Effects of rutin on laying performance, egg quality, serum biochemistry, antioxidant capacity and immunity in laying hens fed a diet containing stored soybean meal

Abstract

This study aimed to investigate the effects of rutin on laying performance, egg quality, serum biochemical parameters, serum immunoglobulin, and antioxidant status in laying hens fed a diet containing stored soybean meal (SBM). The dietary treatments used were arranged in a 2 × 2 factorial arrangement with 2 types of SBM (FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days and was considered as fresh SBM; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days) and 2 levels of rutin (0 and 500 mg/kg). In total, 384 Hy-Line Brown laying hens (220 days of age) were randomly divided into 4 groups with eight replicates. Pre-feeding period was 1 week, and the experiment lasted for 8 weeks. The results showed that the RTSM diet had no effect on laying performance (p > 0.05). Compared with the diet without rutin, diet with 500 mg/kg rutin exhibited a tendency to increase egg mass compared with the diet without rutin (p = 0.096), and there was a trend of interaction effect on average egg weight (p = 0.061). The RTSM diet decreased the egg Haugh unit significantly compared with the FSM diet at the end of 8th week (p < 0.05). Compared with the diet without rutin, dietary rutin supplementation could affect egg quality as evidenced by increased eggshell thickness, albumen height, egg yolk colour at the end of 4th week and increased eggshell strength and eggshell thickness at the end of 8th week (p < 0.05). Furthermore, dietary rutin supplementation increased urea nitrogen, decreased the immunoglobulin M (IgM) content in serum compared with the diet without rutin (p < 0.05). Compared with the diet without rutin, dietary supplementation with rutin improved the total antioxidant capacity in the serum and liver (p < 0.05). The interactions of SBM × Rutin were observed on egg yolk ratio at the end of 8th week, and the urea nitrogen and IgM content in serum. These findings suggested that diet with RTSM had adverse effects on egg quality in laying hens. The RTSM diet negatively impacted egg quality of laying hens over time when compared to the FSM diet. Dietary rutin supplementation could improve the egg quality, and antioxidant capacity of laying hens.

Highlights

• Dietary with soybean meal stored in room temperature warehouse reduced egg quality of laying hens.

• Dietary rutin supplementation improved egg quality and antioxidant capacity of laying hens independent of stored SBM.

• There was a significant interaction between stored soybean meal and rutin on egg yolk ratio, serum UN and IgM levels.

Keywords:

• Soybean meal
• rutin
• laying hen
• egg quality
• antioxidant capacity

Introduction

Exogenous factors such as oxidative deterioration of feed ingredients can increase free radical production in the body and alter redox balance (Surai et al. 2019). The change in redox balance during the breeding of laying hens will lead to an impairment in immunological function and endocrine dysfunction, which will result in a decrease in egg production rate and egg quality (Mignon-Grasteau et al. 2015). SBM is one of the most significant protein feed sources, and it is widely used in cattle, poultry, and aquatic feed due to its reasonable amino acid profile and high protein content (Beski et al. 2015). Affected by the supply of raw materials and market fluctuations, the storage of SBM is an inevitable procedure in a series of processes from the production of SBM to the delivery to feed mill production and farm use. SBM protein oxidation is influenced by storage temperature and humidity (Lu et al. 2017; Wang et al. 2020). Study showed that the molecular structure of soy protein could be modified by storage condition, e.g. high temperature and humidity can easily lead to heat up and mildew of SBM (Wright 1981). According to studies, when storage time was extended, the protein carbonyl level in SBM increased while the sulfhydryl content declined, indicating that the protein was oxidised (Wu et al. 2014). Heat-oxidised soy protein showed a significant increase in protein carbonyl formation and a decrease in DPPH free radical-scavenging activity (Tang et al. 2012). Heating can promote protein oxidation in SBM, and heat induced SBM protein oxidation can lower broiler growth performance and degrade antioxidant status (Lu et al. 2017). Storage of SBM reduces egg Haugh unit and albumen height and antioxidant capacity of eggs and muscle (He et al. 2019; Wang et al. 2020).

Flavonoids have been used in health promotion and disease prevention because of their anti-inflammatory (Kim et al. 2004; Tungmunnithum et al. 2018), antioxidant and other biological effects (Burda and Oleszek 2001; Kamboh et al. 2019). In laying hens, flavonoids have been shown to improve egg production and feed conversion (Liu et al. 2014), extend egg shelf life (Simitzis et al. 2018), and enhance the antioxidant status of laying hens exposed to a stress stimulator (Iskender et al. 2017). Rutin is a flavonoid that may be found in a variety of plants and fruits (Li et al. 2014). Rutin reduced lipid peroxidation and displayed substantial DPPH radical scavenging capacity, and decreased ROS levels and exerted protective effects under conditions of oxidative stress (Yang et al. 2008; Choi et al. 2016). Chen et al. (2022) found that diet containing 500 mg/kg rutin significantly increased average daily feed intake, body weight, average daily gain, feed conversion ratio, and the level of IgA in serum of broilers. Diet containing 1 g/kg rutin improved growth, enhanced antioxidant capacity and the immune activity in broilers (Hassan et al. 2018; Awad et al. 2019). These results suggest that rutin is a promising feed additive for poultry and may have a protective effect on laying hens.

Protein oxidation occurs in SBM during storage and has a negative impact on poultry health when utilised as a feed source. It is expected that methods such as antioxidants will reduce the potential detrimental effects of stored SBM on poultry. Therefore, this study was conducted to investigate the effects of dietary rutin supplementation on laying performance, egg quality, serum biochemical indices, serum immunity, and antioxidant function in laying hens fed a diet containing stored SBM.

Materials and methods

Animals, housing, and treatment

All procedures were conducted under the guidelines of Nanjing Agricultural University Institutional Animal Care and Use Committee (Certification No.: SYXK(Su)2017-0007).

SBM was purchased from Yihai Grain and Oil Industry Co., Ltd. (Jiangsu, P.R. China). Fresh SBM after production was immediately divided into two groups for storage: one part was stored in the cold storage warehouses at −20 °C for 45 days as FSM; and the other was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days as RTSM. The carbonyl and sulfhydryl content of the FSM and RTSM were determined after storage. FSM had a carbonyl content of 7.89 nmol/mg protein and a sulfhydryl content of 8.02 nmol/mg protein. RTSM had a carbonyl content of 9.40 nmol/mg protein and a sulfhydryl content of 6.58 nmol/mg protein. It showed that protein oxidation occurred in RTSM. Rutin purity was confirmed to be 96% using high-performance liquid chromatography (HPLC) diffraction. A total of 384 220-day-old Hy-Line Brown laying hens were obtained from a commercial farm and were divided into four treatments, each consisting of eight replicates of 12 laying hens. After a one-week pre-experiment, laying hens were fed with four diets. The four treatments were designated as follows: FSM basal diet; RTSM basal diet; FSM diet supplementation with 500 mg/kg rutin; RTSM diet supplementation with 500 mg/kg rutin. And FSM was considered as fresh SBM, as the control group. The research lasted for eight weeks. Table 1 shows the composition and nutritional levels of commercial basal diets (Mechanized Chicken Farm in Panchu, Nanjing, China), which were designed based on the recommendation by the National Research Council (NRC). The hens had free access to feed and water during the experiment and were kept on a 16-hour/8-hour light/dark cycle, and a wet curtain was used for ventilation and cooling. Daily feed intake, egg production, and mortality (culling) were recorded in replicates.

Table 1. Composition and nutrient level of basal diet (as fed basis unless otherwise stated).

Item	Content
Ingredient (%)
Corn	64
Soybean meal	24
Limestone	9
Premix^a	3
Calculated nutrient levels
Apparent metabolisable energy (MJ/kg)	11.04
Crude protein (%)	16.16
Lysine (%)	0.80
Methionine + cystine (%)	0.62
Methionine (%)	0.34
Calcium (%)	3.6
Total phosphorus (%)	0.56
Available phosphorus (%)	0.37

^aSupplied per kg of diet: Vitamin A, 10,000 IU; vitamin D3, 3000 IU; vitamin E, 30 IU; vitamin K3, 1 mg; vitamin B1, 1 mg; vitamin B2, 6 mg; vitamin B6, 3 mg; pantothenic acid, 10 mg; vitamin B12, 0.02 mg; nicotinamide, 40 mg; folic acid, 0.3 mg; biotin, 0.1 mg; choline chloride, 500 mg; Fe (ferrous sulfate), 80 mg; Cu (copper sulfate), 8 mg; Mn (manganese sulfate), 100 mg; Zn (zinc oxide), 65 mg; I (calcium iodate), 0.8 mg; Se (sodium selenite), 0.3 mg; calcium, 3.6 g; phosphorus, 2.4 g; methionine, 1 g; sodium chloride, 3 g.

Sample collection

We recorded daily total egg weight, number of eggs, broken eggs, and the survival number of laying hens in each replicate. In addition, at the end of experiment, we recorded the amount of feed consumed in each replicate. Then, laying rate, average egg weight, average daily feed intake, egg mass, and feed to egg ratio during the trial was calculated. Two eggs were randomly selected from each replication for the determination of egg quality at the end of the fourth and eighth weeks of the experiment. One bird per replication (8 birds per treatment, a total of 32 birds) was randomly selected for sampling at the end of the feeding study (8 weeks). Blood samples were taken from the wing vein puncture and centrifuged at 4 °C at 3500 × g for 15 min to separate the serum for further examination. The birds were then killed by cervical dislocation, and immediately necropsied. The liver was collected, snap-frozen in liquid nitrogen and stored at −80 °C. Meanwhile, the right lobe of the liver was removed, washed in phosphate-buffered saline, dried with filter paper, and kept at −20 °C for further examination.

Egg quality

The eggshell strength was measured using a compression tester (Model-II, Robotmation, Tokyo, Japan). At three distinct sites, the eggshell thickness was measured with a micrometer (air cell, equator, and sharp end). An egg quality tester was used to measure egg albumen height, Haugh unit, and egg yolk colour (EMT-5200, Robotmation, Tokyo, Japan). An egg separator was used to separate the egg white and egg yolk completely, and then weigh the egg yolk with an electronic balance. Egg yolk ratio = egg yolk weight (g)/egg weight (g).

Measurement of biochemical parameters, immunoglobulin, and antioxidant parameters in serum

The biochemical kits were used to measure the biochemical parameters of glucose (GLU), triglyceride (TG), total cholesterol (TC), total protein (TP), albumin (ALB), globulin (GLOB), urea nitrogen (UN), low-density lipoprotein (LDL), and high-density lipoprotein (HDL) (Jiancheng Institute of Bioengineering, Nanjing, China). Globulin (GLOB) content was calculated from the difference between serum total proteins and albumin content. Serum levels of immunoglobulin A (IgA), immunoglobulin G (IgG), and immunoglobulin M (IgM) were determined according to the manufacturer’s recommendations using corresponding Elisa kits (Jiancheng Institute of Bioengineering, Nanjing, China). Using commercial kits, the level of malondialdehyde (MDA), the activity of total superoxide dismutase (SOD), total antioxidant capacity (T-AOC), and glutathione peroxidase (GSH-Px) in serum were determined according to the manufacturer’s instructions (Jiancheng Institute of Bioengineering, Nanjing, China).

Measurement of antioxidant parameters and mRNA expression in the liver

Liver samples were homogenised to analyse the antioxidant capacity. The level of MDA, the activities of SOD, T-AOC, and GSH-Px of the liver were determined using commercial kits according to the manufacturer’s instructions (Jiancheng Institute of Bioengineering, Nanjing, China). The activities of T-AOC, SOD, and GSH-Px were expressed in U/mg protein, and the MDA level was shown in nmol/mg protein, respectively.

Total RNA was extracted from each liver sample using RNAiso Plus according to the manufacturer’s instructions (TaKaRa, Dalian, China). The RNA quality and quantity were then assessed using a Nano Drop ND-1000 to detect optical density at 260 and 280 nm (Nano Drop Technologies, Wilmington, DE). The RNA samples were then diluted to a final concentration of 0.5 μg/μL with diethyl pyrocarbonate-treated water, and reverse-transcribed into cDNA using the Prime Script RT Master Mix reagent kit according to the manufacturer’s instructions (TaKaRa Biotechnology Co., Ltd.). The relative mRNA expression of target genes was assessed using quantitative real-time PCR. The primer sequences, including glutathione peroxidase 1 (GPX1), glutathione S-transferase theta 1 (GSTT1), superoxide dismutase 1 (SOD1), superoxide dismutase 2 (SOD2), β-actin and their gene bank ID numbers are presented in Table 2. The relative changes in mRNA expression levels determined from RT-PCR were calculated according to the 2^–△△CT method (Livak and Schmittgen 2001).

Table 2. Sequences for real-time PCR primers.

Genes^a	Gene Bank ID		Primer Sequence (5′’-3′’)	Product length (bp)
GPX1	NM_001277853.1	F	CGCTACAGCCGCCACTT	287
		R	TTCGGAGAATCCCACAACG
GSTT1	NM_205365.1	F	GACGGAGACTTCACCCTAGCAGA	87
		R	TGATGGGTACCAGTGGTCAGGA
SOD1	NM_205064.1	F	TTGTCTGATGGAGATCATGGCTTC	98
		R	TGCTTGCCTTCAGGATTAAAGTGAG
SOD2	NM_204211.1	F	CAGATAGCAGCCTGTGCAAATCA	86
		R	GCATGTTCCCATACATCGATTCC
β-actin	NM_205518	F	TGCTGTGTTCCCATCTATCG	150
		R	TTGGTGACAATACCGTGTTCA

^aGPX1: glutathione peroxidase 1; GSTT1: glutathione S-transferase theta 1; SOD1: superoxide dismutase 1; SOD2: superoxide dismutase 2.

Statistical analysis

Data were expressed as means and standard error of mean (SEM). All data were analysed by a two-way ANOVA via a general linear model (GLM) included the main effects of SBM, Rutin and SBM × Rutin interaction using SPSS 19.0 software. When an effect was significant, the Tukey’s multiple comparison test in a one-way ANOVA was performed to examine differences across groups. The difference was considered significant at p < 0.05. The ANOVA test with p between 0.05 and 0.10 was considered a trend towards significance.

Results

Laying performance

As shown in Table 3, compared with the FSM diet, the RTSM diet had no effect on laying performance (p > 0.05). Compared with the diet without rutin, diet with rutin exhibited a tendency to increase egg mass compared with the diet without rutin (p = 0.096). Furthermore, there was a trend of interaction effect on average egg weight (p = 0.061).

Table 3. Effect of rutin on laying performance of laying hens fed a diet containing stored soybean meal.

Treatment^a		Items^b
SBM	Rutin (mg/kg)	Laying rate (%)	Average egg weight (g)	ADFI (g)	Egg mass (g)	Feed-to-egg ratio
FSM	0	87.33	60.27	121.01	52.62	2.30
	500	89.84	61.10	123.06	54.86	2.25
RTSM	0	88.67	60.72	122.58	53.85	2.27
	500	91.56	59.98	121.85	54.92	2.22
SEM^c		0.82	0.21	0.59	0.49	0.02
Main effect
SBM
FSM		88.58	60.68	122.04	53.74	2.28
RTSM		90.11	60.35	122.21	54.38	2.25
Rutin
0		88.00	60.50	121.79	53.23	2.29
500		90.70	60.54	122.45	54.89	2.23
p-Value^d
SBM		0.353	0.407	0.941	0.509	0.416
Rutin		0.107	0.924	0.452	0.096	0.146
SBM × Rutin		0.909	0.061	0.364	0.545	0.995

^aSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at –20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^bADFI: average daily feed intake.

^cSEM: standard errors of mean (n = 8).

^dp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Egg quality

Egg quality at the end of the fourth week was shown in Table 4. Compared with the FSM diet, the RTSM diet did not affect egg quality (p > 0.05). Compared with the diet without rutin, dietary rutin increased eggshell thickness, albumen height, and yolk colour (p < 0.05), and tended to raise Haugh unit (p = 0.075) and egg yolk ratio (p = 0.074). However, no SBM × Rutin interaction was found in egg quality (p > 0.05). Egg quality at the end of the eighth week was shown in Table 5. The RTSM diet reduced egg albumen height when compared to the FSM diet (p < 0.05). Compared with the diet without rutin, dietary rutin supplementation increased eggshell strength and eggshell thickness significantly (p < 0.05). Furthermore, there was an interaction between SBM and rutin for egg yolk ratio (p < 0.05).

Table 4. Effect of rutin on egg quality of laying hens fed a diet containing stored soybean meal at the end of fourth week.

Treatment^c		Items
SBM	Rutin (mg/kg)	Eggshell strength (kg/cm2)	Eggshell thickness (μm)	Albumen height (mm)	Yolk colour	Haugh unit	Egg yolk ratio (%)
FSM	0	4.46	331.11	7.73	6.22	88.19	26.59
	500	4.62	347.96	8.93	8.94	93.79	28.23
RTSM	0	4.45	318.29	8.49	6.28	91.81	27.08
	500	4.57	356.17	8.88	9.24	93.56	27.48
SEM^d		0.09	3.91	0.16	0.28	1.03	0.28
Main effect
SBM
FSM		4.54	339.53	8.33	7.58	90.99	27.41
RTSM		4.51	337.23	8.68	7.76	92.68	27.28
Rutin
0		4.46	324.70^b	8.11^b	6.25^b	90.00	26.83
500		4.60	352.06^a	8.90^a	9.09^a	93.68	27.85
p-Value^e
SBM		0.876	0.708	0.230	0.893	0.402	0.782
Rutin		0.451	< 0.001	0.010	< 0.001	0.075	0.074
SBM × Rutin		0.914	0.095	0.172	0.126	0.343	0.255

^a,bMeans with different superscripts within a column differ significantly (p < 0.05).

^cSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^dSEM: standard errors of mean (n=8).

^ep-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Table 5. Effect of rutin on egg quality of laying hens fed a diet containing stored soybean meal at the end of eighth week.

Treatment^c		Items
SBM	Rutin (mg/kg)	Eggshell strength (kg/cm^2)	Eggshell thickness (μm)	Albumen height (mm)	Yolk colour	Haugh unit	Egg yolk ratio (%)
FSM	0	4.79	323.94	9.00	6.00	91.29	26.38
	500	5.28	343.73	8.98	5.38	95.09	25.76
RTSM	0	4.63	324.56	8.29	4.91	89.41	24.74
	500	5.11	347.44	8.11	5.21	89.53	27.19
SEM^d		0.09	3.49	0.13	0.19	1.49	0.36
Main effect
SBM		5.03	333.83	8.99^a	5.69	93.19	26.03
FSM		4.87	336.00	8.20^b	5.06	89.47	25.85
RTSM
Rutin
0		4.71^b	324.25^b	8.65	5.46	90.35	25.51
500		5.20^a	345.58^a	8.54	5.30	92.31	26.37
p-Value^e
SBM		0.359	0.726	0.002	0.107	0.226	0.881
Rutin		0.009	0.002	0.658	0.676	0.520	0.182
SBM × Rutin		0.991	0802	0.732	0.233	0.546	0.030

^a,bMeans with different superscripts within a column differ significantly (p < 0.05).

^cSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^dSEM: standard errors of mean (n=8).

^ep-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Biochemical parameters, immunoglobulin, and antioxidant parameters in serum

As shown in Table 6, SBM storage modes had no significant effect on biochemical parameters (p > 0.05). Compared with the diet without rutin, dietary rutin addition raised the content of UN in serum (p < 0.05). An interaction between SBM and rutin for UN level was observed (p < 0.05), with greatest content in FSM + Rutin group.

Table 6. Effect of rutin on serum biochemical indexes of laying hens fed a diet containing stored soybean meal.

Treatment^d		Items^e
SBM	Rutin (mg/kg)	GLU (mmol/L)	TG (mmol/L)	TC (mmol/L)	TP (g/L)	ALB (g/L)	GLOB (g/L)	UN (mmol/L)	LDL (mmol/L)	HDL (mmol/L)
FSM	0	11.47	16.04	3.21	54.13	16.33	37.80	4.81^c	1.11	0.51
	500	10.50	15.28	3.32	53.75	16.68	37.08	8.90^a	1.27	0.60
RTSM	0	12.01	13.19	2.89	51.43	15.51	35.92	6.60^b	1.05	0.53
	500	11.44	13.09	3.31	54.65	16.03	38.63	6.91^b	1.40	0.69
SEM^f		0.27	1.33	0.15	1.13	0.22	1.12	0.31	0.09	0.06
Main effect
SBM
FSM		10.98	15.66	3.26	53.94	16.50	37.44	6.86	1.19	0.55
RTSM		11.72	13.14	3.10	53.04	15.77	37.27	6.76	1.22	0.61
Rutin
0		11.74	14.62	3.05	52.78	15.92	36.86	5.70^b	1.08	0.52
500		10.97	14.18	3.32	54.20	16.35	37.85	7.91^a	1.33	0.64
p-Value^g
SBM		0.179	0.369	0.604	0.703	0.102	0.945	0.775	0.854	0.623
Rutin		0.163	0.876	0.397	0.548	0.333	0.674	<0.001	0.174	0.288
SBM × Rutin		0.710	0.905	0.625	0.448	0.846	0.468	<0.001	0.259	0.768

^a,b,cMeans with different superscripts within a column differ significantly (p < 0.05).

^dSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^eGLU: glucose; TG: triglyceride; TC: total cholesterol; TP: total protein; ALB: albumin; GLOB: globulin; UN: urea nitrogen; LDL: low-density lipoprotein; HDL: high-density lipoprotein.

^fSEM: standard errors of mean (n=8).

^gp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

As shown in Table 7, the RTSM treatment had no significant effect on the content of immunoglobulin in serum compared with the FSM diet (p > 0.05). Compared with the diet without rutin, dietary rutin supplementation significantly decreased the content of IgM (p < 0.05) and tended to decrease IgA content (p = 0.068) in serum. There was an SBM × Rutin interaction for IgM content (p < 0.05), and the FSM diet had the highest IgM content.

Table 7. Effect of rutin on immunoglobulins levels of laying hens fed a diet containing stored soybean meal.

Treatment^d		Items^e
SBM	Rutin (mg/kg)	IgA (mg/mL)	IgG (mg/mL)	IgM (mg/mL)
FSM	0	2.58	3.35	4.90^a
	500	2.11	2.94	3.30^c
RTSM	0	2.39	3.17	4.20^a,b
	500	2.28	3.11	3.92^b,c
SEM^f		0.08	0.09	0.14
Main effect
SBM
FSM		2.35	3.14	4.10
RTSM		2.33	3.14	4.06
Rutin
0		2.48	3.26	4.55^a
500		2.20	3.03	3.61^b
p-Value^g
SBM		0.925	0.989	0.849
Rutin		0.068	0.212	< 0.001
SBM × Rutin		0.234	0.355	0.004

^a,b,cMeans with different superscripts within a column differ significantly (p < 0.05).

^dSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^eIgA: immunoglobulin A; IgG: immunoglobulin G; IgM: immunoglobulin M.

^fSEM: standard errors of mean (n=8).

^gp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

As presented in Table 8, SBM storage modes did not affect serum antioxidant capacity (p > 0.05). Compared with the diet without rutin, dietary rutin raised T-AOC activity (p < 0.05). In addition, dietary rutin had a trend to increase SOD activity (p = 0.063). Meanwhile, there was a trend of interaction effect on T-AOC activity of serum (p = 0.069).

Table 8. Effect of rutin on antioxidant capacity in serum of laying hens fed a diet containing stored soybean meal.

Treatment^c		Items^d
SBM	Rutin (mg/kg)	MDA (nmol/mL)	SOD (U/mL)	T-AOC (U/mL)	GSH-Px (U/mL)
FSM	0	3.41	298.70	2.37	731.75
	500	2.85	402.14	2.91	770.52
RTSM	0	2.57	340.60	1.87	790.04
	500	3.30	354.53	3.91	718.95
SEM^e		0.19	15.88	0.23	21.25
Main effect
SBM
FSM		3.13	350.42	2.64	751.14
RTSM		2.94	347.57	2.89	754.50
Rutin
0		2.99	319.65	2.12^b	760.90
500		3.08	378.33	3.41^a	744.74
p-Value^f
SBM		0.610	0.926	0.525	0.939
Rutin		0.828	0.063	0.003	0.712
SBM × Rutin		0.102	0.152	0.069	0.216

^a,bMeans with different superscripts within a column differ significantly (p < 0.05).

^cSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^dMDA: malondialdehyde; T-SOD: total superoxide dismutase; T-AOC: total antioxidant capacity; GSH-Px: glutathione peroxidase.

^eSEM: standard errors of mean (n=8).

^fp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Antioxidant capacity of the liver

As shown in Table 9, the RTSM diet had a trend to increase the MDA content compared with the FSM diet (p = 0.074). What’s more, dietary supplementation with rutin increased T-AOC activity significantly compared with the diet without rutin (p < 0.05). In addition, dietary rutin tended to increase the activity of GSH-Px (p = 0.056). However, no SBM × Rutin interaction was discovered in the antioxidant capacity of the liver (p > 0.05).

Table 9. Effect of rutin on antioxidant capacity in the liver of laying hens fed a diet containing stored soybean meal.

Treatment^c		Items^d
SBM	Rutin (mg/kg)	MDA (nmol/mg prot.)	SOD (U/mg prot.)	T-AOC (U/mg prot.)	GSH-Px (U/mg prot.)
FSM	0	0.54	939.93	0.51	53.52
	500	0.54	897.04	0.92	110.80
RTSM	0	0.62	988.28	0.47	91.11
	500	0.71	851.24	1.13	104.15
SEM^e		0.03	35.27	0.06	9.28
Main effect
SBM
FSM		0.54	918.49	0.71	82.16
RTSM		0.66	919.76	0.80	97.63
Rutin
0		0.58	964.11	0.49^b	72.31
500		0.62	874.14	1.03^a	107.47
p-Value^f
SBM		0.074	0.986	0.288	0.388
Rutin		0.587	0.220	<0.001	0.056
SBM × Rutin		0.527	0.517	0.126	0.220

^a,bMeans with different superscripts within a column differ significantly (p < 0.05).

^cSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^dMDA: malondialdehyde; T-SOD: total superoxide dismutase; T-AOC: total antioxidant capacity; GSH-Px: glutathione peroxidase.

^eSEM: standard errors of mean (n=8).

^fp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

The mRNA abundance of antioxidant-related genes in the liver of laying hens was shown in Table 10. Neither SBM storage modes nor dietary rutin could affect the mRNA expression of GPX1, GSTT1, SOD1, and SOD2 (p > 0.05), and no SBM and rutin interactions on mRNA gene abundance were observed (p > 0.05).

Table 10. Effect of rutin on antioxidant-related genes expression in the liver of laying hens fed a diet containing stored soybean meal.

Treatment^a		Items^b
SBM	Rutin (mg/kg)	GPX1	GSTT1	SOD1	SOD2
FSM	0	1.00	1.00	1.00	1.00
	500	1.32	1.22	1.43	1.63
RTSM	0	1.07	1.10	1.10	1.47
	500	1.20	0.80	1.01	1.24
SEM^c		0.12	0.08	0.09	0.16
Main effect
SBM
FSM		1.16	1.11	1.21	1.32
RTSM		1.13	0.95	1.05	1.36
Rutin
0		1.03	1.05	1.05	1.24
500		1.26	1.01	1.22	1.44
p-Value^d
SBM		0.904	0.328	0.353	0.908
Rutin		0.378	0.793	0.325	0.546
SBM × Rutin		0.706	0.109	0.138	0.204

^aSBM: Soybean meal; FSM: SBM was stored in the cold storage warehouses at –20 °C for 45 days; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days.

^bGPX1: glutathione peroxidase 1; GSTT1: glutathione S-transferase theta 1; SOD1: superoxide dismutase 1; SOD2: superoxide dismutase 2.

^cSEM: standard errors of mean (n = 8).

^dp-Value: statistical significances of main effects of SBM (two storage methods), rutin (two levels), and their interactions.

Discussion

Protein oxidation reactions during the storage process may occur under the effects of storage conditions, free radicals, and tiny molecular active compounds (Narayan et al. 1988; Lu et al. 2019). The previous study reported that heating SBM induced protein oxidation, which lowered broiler performance (Lu et al. 2017, 2019). A study on laying hen showed that diet containing SBM stored at room temperature for 30 days had no significant influence on production performance (Wang et al. 2020). Zhu et al. (2021b) found that dietary rutin levels of 0, 100, 200, and 400 mg/kg had no significant influence on laying rate, egg weight, feed intake, or feed-to-egg ratio. In the present study, the RTSM diet and dietary rutin supplementation had no effect on laying performance, which was consistent with previous study. The SBM × Rutin interaction was found in egg weight. This may be because storage decreased crude protein content and digestibility of crude protein in vitro, and study found that there was a positive correlation between dietary protein levels and egg weight (Keshavarz and Nakajima 1995). What’s more, dietary rutin supplementation tended to increase egg mass compared to that in the diet without rutin in this study. This may be due to its oestrogen-like effect. Rutin, which has a planar double benzene ring structure similar to natural oestrogen 17-β-estradiol, can raise oestrogen concentrations in plasma and mammary glands, stimulate pituitary prolactin and growth hormone release, and elevated oestrogen receptors, prolactin receptors, and growth hormone receptors gene expression in ovariectomised virgin rats (Tham et al. 1998; Guo et al. 2012; Zhao et al. 2020).

Wang et al. (2020) discovered that six-week feeding with SBM that had been stored at room temperature for 30 days had no effect on egg quality in laying hens. He et al. (2019) pointed that feeding laying hens with SBM that has been stored for 20 and 30 days significantly reduced egg Haugh unit on the 20th and 40th days, as well as albumen height of egg on the 40th day in laying hens. This study found that feeding the RTSM diet 4 weeks had no effect on egg quality. When compared to the FSM diet, the RTSM diet significantly reduced egg albumen height after eight weeks of feeding. This is consistent with the previous study (He et al. 2019; Wang et al. 2020). The result indicated that RTSM reduced egg albumen height with prolonged feeding time. This may be due to protein oxidation of SBM. Dietary flavonoids can influence egg quality of laying hens (Liu et al. 2014; Zhu et al. 2021a). Bee pollen includes a few phenolic compounds, including rutin, quercetin, vanillic acid, and protocatechuic acid, which can influence egg weight, yolk index, Hough units, and protein height when given to laying hen diets (Demir and Kaya 2020). Quercetin is the aglycone of rutin, study found that the diet with 0.2 and 0.4 g/kg quercetin raised Haugh unit, eggshell strength, eggshell thickness, and yolk protein of egg significantly (Liu et al. 2014). Diet supplemented with neohesperidin dihydrochalcone, as a kind of flavonoids, improved egg quality as evidenced by higher albumen height and Haugh unit of Lohmann commercial laying hens (Zhu et al. 2021a). According to the current study, dietary rutin significantly increased eggshell thickness, albumen height, and yolk colour, as well as tending to increase Haugh unit and egg yolk ratio at the end of fourth week. However, by the end of the eighth week of the experiment, dietary rutin increased eggshell strength and eggshell thickness. Effects of flavonoids on egg quality may be related to their antioxidant function (Demir and Kaya 2020; Zhu et al. 2021a). Rutin as a kind of flavonoids, we speculated that its effect on albumen height of egg may be related to its antioxidant properties. Huang et al. (2022) have reported that dietary mulberry-leaf flavonoids improved the eggshell quality by improving Ca deposition in the shell gland of uterus. The main component of the eggshell was calcium, which was a key factor in the hardness and strength of the eggshell. We suggested that rutin affect eggshell quality may by regulating calcium metabolism. There was an interaction between SBM storage method and rutin on the egg-yolk ratio at the 8th week, adding rutin to the RTSM diet could significantly increase the egg-yolk ratio. Flavonoids may affect yolk cholesterol content by regulating cholesterol synthesis and metabolism in egg yolk. Therefore, we speculated that the effect of rutin on egg-yolk ratio may be related to the effect of rutin on cholesterol metabolism.

Biochemical indicators are useful to assess the nutritional and health status of the body. Gu et al. (2021) discovered that heated SBM (HSBM) led to protein oxidation of SBM, which reduced the total protein and albumin levels in the serum of laying hens. Wang et al. (2020) pointed out protein oxidised SBM had no significant effect on serum biochemical indexes of laying hens. In this experiment, the RTSM diet had no significant effect on serum biochemical indexes. It might be attributed to the low degree of protein oxidation of SBM stored at room temperature about 20 °C for 45 days, which was insufficient to cause alterations in the serum biochemistry of laying hens.

Serum TP and ALB are important indicators of liver protein anabolism, whereas serum UN is an indicator of liver protein catabolism (Robin et al. 1987). Previous research has discovered that dietary rutin supplementation recovered hepatic oxidative stress-induced decreases in serum albumin and total protein owing to iron excess (Hussein and Shall 2013). Although rutin treatment had no impact on any of the serum biochemical indicators studied in normal rats, oral rutin administered to diabetic rats significantly raised total plasma protein (Kamalakkannan and Prince 2006). In this study, dietary rutin supplementation had no significant effect on total serum protein. However, dietary rutin increased the level of UN significantly, and adding rutin to the FSM diet had a greater effect on laying hens, and there was an interaction between SBM and rutin on the content of UN. The reason for this result could be that different storage methods or environment for SBM cause differing degrees of protein oxidation (Hellwig 2020), which affects SBM protein consumption. The study found that the treatment of rats with rutin (30 mg/kg) significantly reduced the elevated levels of blood urea nitrogen and increased serum total protein (Kamel et al. 2014), indicating that rutin may be associated with protein metabolism, influencing blood urea nitrogen levels. It showed that rutin may be related to protein metabolism and affect the blood urea nitrogen level, and the mechanism of differences in research results required further investigation.

This study discovered that the RTSM diet had no effect on serum immunoglobulin levels in laying hens. This may be related to the degree of oxidation of SBM protein. Rutin (25, 50 and 100 mg/kg, p.o.) has the capacity to increase immunological activity via cellular and humoral mediated processes in rat, evidenced by increasing antibody titre and immunoglobulin levels and enhancing delayed type hypersensitivity reaction (Ganeshpurkar and Saluja 2017). Chen and Ko (2021) reported that rutin (30 and 100 μmol/kg, p.o.) increased the IgG content in the serum of mice model with atypical allergic asthma. In plasmodium berghei-infected mice, co-administration of rutin with artequine enhanced the IgM content while lowering IgG content (Olanlokun et al. 2021). However, dietary rutin supplementation showed no influence on the blood contents of IgA, IgG, and IgM in Hu sheep (Wang et al. 2022). The study showed that the IgM content was higher in rutin-fed broilers than in control group, but there was no significant effect of rutin at any dose on the IgG and IgA contents (Awad et al. 2019). In this study, dietary rutin reduced the IgM content, and tended to reduce the IgA content, but had no effect on the IgG content in serum of laying hens during the peak laying period. What’s more, there was an interaction between SBM and rutin on the IgM content. It illustrates that the effect of rutin on immunoglobulin in serum can vary based on species, dosage, and other factors.

The antioxidant defense system of the body comprises antioxidant enzymes as well as non-enzymatic antioxidants (Kabel 2014). Heated SBM decreased the activities of SOD and GSH-Px in the serum and tissues in broilers (Lu et al. 2019). In this study, the RTSM diet had no effect on the SOD and GSH-Px activity in the serum and liver but tended to increase MDA levels in the liver. Rutin, a flavonoid, has an antioxidant impact in poultry as a natural antioxidant (Brewer 2011; Mahfuz et al. 2021). Studies have shown that feeding diet with additional hesperetin and naringenin increased serum SOD activity (Lien et al. 2008). Hassan et al. (2018) found that fed rutin-containing diets can reduce oxidative stress in broilers by enhancing SOD, catalase, and GSH-Px activity and decreasing MDA concentration. This experimental investigation found that dietary rutin increased T-AOC levels in serum and liver and had a trend to enhance SOD activity in serum, indicating that dietary rutin could effectively improve the antioxidant capacity of laying hens.

Rutin has been shown to be a powerful scavenger of hydroxyl and superoxide radicals (Kessler et al. 2003), exerting antioxidative effects by anti-lipid peroxidation (Nègre-Salvayre et al. 1991). What’s more, rutin can enhance the activity of antioxidant enzymes to exert antioxidant effects (Lee et al. 2013), which is consistent with our study.

Conclusions

In conclusion, the RTSM diet negatively impacted egg quality of laying hens over time when compared to the FSM diet. Dietary rutin supplementation improved egg quality and antioxidant capacity, but reduced serum IgM levels. In addition, there was a significant interaction between SBM and rutin on egg yolk ratio, serum UN and IgM levels after 8 weeks of feeding.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data that support the findings of this study are available from the corresponding author, Yanmin Zhou, upon reasonable request.

Additional information

Funding

This work was supported by the Nutrition Regulation Innovation Team of Jiangsu Modern Agricultural Industry (Laying Hens) Technology System [grant numbers 61KA210022].