Methyltransferase like 21C interaction with Hsc70 affects chicken myoblast differentiation

Abstract

Skeletal muscle has an essential role in boiler production, which depends on the muscle fibre development during the embryonic stage. Whereas the posttranslational modifications of both histone and non-histone proteins are known to regulate postnatal muscle development, the biological significance of non-histone methylation is poorly understood. Recently, the methyltransferase like 21 C (METTL21C) is identified as a non-histone lysine methyltransferase whose role in chicken muscle function remains elusive. In this study, METTL21C was found by comparing free-range and caged modes in Lueyang black-boned chicken aged 60 and 120 days. Quantitative real-time PCR (qPCR) analysis demonstrated that METTL21C was mainly enriched in chicken soleus (SOL) and gastrocnemius muscle (GA) (p < .05). Meanwhile, METTL21C had a rapid increase during chicken myoblast differentiation. After METTL21C overexpression, myogenic differentiation (MyoD) and myogenin (MyoG) expression were significantly increased, indicating that METTL21C promotes chicken myoblast differentiation. Using co-immunoprecipitation (Co-IP) and liquid chromatography-mass spectrometry (LC-MS/MS) analysis, heat shock cognate 71 kDa protein (Hsc70) was confirmed to interact with METTL21C, while the effects of Hsc70 Lys-561 (Hsc70 K561) mutation suggested that Hsc70 was a METTL21C target protein. These results identify the molecular mechanism of METTL21C interaction with Hsc70 associated with chicken myoblast differentiation in the postnatal period.

Highlights

• The mRNA of methyltransferase like 21C (METTL21C) was significantly increased in free-rang mode and during the chicken myoblast differentiation.

• Overexpression of METTL21C promoted the primary chicken myoblasts proliferation and differentiation.

• METTL21C could mediate the lysine methylation modification of heat shock cognate 71 kDa protein (Hsc70) to regulate the proliferation of chicken myoblasts.

Keywords:

• Chicken
• METTL21C
• Hsc70
• myoblast
• differentiation

Introduction

Skeletal muscle is a heterogeneous tissue, which includes two general types of myofibers: the slow-twitch (type I) and fast-twitch (type II) myofibers (Schiaffino and Reggiani 2011). The growth and development stability of skeletal muscle is arranged by a complex regulatory network that includes many function genes, transcription factors and signal pathways, which may interact with each other (Cui et al. 2021). Several studies have investigated gene expression levels during chicken skeletal muscle growth. However, there are few published studies on the valuable gene of chicken breeds. As germplasm resource of local breeds in China, Lueyang black-bone chickens form strong disease resistance and excellent meat quality during its breeding (Zhang et al. 2015).

With the advent of post-genomic era, genomics technologies have become widely used in the field of poultry (Jingting et al. 2017; Liu et al. 2019; Hu et al. 2021). They have become the preferred technologies for screening candidate genes and explaining biological problems of muscle development. Previous studies have demonstrated that METTL21C is exclusively expressed in slow muscle fibres (Wiederstein et al. 2018; Wang et al. 2019), which play a great role in meat quality. A previous study employed genome-wide identification of chicken METTL21 family and analysed their transcriptional expression profile in the muscle, indicating that these genes are involved in the development of Lueyang black-bone chicken muscle (Yang et al. 2019). Besides, METTL21C also involved in stress-related signalling that might be affecting Ca²⁺ transport and oxidative metabolism pathways in high pH muscles (Jerez-Timaure et al. 2019). Until now, the latest research results reported that METTL21C was a potential candidate gene associated with the high adaptive ability of chickens (Fedorova et al. 2022) and improved production performance of layers by regulating uterus function (Ma et al. 2023). However, there is a lack of direct physiological evidence of METTL21C in chicken muscle.

At the posttranslational level, the methylation alters the hydrophobic and steric properties of lysine or arginine residue, leading to changes in protein-protein interactions, protein-DNA/RNA interactions and protein stability (Hamamoto et al. 2015). Meanwhile, the biological significance of non-histone methylation in modulating gene expression and protein stability has drawn increasing attention. METTL21C is a newly classified non-histone lysine methytransferase. Recently, many studies identified that METTL21C had a key role in the regulation of myogenesis (Wang et al. 2019; Zoabi et al. 2020). However, the function of METTL21C regulating chicken myoblast differentiation has not yet been elucidated.

In the present study, we performed an RNA-seq analysis of the thigh muscle of Lueyang black-bone chickens at different growth stages. We selected a key DEG METTL21C from RNA-seq and hypothesised that METTL21C contributed to chicken myoblast differentiation in the postnatal period. The reported results could explore a mechanism of METTL21C in myoblast differentiation and provide a molecular basis for selection work.

Materials and methods

Animals and samples collection

Lueyang black-boned chickens were operated by a commercial supplier (Hanzhong, Shaanxi province). The animals were divided into 60-day-old and 120-day-old, caged and free-range, with 3 cocks in each group, respectively. The extensor digitorum longus (EDL), soleus (SOL) and gastrocnemius (GA) muscles were collected and frozen for mRNA isolation and RNA-seq.

The 30 E10 embryos in genetically similar were used to isolate the chicken’s leg muscle primary myoblast. Samples were washed by the precooled phosphate buffered saline (PBS) (pH 7.4), then were incubated with 0.2% collagenase I (Beyotime, China) and 0.25% trypsin (Beyotime, China) for 40 min and 8 min, respectively. After filtering, the adherent cells were directly grown on a culture dish. The myoblasts were cultured in a DMEM (Gibco, US) supplemented with 20% FBS (Gibco, USA) and 1% penicillin/streptomycin (Beyotime, China) in an incubator containing 5% CO₂ at 37 °C. The cultures grown prior to being induced were maintained for 10 days and changed medium every 2 days. At fifth day during cultured period, cells were cultured in differentiation medium (DM), DMEM containing 2% horse serum (Gibco, USA), until 90% confluence was reached.

RNA extraction and sequencing

Total RNA was isolated from the thigh muscle using the Trizol reagent (Sigma, USA) . The purity and amount of RNA were detected, then the following protocols were performed by staff at the Personal bio Co., Ltd., Shanghai, China. The main context was descripted in previous research (Cheng et al. 2021). This BioProject accession number is PRJNA957726.

Data analysis

According to the methods described by Yang et al. (2019), the assembled RNA-seq data were used to quantify the expression levels of these genes based on their fragments per kilobase of exon per million reads mapped (FPKM) values using Cufflinks with default parameters (Grabherr et al. 2011). The HemI 1.0 software was used with default parameters for each gene expression level (Li et al. 2015). The different expression genes in the two feeding modes between 60-days-old and 120-days-old were shown in Table S1.

Quantitative real-time PCR confirmation (qPCR)

cDNA was synthesised using a reverse transcription kit (Takara, Japan) and approximately 600 ng of total RNA per reaction. qPCR method was used to assess differential genes expression levels. The β-actin was the housekeeping gene. The primer sequences of genes were listed in Table S2.

We performed qPCR with 20 μL mixture containing 1 μL of cDNA, 10 μL of 2 ×SYBR green Mix (Invitrogen, CA, US), 0.5 μL each of the forward and reward primers (10 μM) and double-distilled water. The qPCR reaction procedure was as follows: 95 °C for 30 s; 40 cycles at 95 °C for 5 s, 60 °C for 30 s, 72 °C for 30 s; followed by 72 °C for 5 min. The qPCR was performed on an ABI StepOne plus system. The 2^−ΔΔCT method was employed to estimate the expression levels of candidate genes.

Plasmids construction and cell transfection

To construct the METTL21C and HSC70 plasmids, the full length of METTL21C and HSC70 was amplified by normal PCR, which primers included BamH I and EcoR I at 5′-ends of forward and reward primers, respectively (Table 1). The PCR was performed with a 50 μL reaction mixture containing 1 μL of cDNA, 10 μL of Q5 buffer (NEB, US), 8 μL dNTP, 2 μL each of the forward and reward primer (10 μM) and double-distilled water. The PCR reaction procedure was as follows: 94 °C 3 min, 30 cycles at 94 °C 30 s, 56 °C 30 s and 72 °C 30 s; followed by 72 °C for 10 min. The PCR products were digested with BamH I and EcoR I (NEB, US), and the purified fragment was ligated into pCD513B-FLAG and pcDNA3.1-HA plasmid to obtain the recombinant plasmids, respectively.

Table 1. Primers information for genes PCR.

Gene symbol	Sequences (5'→3')
METTL21C	F: ccgGAATTCCCCAACAAAATGCAAAG
	R: cgcGGATCCAGTTCTCTCTTACCGTGGCTT
Hsc70	F: cgGGATTCATGTACCCATACGACGTCCCAGACTACGCTTCTGGCAAAGGGCCG
	R: ccgGAATTCTTAATCTACTTCTTCAAT
Hsc70(K561)	F: TGGAGGATGAGAAACTGGCGGGAAAGATCAGTGACCA
	R: TGGTCACTGATCTTTCCCGCCAGTTTCTCATCCTCCA

Abbreviations: METTL21C, methyltransferase like 21 C; Hsc70, heat shock cognate 71 kDa protein; K, lysine; F, forward primer; R, reversed primer.

Note: The lowercase part is the enzyme site.

The pcDNA3.1-HA-Hsc70 (K561A) was generated using Overlap PCR. In brief, the pcDNA3.1-HA-Hsc70 was amplified by primers (Table 1). PCR products were reacted with Gel purification Kit (NEB, US), and the double enzyme was digested. The cloned DNA sequence was inserted into the pcDNA3.1-HA plasmid. Plasmids were extracted and sequenced to confirm the correct mutation.

The overexpression and Co-IP assay were carried out in cells by transfecting of pCD513B-FLAG-METTL21C and pcDNA3.1-HA-Hsc70/pcDNA3.1-HA-Hsc70 (K561A) into primary myoblast and HEK293T using Lipofectamine2000 (Invitrogen, Carlsbad, CA), respectively. Due to the plasmid containing a resistance gene, puromycin (Beyotime, ST551) was used to screen the cells to further improve the expression efficiency. And then, a cell system with stable expression of exogenous genes was established.

Co-immunoprecipitation and Western blotting

Cultured cells were washed twice with pre-chilled PBS (pH 7.4), followed by the addition of lysis buffer (Beyotime, China). After slowly shaking for approximately 15 min, the cell lysate was centrifuged at 14 000 g, 4 °C for 15 min. Primary antibody (anti-FLAG, CST, 2367S; anti-HA, CST, 8146 T) was added and incubated with the cell lysate supernatant overnight at 4 °C, after which protein A agarose beads (Beyotime, China) were added. Samples were incubated with gentle rocking. The beads were washed with PBS, followed by adding SDS loading buffer for re-suspending. The sample was heated and micro-centrifuged at 14 000 g. Western blotting was performed as previously described (Xu et al. 2019). Primary antibody (anti-MyoG, DSHB, AB2146602; anti-Pax7, DSHB, AB528428; anti-β-actin, CST, 12262S; anti-methylated lysine, CST, 14117S) diluted in 1% BSA, after which they were washed and incubated at room temperature with the goat anti-mouse-HRP (Cwbio, CW0102). Chemiluminescence solution (Beyotime, China) was used for colour rendering.

LC-MS/MS analysis

The tryptic peptides were dissolved in solvent A (0.1% formic acid) and directly loaded onto a homemade reversed-phase analytical column. The gradient included an increase from 6% to 25% of solvent B (0.1% formic acid in 98% acetonitrile) over 16 min, 25% to 40% in 6 min and climbing to 80% in 4 min, then retaining at 80% for 4 min; all at a constant flow rate of 700 nl/min on an EASY-nLC 1000 UPLC system.

The peptides were subjected to NSI source followed by tandem mass spectrometry (MS/MS) in Q Exactive^TM Plus (Thermo) coupled online to the UPLC. The full scan was used and intact peptides were detected in the Orbitrap at a resolution of 70,000. Next, peptides were selected for MS/MS using an NCE setting of 28, and the fragments were detected in the Orbitrap at a resolution of 17,500. A data-dependent procedure alternated between one MS scan followed by 20 MS/MS scans with 15.0s dynamic exclusion. This work and data processing (Table S3) were supported by PTM biotechnology (Hangzhou, China).

Immunofluorescence assay

Chicken primary myoblast were treated with different plasmid, including pCD513B-FLAG-METTL21C, pcDNA3.1-HA-Hsc70 and pcDNA3.1-HA-Hsc70 (K561A), respectively. Each one was processed with three replicates. The cultured cells was washed with PBS (pH 7.4) and permeabilized with 0.5% Triton X-100 before fixation in 4% paraformaldehyde. Next, the cells were incubated with primary anti-MyHC (DSHB, AB528376) diluted in 1% BSA, after which they were washed and incubated with the secondary antibody Cy3-goat anti-mouse (Boster, BA1031). DNA was visualised using 5 mg/mL DAPI (Boster, AR1176). Finally, the cells were washed and observed with an inverted fluorescence microscope (DFC 450 C, Leica, Germany).

Statistical analysis

All data represent at least three independent experiments, and results were mean ± S.D. Differences between groups were assessed by analysis of variance and significance test using the SPSS v11.5 software. * and ** were considered at p < .05 and p < .01, respectively.

Results

METTL21C regulates the chicken slow muscle formation

Based on the heat maps of the DEGs in the free-range 60-day-old and 120-day-old chickens compared to caged chickens (Figure 1(a)), several genes mRNA levels were analysed by qPCR. The expression of METTL21C was significantly up-regulated comparing between caged and free-range chickens at two ages (p < .01) (Figure 1(b)). To investigate METTL21C expression in chicken muscle, different muscle fibre types were isolated from Lueyang 60-day-old chickens. The result analysis indicated that METTL21C had the highest level in soleus (SOL) than extensor digitorum longus (EDL) and gastrocnemius (GA) muscles (Figure 1(c)). Combining the above results, we speculated METTL21C might involve in the chicken slow muscle formation in the postnatal period. Besides, METTL21C was increased during primary myoblast differentiation (Figure 1(d)). These variations indicated that METTL21C contributed to myoblast differentiation in chickens.

Figure 1. The expression pattern of METTL21C. (a) The heat map was drawn in log10-transformed expression values. Red and blue represent relatively high and low expression, respectively. C represents the caged chicken. F represents the free-ranged chicken. The numbers represent the age of the chickens in days. (b) Five genes mRNA expression levels in thigh muscle comparing between 60-old-day or 120-old-day caged and free-ranged chickens. Data were presented the mean ± S.D., *p<.05, **p<.01. Each sample was measured in triplicate. (c) METTL21C mRNA expression level in the extensor digitorum longus (EDL), soleus (SOL) and gastrocnemius muscle (GA), comparing between 60-old-day caged and free-ranged chickens. Data were presented the mean ± S.D., *p<.05, **p<.01. Each sample was measured in triplicate. (d) The temporal expression of METTL21C during primary myoblast differentiation. Data were presented the mean ± S.D., each sample was measured in triplicate. d, days. Abbreviations: KCND3, potassium voltage-gated channel, Shal-related subfamily, member 3; ATP2A2, ATPase, Ca++ transporting, cardiacmuscle, slow twitch 2; OSGIN1, oxidative stress induced growth inhibitor 1; KCNJ2, potassium inwardly-rectifying channel, subfamily J, member 2; DUPD1, dual specificity phosphatase and proisomerase domain containing 1; SRPK3, SRSF protein kinase 3; PPP1R3C, protein phosphatase 1, regulatory subunit 3C; ABCD4, ATP-binding cassette, sub-family D, member 4; PVALB1, parvalbumin; CD2, CD2 molecule; METTL21C, methyltransferase like 21C; SPSB4, splA/ryanodine receptor domain and SOCS box containing 4; EVA1, Beva-1 homolog B; GOS2, G0/G1switch 2; LCAT, lecithin-cholesterol acyltransferase; TNNC1, troponin C type 1; MUSTN1, musculoskeletal, embryonic nuclear protein 1; GPR157, G protein-coupled receptor 157; SPSB1, splA/ryanodine receptor domain and SOCS box containing 1; NACAD, NAC alpha domain containing; ABHD2, abhydrolase domain containing 2; FGF1, fibroblast growth factor 1; PDK4,pyruvate dehydrogenase kinase, isozyme 4; ELOVL1, ELOVL fatty acid elongase 1; ASB2, ankyrin repeat and SOCS box containing 2; HOPX, HOP homeobox; PDE10A, phosphodiesterase 10A; EEPD1, endonuclease/exonuclease/phosphatase family domain containing 1; FBXO32, F-box protein 32; IRS2, insulin receptor substrate 2; FAM134B, family with sequence similarity 134, member B; GRIN2C, glutamate receptor, ionotropic, N-methyl D-aspartate 2C; GADD45B, growth arrest and DNA-damage-inducible, beta; MT4, metallothionein 4 (the bold genes were detected by qPCR.)

METTL21C promotes chicken myoblast differentiation

To evaluate the METTL21C function in chicken myoblast differentiation, the pCD513B-FLAG-METTL21C and pCD513B plasmids were transfected into chicken primary myoblast cultured in 12-well plates. The results showed that METTL21C mRNA and protein expression were significantly increased in the pCD513B-FLAG-METTL21C groups (p < .01) (Figure 2(a,c)). Meanwhile, the overexpression of METTL21C significantly promoted MyoD, Myf5 and MyoG mRNA levels (p < .05) (Figure 2(b)). The results also demonstrated that the protein level of Pax7 and MyoG in the pCD513B-FLAG-METTL21C group was significantly higher than that of the control group (Figure 2(c)), suggesting that METTL21C promotes the number of satellite cells and myoblast differentiation of chicken skeletal muscle. Interestingly, overexpression of METTL21C increased the abundance of dimethylated and trimethylated peptides by 30% and 50%, respectively (Figure 2(d)).

Figure 2. METTL21C effects on chicken myoblast differentiation. (a) The expression of METTL21C for the recombinant plasmid (pCD513B-21C). Data were presented the mean ± S.D., *p<.05, **p<.01. Each sample was measured in triplicate. (b) The mRNA expression of Pax7, MyoD, Myf5 and MyoG between METTL21C overexpression (pCD513B-21C) and control group (pCD513B). Data were presented the mean ± S.D., *p<.05, **p<.01. Each sample was measured in triplicate. (c) The proteins expression of METTL21C, MyoG and Pax7 between METTL21C overexpression (pCD513B-FLAG-21C) and control group (pCD513B). Each sample was measured in triplicate and the data were representative for one of the three independently repeated experiments. (d) METTL21C increased the dimethylation level in chicken myoblast. Left was detected with dimethyl antibody. Right was detected with trimethyl antibody. Each sample was measured in triplicate and the data were representative for one of the three independently repeated experiments.

METTL21C can methylate Hsc70 at Lys-561

To further investigate the mechanisms of METTL21C in myoblast differentiation, co-immunoprecipitation (Co-IP) and LC-MS/MS were employed to confirm that protein interacted with METTL21C. The results showed that 79 proteins were separately obtained from samples co-precipitation with METTL21C (Figure 3(a)). Hsc70 was found to account for the highest protein score and sequence coverage (%) (Table 2). Further analysis revealed that pCD513B-FLAG-METTL21C and pcDNA3.1-HA-Hsc70 were transfected into HEK293T cells. As expected, METTL21C and Hsc70 were detected in proteins pull-downed by HA and FLAG, respectively (Figure 3(b)). To verify the methylation site, we mutated the Lys-561 to nonmethylatable alanine (A) and used the recombinant Hsc70 (K561A) mutant as a group whilst interrupting the combination between METTL21C and Hsc70 (Figure 3(c)), which suggested that METTL21C could certainly methylate Hsc70 at Lys-561.

Figure 3. METTL21C interacted with Hsc70 at lysine 561 site. (a) The venn plot of differentially expressed proteins from LS-MS/MS. List 1,2,3 represents the three independently repeated experiments. (b) The interaction between METTL21C with Hsc70. Each sample was measured in triplicate and the data were representative for one of the three independently repeated experiments. (c) The interaction between METTL21C with Hsc70 (K561). Each sample was measured in triplicate and the data were representative for one of the three independently repeated experiments. K, lysine; A, alanine.

Table 2. Top10 proteins interaction with METTL21C by LS-MS/MS.

Accession	Protein names	Gene names	MW, kDa	Protein score	Sequence coverage, %
P11142	Heat shock cognate 71 kDa protein	HSPA8/HSC70	71	1245	32.97
P0DMV9	Heat shock 70 kDa protein 1B	HSPA1B	70	1215	35.1
P11021	78 kDa glucose-regulated protein	HSPA5	72	879	29.36
P38646	Stress-70 protein, mitochondrial	HSPA9	74	734	27.39
P08670	Vimentin	VIM	54	640	43.78
Q86YZ3	Hornerin	HRNR	282	608	19.58
P68104	Elongation factor 1-alpha 1	EEF1A1	50	472	27.06
P19338	Nucleolin	NCL	77	460	17.75
P07437	Tubulin beta chain	TUBB	50	410	27.48
P07814	Bifunctional glutamate/proline–tRNA ligase	EPRS	170	405	9.66

METTL21C interaction with Hsc70 regulates myoblast differentiation

To elucidate the possible roles of Hsc70 during chicken myoblast differentiation, the recombinant plasmids were transfected into the chicken primary myoblast (Figure 4(a)). The Western blotting results showed that Pax7 and MyoG expressions were decreased in the pcDNA3.1-HA-Hsc70 group. However, the attenuated effect was rescued in METTL21C and Hsc70 (Figure 4(b)), demonstrating that METTL21C interacting with Hsc70 enhances myoblast differentiation. Importantly, comparison of the Hsc70 group showed that MyoG protein level was reduced in Hsc70 (K561A) group (Figure 4(c)). Immunofluorescence assay for MyHC illuminated that the differentiation of chicken myoblasts was suppressed in Hsc70 (K561A) group (Figure 4(d)). All the above results indicate that METTL21C is involved in the myoblast differentiation through mediating methylation of Hsc70 at Lys-561.

Figure 4. Effects of chicken METTL21C and Hsc70 on myoblast differentiation. (a) Transfection efficiency of myoblasts with pCD513B-FLAG-METTL21C and Hsc70 or Hsc70 (K561A). Both are GFP representing METTL21C. Each sample was measured in triplicate and the data were representative for one of the three independently repeated experiments. K, lysine; A, alanine. (b) The protein expression of MyoG, Pax7 and Hsc70 among different groups. Each sample was measured in triplicate and the data were representative for one of the three independently repeated experiments. (c) MyoG protein expression between Hsc70 and Hsc70 (K561A) group. Each sample was measured in triplicate and the data were representative for one of the three independently repeated experiments. K, lysine; A, alanine. (d) MyHC expression in myoblast differentiation phase between Hsc70 and Hsc70 (K561A) group. Each sample was measured in triplicate and the data were representative for one of the three independently repeated experiments. K, lysine; A, alanine.

Discussion

According to some previous studies, the broiler exercise can affect skeletal muscle fibre types and promote the slow muscle fibres formation (Ono et al. 1993; Ferreira et al. 2010; Azad et al. 2016; Katsumata et al. 2017). In this study, DEGs analysis compared caged and free chicken at two ages showed muscle development was associated with dynamic change of gene regulatory networks. The function of METTL21C was payed attention to. The expression of METTL21C was up-regulated in the free-range group at 60 and 120 days (p < .01), which suggested that METTL21C might be involved in muscle development. Significantly, the free-ranged mode effectively improved formation of the slow muscle fibres and contributed to elevating METTL21C expression (Cheng et al. 2021). Besides, METTL21C was conducive to chicken SOL and myoblast differentiation, which indicated that METTL21C had effect on slow-twitch fibres formation and maturation. Wang et al. found that METTL21C is not required for the development of mice’s skeletal muscle; yet, he also found decreased motor activity in METTL21C KO mice (Wang et al. 2019).

METTL21C has been identified as a pleiotropic gene for skeletal muscle and bone through a genome-wide association study (Huang et al. 2014). In our previous study, we identified that the METTL21C gene family had conservative evolution (Yang et al. 2019). The METTL21C is structurally and functionally similar to chickens, mice and humans. We found that METTL21C was related to the chicken myoblast development by increasing the number of skeletal muscle satellite cells and muscular tube forming. Satellite cells expressing Pax7 have great potential as a large source of endogenous cells (Abou-Khalil et al. 2015). When METTL21C was overexpressed in chicken myoblast, Pax7 and MyoG significantly increased. Inversely, some reports confirmed that METTL21C knockdown impaired the myogenesis of C2C12 myoblasts (Huang et al. 2014). METTL21C KO showed a weak muscle phenotype in vivo (Wiederstein et al. 2018).

METTL21C has been identified as a type I myofiber-specific methyltransferase. The latest research revealed that METTL21C mediated the lysine trimethylation modification of IGF2BP1 (insulin-like growth factor 2 mRNA-binding protein 1) to regulate the proliferation of chicken myoblasts (Wang et al. 2023). In this study, the METTL21C overexpression revealed a visible methylation difference in chicken myoblast. Our results also indicated that METTL21C methylated Hsc70 at Lys-561 in chicken muscle. Consistent with the human cells, METTL21C physically interacts with heat shock 70 kDa (HSPA) proteins (Cloutier et al. 2013). Collectively, these data suggested that METTL21C could promote chicken myoblast differentiation by interacting with Hsc70. Other studies showed that heat shock 70 kDa protein 8 (Hspa8) acted as a novel substrate of Mettl21c and pinpointed Lys-561 as the specific residue being trimethylated (Wang et al. 2019). Interestingly, human Hspa8 was trimethylated at Lys-561 by METTL21A, a paralog of METTL21C (Jakobsson et al. 2013). A recent report identified alanine tRNA synthetase 1 (AARS1) as a direct substrate of METTL21C (Zoabi et al. 2020).

METTL21C is a lysine methyltransferase implicated in muscle biology that has been reported to methylate Hsc70/Hspa8. It was noteworthy that the chicken myoblast differentiation was enhanced when METTL21C and Hsc70 treated together. At the functional level, Lys-561 methylation of Hspa8/Hsc70 reduces the Hspa8 ubiquitination, which prevents ubiquitin-mediated proteasomal degradation of Hspa8/Hsc70 and stabilises Hspa8/Hsc70 (Zhang et al. 2015). At the posttranslational level, Hspa8/Hsc70 participates in the chaperone-mediated autophagy (CMA) program (Stricher et al. 2013). Also, Hspa8^OE reduced the protein levels of Mef2A and Mef2D (Wang et al. 2019). Thus, the mutation of Hsc70 may contribute to impaired autophagy and reduce chicken myoblast differentiation. Our study established METTL21C as a regulator of Hsc70 in response to chicken slow-twitch muscle fibres formation.

Conclusions

Our studies suggest that METTL21C is a significant protein for chicken muscle development and Hsc70 provides a potential target of METTL21C to regulate the primary chicken myoblasts differentiation.

Ethical approval

All animal experiments were performed following the ‘Guide for the Care and Use of Laboratory Animal’ of the Institutional Animal Care and Use Committee of Shaanxi University of Technology (SLGQD/09/2017) and in accordance with a protocol approved by the animal use committee of the Chinese Ministry of Agriculture.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.

Additional information

Funding

This study was supported by Scientific Research Project of Shaanxi University of Technology (SXC-2101). Shaanxi Union Research Centre of University and Enterprise for Zhenba Bacon.