturase (SCD) are listed in Table 2.

Table 2. Information of primer sequences of lipid metabolism genes.

Gene	GenBank No.	Primer Sequences (5′–3′)	Product size (bp)
SCD	NM_001009254.1	F: TTCTCCGTTACGCTGTTGTGCTC	158
		R: GGTGTGGTGGTAGTTGTGGAAGC
ACC	NM_001009256.1	F: GCTATGGAAGTCGGCTGTGGAAG	108
		R: TCGTCAGGAAGAGGCGGATGG
LPL	NM_001009394.1	F: CGCCGCCGACAGGATTACAAG	130
		R: GTTAGCCACAGATTCCGTCACTCC
FAS	XM_015098375.1	F: AGATGAAGGTGGTGGAGGTGCTAG	112
		R: TGGCGGTCAGTGGCTATGTAGTC
PPAR-γ	NM_001100921.1	F: TGCCGATTCCAGAAGTGCCTTG	118
		R: GTTGGTCGATGTCGCTGGAGATC
β-actin	NM_001009784.2	F: GAGCGCAAGTACTCCGTGTG	112
		R: CATTTGCGGTGGACGATG

PPARγ: peroxisome proliferator-activated receptor γ; LPL: lipoprotein lipase; ACC: acetyl-coenzyme A carboxylase; FAS: fatty acid synthase; SCD: stearoyl-coenzyme A desaturase.

Statistical analysis

Individual lambs served as experimental units Data were analysed using one-way ANOVA (SAS 9.2, SAS Inst. Inc., Cary, NC, USA). Mean comparisons were performed using Duncan’s multiple tests. The final test results were presented as mean and SEM. Significance was considered when p < .05.

Results

Carcase traits and meat quality

The carcase traits of lambs were not affected by dietary FOs-FWB supplementation (Table 3). The shear force of LD muscle from lambs received 50 and 100 mg/kg FOs-FWB was significantly (p < .05) lower than the control group (Table 4). There was no significant difference in the pH_45 min, meat colour, water loss rate, and cooking loss rate of LD muscle among the groups.

Table 3. Effect of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on carcase traits of lambs.

Item	Treatment^a					SEM	p-value
	Control	50 mg/kg	100 mg/kg	200 mg/kg	400 mg/kg
Pre-slaughter live weight (kg)	33.060	32.660	32.730	34.720	33.290	0.484	.647
Hot carcase weight (kg)	17.760	17.600	17.530	18.360	18.050	0.341	.942
Dressing percentage (%)	53.770	53.820	53.650	52.710	54.110	0.489	.897
Loin eye area (cm^2)	24.500	22.710	23.000	24.000	23.710	0.562	.868
Total tissue depth (GR, mm)	19.330	19.890	18.290	20.090	20.170	0.711	.943

^aLambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB.

Table 4. Effect of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on physical characteristics of Longissimus dorsi muscle in lambs.

Item	Treatment^1					SEM	p-value
	Control	50 mg/kg	100 mg/kg	200 mg/kg	400 mg/kg
pH45min	6.230	6.360	6.360	6.210	6.290	0.030	.376
Lightness (L*)	38.590	38.740	38.240	39.100	38.450	0.289	.924
Redness (a*)	9.650	9.920	9.770	9.450	9.890	0.167	.883
Yellowness (b*)	13.760	13.150	13.080	13.290	12.990	0.155	.561
Chroma (C*)	16.850	16.50	16.340	16.320	16.350	0.170	.864
Hue angle (H◦)	54.810	52.450	53.280	54.620	52.130	0.466	.251
Water loss rate (%)	12.310	11.230	12.510	12.190	10.570	0.309	.167
Cooking loss (%)	38.510	36.700	36.510	37.450	36.200	0.315	.112
Shear force (kg/cm^2)	8.090^a	7.170^c	7.330^b,c	7.890^a,b	7.800^a,b,c	0.107	.021

^a,b,cMeans (n = 10) with different superscripts within the same row differ significantly (p < .05).

¹Lambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB.

Chemical composition of longissimus dorsi muscle in lambs

Compared with the control group, lambs fed with 200 mg/kg FOs-FWB had significantly lower crude protein content but higher ether extract content in LD muscle (Table 5; p < .05). Furthermore, the content of ash in LD muscle was significantly increased by dietary FOs-FWB supplementation (p < .05).

Table 5. Effect of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on chemical composition of Longissimus dorsi muscle in lambs (g/100 g Meat).

Item	Treatment^1					SEM	p-value
	Control	50 mg/kg	100 mg/kg	200 mg/kg	400 mg/kg
Moisture	76.690	76.300	75.910	77.000	76.140	0.160	.231
Crude protein	21.260^a	21.360^a	20.990^a	19.430^b	21.050^a	0.180	<.010
Ether extract	2.900^b	3.3770^a,b	3.480^a,b	3.830^a	2.820^b	0.110	<.010
Ash	1.340^b	1.890^a	2.000^a	1.780^a	1.860^a	0.050	<.010

^a,bMeans (n = 10) with different superscripts within the same row differ significantly (p < .05).

¹Lambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB.

Meat Fatty Acid Composition

Compared to the control group, lambs fed 200 mg/kg FOs-FWB had significantly lower proportions of C14:0 and total unsaturated fatty acid (UFA), but a higher UFA to saturated fatty acid (SFA) ratio (Table 6; p < .05). The proportion of C18:1n − 9 was significantly increased by 50 and 200 mg/kg FOs-FWB supplementation, and the proportion of C20:1 by 50 mg/kg FOs-FWB supplementation (p < .05). Additionally, the total monounsaturated fatty acid (MUFA) proportion of lambs fed 200 mg/kg FOs-FWB was significantly higher (p < .05). Feeding 50 mg/kg FOs-FWB significantly increased the proportion of C18:3n − 3 and total n-3 (p < .05). An increase in the proportion of C18:2n − 6 was observed in lambs fed 200 mg/kg FOs-FWB (p < .05). The addition of 50 and 100 mg/kg FOs-FWB significantly increased the proportion of C18:3n − 6 (p < .05). Moreover, the proportion of C22:6n − 3 (DHA) and total polyunsaturated fatty acid (PUFA) increased by dietary FOs-FWB supplementation (p < .05).

Table 6. Effect of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on fatty acid composition of Longissimus dorsi muscle in lambs (% total fatty acids).

Item	Treatment^1					SEM	p-value
	Control	50 mg/kg	100 mg/kg	200 mg/kg	400 mg/kg
C12:0	0.140	0.130	0.090	0.120	0.100	0.012	.707
C14:0	2.020^a	1.980^a	1.730^a,b	1.270^b	1.550^a,b	0.085	.006
C14:1	0.060	0.080	0.060	0.060	0.060	0.004	.419
C16:0	41.520	39.440	38.640	35.530	39.660	0.734	.101
C16:1	1.260	1.530	1.440	1.360	1.500	0.058	.569
C18:0	7.610	7.520	7.910	7.410	7.580	0.141	.859
C18:1n − 9	11.680^c	12.960^b	12.440^b,c	14.250^a	11.530^c	0.268	<.001
C18:2n − 6	28.740^b	29.450^b	30.630^a,b	33.430^a	30.410^a,b	0.599	.036
C18:3n − 3	0.750^b	0.910^a	0.740^b	0.730^b	0.740^b	0.014	.001
C18:3n − 6	0.160^c	0.260^a	0.220^a,b	0.180^c	0.190^b,c	0.008	.001
C20:0	0.050	0.060	0.050	0.050	0.050	0.002	.059
C20:1	0.070^b	0.090^a	0.070^b	0.070^b	0.070^b	0.002	.001
C20:2	0.070	0.090	0.070	0.080	0.070	0.003	.067
C20:3n − 3	0.270	0.240	0.230	0.290	0.270	0.012	.656
C20:3n − 6	0.010	0.010	0.010	0.010	0.010	<0.001	.46
C20:4n − 6	4.720	4.470	4.700	4.400	5.120	0.125	.443
C20:5n − 3	0.300	0.260	0.260	0.270	0.30	0.014	.826
C22:0	0.010	0.010	0.010	0.010	0.010	0.001	.326
C22:1n − 9	0.110	0.150	0.130	0.110	0.120	0.006	.076
C22:2	0.010	0.010	0.010	0.010	0.010	0.001	.629
C22:6n − 3	0.420^d	0.710^a	0.540^c	0.510^c	0.640^b	0.025	<.001
ΣSFA	51.350^a	49.150^a	48.430^a	44.400^b	48.940^a	0.862	.004
ΣMUFA	13.200^b	14.810^a,b	14.130^a,b	15.840^a	13.280^b	0.316	.024
ΣPUFA	35.450^c	36.410^a,b	37.400^a,b	39.900^a	37.750^a,b	0.841	.041
Σn − 3	1.740^b	2.130^a	1.760^b	1.790^b	1.950^a,b	0.046	.032
Σn − 6	33.630	34.190	35.560	38.010	35.720	0.742	.293
UFA:SFA	0.950^b	1.040^b	1.060^a,b	1.260^a	1.040^b	0.034	.035
PUFA:SFA	0.690	0.740	0.770	0.900	0.770	0.026	.716

^a,b,c,dMeans (n = 10) with different superscripts within the same row differ significantly (p < .05).

¹Lambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB.

Lipid metabolism gene expression

The mRNA levels of genes related to lipid metabolism in LD muscle are shown in Figure 1. The relative mRNA expression levels of ACC, FAS and SCD in LD muscle of lambs fed 200 and 400 mg/kg FOs-FWB were higher than that of the control group (p < .05). Feeding 100, 200, 400 mg/kg FOs-FWB significantly increased the relative mRNA expression level of LPL (p < .05). Furthermore, a decrease in the relative mRNA expression level of PPARγ was observed in lambs fed 50 mg/kg FOs-FWB (p < .05).

Figure 1. Effects of dietary feruloyl oligosaccharides derived from fermented wheat bran (FOs-FWB) supplementation on the mRNA expression of lipid metabolism genes in Longissimus dorsi muscle of lambs. Lambs received a basal diet (control) or basal diet supplemented with 50, 100, 200 or 400 mg/kg FOs-FWB. Data are represented as mean ± SEM. Different letters above bars are significantly different (p < .05). Abbreviations: PPARγ, peroxisome proliferator-activated receptor γ; LPL, lipoprotein lipase; ACC: acetyl-coenzyme A carboxylase; FAS: fatty acid synthase; SCD: stearoyl-coenzyme A desaturase.

Discussion

It has shown that FOs exhibit the biological activity of FA and oligosaccharides, such as antioxidant, immunomodulatory and probiotic physiological effects (Ou and Sun 2014). In our previous, FOs was obtained by fermentation of wheat bran, and the esterified FA content in FOs-FWB was 0.99 mmol/g (Wang et al. 2019b). Furthermore, FOs-FWB can be used as a feed additive in lamb production to improve the growth performance and antioxidant status, thus has application prospects in modifying meat quality and lipid metabolism of lambs. In this study, the effects of FOs supplementation on carcase traits, meat quality, fatty acid composition and lipogenic gene expression of lambs were evaluated for the first time.

The carcase traits of lambs were not affected by dietary supplementation of FOs-FWB. Our results are consistent with previous research that found dietary addition of FA or polysaccharides with antioxidant properties had no influence on carcase characteristics of lambs (González-Ríos et al. 2016; Pereira et al. 2020). Carcase traits are directly related to the pre-slaughter live weight of animals and affected by nutrient consumption. Therefore, the lack of difference might be attributed to the isoproteic and isoenergetic diets used in this study.

Meat colour is a direct factor in judging meat quality and customers’ willingness to buy. Meanwhile, the pH value reflecting the rate and intensity of muscle glycogenolysis after slaughter is another important index of meat quality and related to meat colour and water holding capacity (Li, Wang, et al. 2015). Cooking loss and water loss rate can be used to measure the water-holding capacity of meat. It has been proven that feed additives with great antioxidative capacity could delay glycolysis and oxymyoglobin oxidation and reduce oxidative-induced conformational alterations and fragmentation of myofibrillar proteins (Salami et al. 2015). However, in the present study, some traits of the meat quality such as pH_45 min, L*, a*, b* value, water loss rate and cooking loss were not affected by dietary FOs-FWB supplementation. And the observed pH_45 min, L*, a* and b* values of applied treatments and control group maintained within an acceptable range of lamb meat. These data were in accordance with previous research that found that dietary FA supplementation did not affect the muscle pH and colour of lambs (Valadez-Garcia et al. 2021) and pigs (Li, Li, et al. 2015). Furthermore, Peña-Torres et al. (2021) reported no influence of FA supplementation on the water loss rate and cooking loss of heifers. Further studies are required to elucidate the reason why FOs-FWB did not influence the pH, colour, water holding capacity of lambs.

In the current study, lambs fed FOs-FWB had reduced shear force compared to the control group. Similarly, González-Ríos et al. (2016) found that dietary supplementation of FAs decreased the shear force in crossbred steers. Shear force is used to assess the tenderness of the meat, which is affected by muscle fibre types (Schiaffino and Reggiani 1996). In mice (Chen et al. 2019) and pigs (Wang et al. 2021), FA supplementation triggers a preferential differentiation in muscle from fast glycolytic muscle fibres towards slowly oxidising muscle fibres (type I). Peña et al. (2018) also observed increases in the area and diameter of oxidative fibres response to FA supplementation in lambs. It has been reported that an increase in the proportion of type I fibre reduced the shear force of meat (Choi and Kim 2009). Thus, the positive effects of FOs-FWB on shear force may be due to the altered composition of muscle fibre types.

The content of intramuscular fat (IMF) is closely related to meat quality, such as tenderness and flavour (Joo et al. 2013). To the best of our knowledge, few study has been conducted to examine the effects of FA on the IMF of domestic animals. González-Ríos et al. (2016) reported there is no difference in IMF content of steer fed with and without FA. Similar results were also found by Peña-Torres et al. (2021) that feeding FA did not affect the IMF content of heifers. In contrast, our study shown that the fat content of LD muscle in FOs-FWB groups was higher, which was agreed with the reduction of shear force. The discrepancy in IMF might be caused by the specie, physiological state, oxidative status of animals as well as dosage and supplementation period of FA.

The proportional composition of fatty acids in meat is conventionally used for evaluating the nutritional and healthy values of meat (Cabrera and Saadoun 2014). The levels of unsaturated fatty acids (UFA) in the mutton are known to influence the fat firmness, meat nutritional value and consumers’ acceptance. Especially, the percentage of long-chain n-3 PUFA, such as C18:3n − 3 (α-linolenic acid, ALA), C20:5n − 3 (docosapentaenoic acid, DPA), and C22:6n − 3 (docosahexaenoic acid, DHA) are beneficial for preventing atherosclerosis and cardiovascular disease and promoting immune function of human. In this study, we found that the C22:6n − 3 and total PUFA proportion in lipids of LD muscle were increased by dietary FOs-FWB supplementation. The modulating effects of FOs-FWB on the fatty acids profile of LD muscle might partly be attributed to FA, which could be released in the rumen (Yue et al. 2009). Consistent with our findings, González-Ríos et al. (2016) reported that a diet containing FA could increase the percentage of PUFA in the muscle of steers. Phenolic compounds have been proven to modify the rumen microbiota and reduce the probability of biohydrogenation of UFA in the rumen (Cabiddu et al. 2010; Jayanegara et al. 2011; Jafari et al. 2016). It was confirmed that the PUFA proportion in lipids of mutton was increased by the dietary addition of plant polyphenols (Cimmino et al. 2018; Smeti et al. 2021). Furthermore, in the present study, feeding 200 mg/kg FOs-FWB significantly decreased proportions of C14:0 and total SFA, but increased proportions of C18:2n − 6, total MUFA and UFA to SFA ratio. Thereby our data indicate that the inclusion of 200 mg/kg FOs-FWB is a superior choice.

Furthermore, the mRNA expression of a gene involved in fatty acid metabolism in the LD muscle were analysed in this study. Notably, this is the first study to investigate the effects of FOs-FWB on transcripts of fatty acid metabolic genes in the muscles of lambs. Of these genes, LPL was found to be involved in fatty acid uptake, and FAS and ACC were responsible for de novo fatty acid synthesis (Deng et al. 2018). In this study, along with increased IMF level in LD muscle, mRNA expression of LPL, FAS and ACC was upregulated by dietary supplementation of 200 and 400 mg/kg FO-FWB. Furthermore, Δ9 desaturase (encoded by the SCD gene) participates in the formation of MUFA, mainly C16:1 and C18:1n − 9, from SFA in ruminants (Daniel et al. 2004). As expected, FOs-FWB supplementation at 200 and 400 mg/kg upregulated mRNA expression of SCD, which is in agreement with the higher C18:1n − 9 proportion in lipids of LD muscle. However, in contrast with our results, Milojevic et al. (2020) did not observe any effect caused by the dietary plant extracts (rich in phenolic compounds) on the above genes expression of ewes. The inconsistent findings may result from factors such as the growth stages of lambs, rearing environment, additives kinds and dietary nutrition level.

PPARγ plays an important role in the induction of adipocytes differentiation and adipogenesis of mature adipocytes (Kersten et al. 2000; Perera et al. 2006), thus acts as an important regulator of IMF content in animals (Yang et al. 2019; Mohammadpour et al. 2020). It has been proven that the transcription of genes involved in lipid metabolism, such as LPL, FAS, and ACC are negatively correlated with the activation of PPARγ (Takahashi et al. 2002; Ilavenil et al. 2015). Based on molecular dynamics stimulation studies and stability of binding, FA was predicted to be a potential PPARγ inhibitor (Senthil et al. 2021). Yin et al. (2022) suggested that FA could downregulate the expression of PPARγ in zebrafish. Similarly, in this study, the expression of PPARγ in LD muscle of lambs fed 50 mg/kg FOs-FWB was lower than the control group, and lambs fed 200 mg/kg FOs-FWB had similar PPARγ expression level. Therefore, we speculated that the addition of FOs-FWB may achieve the aforementioned effects by activating PPARγ signalling pathway. However, additional studies are needed to comprehensively evaluate protein-level changes of PPARγ, LPL, FAS, ACC and SCD.

Conclusions

The present study provides the first evidence that dietary supplementation of FOs-FWB can reduce shear force, enhance intramuscular fat content and PUFAs proportion and stimulate lipogenic gene expression in longissimus dorsi of lambs. The recommended dietary addition dosage of FOs-FWB is 200 mg/kg for improving the meat quality of lambs.

Ethics statement

This animal study protocol was approved by the Institutional Ethics Committee of Inner Mongolia Agricultural University (protocol code NND201712 and 6 April 2017 of approval.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data that support the findings of this study are available from the corresponding authors upon reasonable request.

Additional information

Funding

This research was funded by National Natural Science Foundation of China [32260840], Major Science and Technology Program of Inner Mongolia Autonomous Region [2021ZD0024-4, 2020ZD0004].