Effects of dietary supplementation with rhamnolipids on the growth performance, nutrient digestibility, slaughter yield, and lipid metabolism of broiler chickens

Abstract

The purpose of this study is to investigate the effect of dietary supplementation with rhamnolipids (RLs) on the growth performance, slaughter performance, apparent digestibility and fat metabolism of broilers. Broiler chicks were randomly divided into 3 groups: control (C) group, 100 mg/kg (L) and 1,000 mg/kg (H) RL supplementation groups. The results, after dietary supplementation with RLs for 42 days, revealed a RL dose-dependent promoting effect on feed intake, and an increase of the evisceration index of 42-day-old broilers, but a decrease in the rate of abdominal fat gain. The dietary supplementation with RLs significantly increased the digestibility of protein and fat in broilers. The serum total cholesterol and high-density lipoprotein cholesterol levels of the H group were significantly higher than those of the C group (p < 0.01), whereas total triglyceride was lower. The liver triglyceride and total cholesterol levels of the H group were significantly higher than those of the L and C groups (p < 0.05). In summary, dietary supplementation with RLs can improve growth performance and carcase quality of broilers by strengthening the emulsification effect of lipid nutrients in the diet of poultry.

HIGHLIGHTS

• Rhamnolipids have a strong oil-water emulsifying capacity and an excellent human safety profile

• Dietary supplementation with rhamnolipids can improve growth performance and carcase quality of broilers

• Dietary supplementation with rhamnolipids strengthening the emulsification effect of lipid nutrients in the diet of livestock and poultry

Keywords:

• Rhamnolipids
• broiler chickens
• lipid metabolism
• emulsification

Introduction

Plant oils and animal fats, as highly efficient energy sources, are essential in the diet of broilers to increase energy density and improve productivity. However, the low-fat digestibility in broiler chickens associated with insufficient bile secretion and the relatively short digestive tract of chickens has led to great interest in the possibility of using exogenous emulsifiers to improve the utilisation of lipids in broiler chickens. Several previous studies have indicated that supplementation with bile acids or bile salts improves the utilisation of dietary fat and increases the production and secretion of pancreatic lipase (Ge et al. 2019; Guerreiro Neto et al. 2011; Shoaib et al. 2021).

Currently, natural and synthetic emulsifiers, such as lecithin, milk-derived casein, glyceryl polyethylene glycol ricinoleate and sodium stearoyl-2-lactylate, are applied in the feed of broilers to improve the digestion and growth performance of broiler chickens by enhancing the activity of lipases and emulsify fatty acids into lipid micelles (Ge et al. 2019; Park et al. 2018; Shoaib et al. 2021; Siyal et al. 2017a; Zhao and Kim 2017; Zulkifli et al. 2019). In addition, many studies have also shown that exogenous emulsifiers can improve the meat quality of broilers and regulate lipid metabolism (An et al. 2020; Ge et al. 2019).

Rhamnolipids (RLs) belong to a class of bacterial glycolipid biosurfactants that are mainly produced by Pseudomonas aeruginosa. RLs have a strong oil-water emulsifying capacity and an excellent human safety profile. Due to their non-toxicity property, high biodegradability, durability at higher temperatures, and ability to withstand a wide range of pH fluctuations, antioxidant properties, antimicrobial and anticancer activities, and ability to serve drug delivery systems, RLs have gained attention in various industrial fields, such as food, healthcare, pharmaceutical and petrochemicals (Kumar 2011; Thakur et al. 2021).

A report from the United States Environmental Protection Agency (USEPA, 2004) evaluated the biological safety of RLs as an additive to poultry feed and exempted the toxicity testing. However, very few studies have investigated RLs in poultry. As a result, many questions remain to be answered, such as whether the dietary supplementation with RLs affects the performance of broilers, determining the effective dose of RLs, elucidating the mechanism of action, and whether excessive dietary supplementation with RLs harms the health or performance of broilers.

The purpose of this study is to investigate the effect of supplementation with RLs on lipid metabolism and other effects related to production performance and the health of broilers. In addition, to elucidate possible mechanism mediating the effects of RLs, this study measured various parameters and indexes, including feed intake, average daily weight gain, feed-to-weight ratio, evisceration index, rate of abdominal fat, serum indexes, digestibility of crude protein (CP) and ether extract (EE), and mRNA expression of key enzymes involved in lipid metabolism in randomly selected Arbour Acres (AA) broilers divided into three groups: no addition (C), 100 mg/kg (L), 1,000 mg/kg (H) rhamnolipid. The findings of this study may contribute to promote the use of RLs in broiler feed.

Materials and methods

Diets, animals and management

A total of 180 one-day-old Arbour Acres (AA) broilers were randomly assigned to three groups with six replicates (3 males and 3 females per group) of ten birds in each. The experiment lasted for 42 days, the first 21 days were defined as start phase (1–21 d), and the rest of 21 days defined as grow phase (22-42 d). Two basic diets designed to meet the nutritional requirements during the two phases recommended by the PRC National Standard GB/T 5916-2020 (Formula feeds for layers and broilers) was used (Table 1). Depending on the group to which they were assigned, birds were fed as follows: basal diet with no supplement (control, C), basal diet with 100 mg/kg RLS (low dosage, L) and basal diet with 1,000 mg/kg (high dosage, H). RLs, with a purity of 94%, and at a concentration of 438 g/kg, were obtained from Shanghai Hengshi Material Technology Co., Ltd. (Shanghai, China).

Table 1. Formulas of basic diets.

Items	Ages (day)
Ingredients (air-dry basis%)	d1-21	d22-42
Corn	52.25	57.84
Soybean meal	28.41	22.04
Wheat middling	7.00	6.00
Corn gluten meal	6.00	5.00
Soybean oil	2.00	5.00
Limestone	1.48	1.24
Calcium hydrogen phosphate	1.21	1.29
Lysine	0.17	0.17
Methionine	0.18	0.12
Salt	0.30	0.30
1% Premix*	1.00	1.00
Nutrient levels
ME (MJ/kg)**	13.31	13.21
CP %	20.66	17.64
EE%	2.85	4.63
Ca %	0.87	0.85
Available P %	0.63	0.56
Lys %	1.14	0.97
Met %	0.50	0.40

Note: *1% premix is provided per kilogram of full price: Vitamin A: 1,000 IU; Vitamin D3: 3,000 IU; Vitamin E: 24 IU; Vitamin K3: 1.3 mg; Vitamin B1: 2.2 mg; Vitamin B2: 8 mg; Vitamin B3: 40 mg; Choline chloride: 400 mg; Vitamin B5: 10 mg; Vitamin B6: 4 mg; Biotin: 0.04 mg; Folic acid: 1 mg; Vitamin B12: 0.013 mg; Iron: 80 mg; Copper: 8 mg; Iodine: 1.1 mg: Selenium: 0.3 mg.

** The value of ME is calculated while others are analysed.

Broilers were housed in metal cages equipped with a nipple drinker, a metal trough and a plastic mat. To ensure proper feeding density, five out of ten birds were moved to another cage at 14 days of age (12 replicates, 5 birds per replicate for 15-21d, 0.06 m² for each bird). Then three birds were remained in each cage at 21 days of age (12 replicates, 3 birds in each replicate for 22-42d, 0.09 m² for each bird) and the other two birds were removed for sampling. The temperature in the broiler house during the first week was 32 to 35 °C, and then it was lowered by 1 °C every other day until it reached 27 °C and provided with water and the appropriate diet ad libitum. Broilers were fed with the experimental diets on an adequate basis and had free access to fresh clean drinking water via a nipple drinker throughout the experiment. The authors confirm that they have provided suitable housing and environment for broilers. Broilers were kept in clean, well-ventilated, and appropriately temperature-controlled facilities. They access to sufficient space to move freely and engage in natural behaviours. The study followed China’s Animal Welfare Law (Regulations on the Administration of Experimental Animals), and the Ethics Committee of Shanghai Academy of Agricultural Sciences approved the study (authorization number: SAASPZ0520008).

Growth performance

Body weight (BW) was recorded on day 1 (the beginning of the experimental period), day 21 (the day of feed change) and day 42 (the end of the experiment), while feed consumption was measured weekly on the cage basis to determine the average daily gain (ADG) and average daily feed intake (ADFI), respectively. The feed conversion rate (FCR) was calculated using total feed provided divided by total BW.

Determination of nutrient digestibility

Acid insoluble ash (AIA) was used as a undigestible indicator to determine the apparent total tract digestibility (ATTD) as previously described (Zhu et al. 2022). Before starting the experiment, the experimental diets were sampled once and stored at −20 °C for chemical analysis. Faeces were collected from each cage on day 19 to day 21 and day 40 to day 42, treated with 10% sulphuric acid to fix excreta nitrogen, and dried in a forced air oven at 65 °C for 48 h. The dried samples were ground and kept for AIA, dry matter (DM), CP and EE analysis using the method described by the Association of Official Agricultural Chemists (AOAC; Rockville, MD, USA, 2000). The digestibility was calculated using the following formula: digestibility (%) = (100 - A1/A × F2/F1 × 100), where A1denotes the AIA content of the feed, A2 denotes the AIA content of the faeces, F1 denotes the nutrient content of the feed, and F2 denotes the nutrient content of the faeces.

Collection of samples

At days 21 and 42, one bird per replicate (6 male and 6 female each group) was random selected, weighed after 12 h of feed deprivation and slaughtered by cervical dislocation. Collected blood samples were quickly transferred to a laboratory for serum separation. After sacrificing the bird, abdominal incisions were made and separated and the removed liver, spleen and abdominal fat (fat around abdomen and gizzard) were weighed to calculate the organ index (organ to live BW ratio). Eventually, the gut was removed to measure its length.

Determination of slaughter yields

To evaluate the slaughter performance, at the end of the experiment (42 d of age), representative birds per replicate (6 male and 6 female each group) were selected, individually weighed, and sacrificed after 12 h of feed deprivation. The birds were manually dissected to determine carcase and abdominal fat weight and yield as previously described (Yan 2013). All yields were calculated using the following formula: dressed weight = BW- (blood + feather) weights; eviscerated weight = dressed weight − (trachea + oesophagus + crop + intestine + spleen + pancreas + gallbladder + reproductive organ + heart + liver + proventriculus + gizzard + fat around abdomen and gizzard + head + neck + claw) weights; dressed yield (%) = dressed weigh/BW × 100; eviscerated yield (%) = eviscerated weight/BW × 100.

Serum biochemical profile analysis

Serum biochemical indices, including total protein (TP), albumin (ALB), globulin (GLB), gamma-glutamyltransferase 2 (GGT2), aspartate aminotransferase (AST), alanine aminotransferase (ALT), urea, glucose (GLU) were determined using a Mindray BS-420 automatic blood analyser (Shenzhen Mindray Bio-Medical Electronics Co., Ltd., Shenzhen, China) in accordance with the manufacturer’s instructions.

The serum total triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were measured using the appropriate commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The experiment was performed following the manufacturer’s instructions.

Liver lipid metabolism

The liver TG, TC, HDL-C, and LDL-C were measured using corresponding commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The experiments were conducted following the manufacturer’s instructions.

Quantitative real-time polymerase chain reaction analysis of gene expression

Total RNA was isolated from frozen liver samples using Trizol Reagent (TaKaRa, Dalian, China). After determining RNA concentration, purity, and integrity, the mRNA was reverse-transcribed into cDNA using a the PrimeScript RT Reagent kit (TaKaRa). The quantitative real-time polymerase chain reaction (qRT-PCR) was performed on an ABI 7500 Fast Real-time PCR detection system (Applied Biosystems, Foster City, CA, USA) using the TB Green® Premix Ex Taq™ II (TaKaRa). All primer sets used in this study were obtained from Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). Primers and expected product size are listed in Table 2. Product sizes were verified by agarose gel electrophoresis. Ribosomal protein S17 (RPS17) and ACTB were used as reference genes and a geometric mean of their Ct value was used as an internal control of the reference genes to calculate the relative expression level of target genes using the ΔΔCt method (Livak and Schmittgen 2001). All PCR reactions were performed in triplicate, and the changes in gene expression are reported as fold-increase relative to control.

Table 2. List of Primers used for qRT-PCR.

Gene name	Gene bank NO.	Sequence (’'→’')	Ref.
ACC	NM_205505	For.: AACGAGTCGGGCTACTACCT	(Li, et al. 2019)
		Rev.: ATCAGCATCCCGTGAAGTGG
ACLY	AJ851548	For.: CACCCAGAGGTGGATGTTCT	(Li, et al. 2019)
		Rev.: GTTGCAGGCCCAATGTTAGT
FAS	NM205155	For.: TGAAGGACCTTATCGCATTGC	(Li, et al. 2019)
		Rev.: GCATGGGAAGCATTTTGTTGT
ADIPOR1	NM001031027	For.: CCCGTGAGGAAGAGGAGGAAGTTG	(Li, et al. 2019)
		Rev.: AGGCTCGGAAGGACGGCATTG
ADIPOR2	NM001007854	For.: GCATCGCAGCCATAATCGTCTC	(Li, et al. 2019)
		Rev.: ATGAGTGCCAGCCAGCCTATC
LPL	NM_205282	For.: ACTTGAAGACCCGTGCTCAG	(Huang, et al. 2013)
		Rev.: GGCTGGTCTACCTTGGTCAC
ATGL	NM_001113291	For.: TCACCTTCAGCGTCCAAGTC	(Huang, et al. 2013)
		Rev.: GCACATGCCTCCAAAAGAGC
PPARA	NM_001001464	For.: TGTGGAGATCGTCCTGGTCT	(Huang, et al. 2013)
		Rev.: CGTCAGGATGGTTGGTTTGC
ACTB	NM_205518	For.: CTGTGCCCATCTATGAAGGCTA Rev.: ATTTCTCTCTCGGCTGTGGTG	(Huang, et al. 2013)
RPS17	NM_204217	For.: AAGCTGCAGGAGGAGGAGAGG Rev.: GGTTGGACAGGCTGCCGAAGT	(Huang, et al. 2013)

Abbreviations: ACC: Acetyl-CoA carboxylase; ADIPOR1: Adiponectin receptor 1; ADIPOR2: Adiponectin receptor 2; LPL: lipoprotein lipase; ACLY: ATP- citrate lyase; ATGL: Adipose triglyceride lipase; PPARA: Peroxisome proliferator-activated receptor alpha; RPS17: Ribosomal Protein S17.

Statistical analysis

The experimental data were analysed by one-way analysis of variance (ANOVA) and Tukey’s post hoc test using the SPSS v21 software (IBM Corporation, Armonk, NY, USA) to determine significant differences among groups. When the P value is less than 0.05, the difference is considered significant, and the statistical results are expressed as the mean ± standard error of mean (SEM).

Results

Growth performance and carcass traits

As shown in the Table 3, the results of this experiment showed that the H group had higher ADFI and ADG than the C group in the finisher phase and over the entire period (p < 0.05). At the end of the experiment (d42), the H group had higher dressed yield and eviscerated yield, but lower abdominal fat than the group C (p < 0.05); the L group had higher dressed yield than the C group (p < 0.01), but no significant differences in eviscerated yield and abdominal fat index were detected between the L and C groups. However, there were no significant differences in FCR, spleen index or gut length among groups (p > 0.05).

Table 3. The effects of dietary rhamnolipids (RLs) supplementation on growth performance, Nutrient digestibility, and carcass Traits in broilers.

	C	L	H	SEM	P Value
BW, g
day 1	57.83	56.67	57.83	0.57	0.14
day 21	402.33	392.00	407.83	10.91	0.11
day 42	2947.50	2961.00	3080.00	61.27	0.35
ADFI, g/d^1
Starter (day1-21)	120.55	113.96	121.83	2.16	0.81
Finisher (day22-42)	166.64^b	167.14^b	175.69^a	1.86	0.04
Entire (day1-42)	148.20^b	145.87^b	154.15^a	1.31	0.02
ADG, g/day^1
Starter (day1-21)	39.76	39.50	41.64	0.54	0.16
Finisher (day22-42)	95.82^b	98.77^ab	104.44^a	1.63	0.03
Entire (day1-42)	68.476^b	69.86^ab	73.81^a	0.90	0.01
FCR^*1
Starter (day1-21)	3.04	2.92	2.95	0.06	0.50
Finisher (day22-42)	1.75	1.70	1.71	0.03	0.53
Entire (d1-42)	2.17	2.09	2.11	0.03	0.30
Carcase traits (day 42)
Dressed yield %	90.13^b	94.26^a	93.87^a	0.39	<0.01
Eviscerated yield %	76.00	76.82	78.25	0.43	0.09
Abdominal fat index %	1.29^ab	1.46^a	1.11^b	0.06	0.04
Liver index %	1.93	1.85	1.92	0.07	0.88
Spleen index %	0.10	0.09	0.10	0.004	0.54
gut/cm	158.33	164.08	168.92	2.49	0.23

Values are mean ± standard error of mean. Mean values with different superscripts in the same row differ significantly (p < 0.05).

¹For day1-14, n = 6; day 15-21, n = 12; day 22-42, n = 12.

Abbreviations: BW, body weight; ADFI, average daily feed intake; ADG, average daily gain; FCR, Feed conversion rate.

C: 0 mg/kg RLs, L: 100 mg/kg RLs, H: 1000 mg/kg RLs.

Nutrient apparent digestibility

As shown in Table 4, the results of this experiment revealed that the H and L groups had higher apparent digestibility of DM, CP and EE compared with the C group in the starter phase and finisher phase of the experiment (p < 0.05). Especially for L group at finisher phase, the apparent digestibility of EE reach to 96.92%.

Table 4. The effects of dietary rhamnolipids (RLs) supplementation on Nutrient apparent digestibility.

	C	L	H	SEM	P Value
d21
DM %	61.73^b	72.02^a	69.68^a	1.21	<0.01
CP %	57.13^b	67.32^a	65.71^a	1.40	<0.01
EE %	84.04^b	87.75^a	82.43^b	0.66	0.25
day 42
DM %	75.58^b	86.29^a	83.58^a	0.81	<0.01
CP %	66.80^b	80.94^a	76.29^a	1.13	<0.01
EE %	93.56^b	96.92^a	95.20^a	0.27	<0.01

Abbreviations: DM, dry materials; CP, crude protein; EE, ether extract (crude fat); C: 0 mg/kg RLs; L: 100 mg/kg RLs; H: 1000 mg/kg RLs.

Serum biochemical profile

As shown in Table 5, among lipid metabolites, the level of free fatty acid (FFA) of broilers was the highest followed by TG and TC. In addition, the levels of serum FFA, TG and TC on d21 were significantly higher than those on d42 (p < 0.05). The results of this experiment also showed that, at d21, the serum FFA levels in the L and H groups were significantly higher, in a dose-dependent manner, than that in the C group (p < 0.05), but there were no significant differences in serum TG, TC, low-density lipoprotein (LDL), high-density lipoprotein (HDL) or total bile acid (Tbil) levels (p > 0.05). At d42, serum TC and HDL levels in the L and H groups were significantly higher than those in the C group (p < 0.05), while serum TG level in the H group was significantly lower than that in the C group (p < 0.05), but there were no significant differences in serum FFA and Tbil levels (p > 0.05).

Table 5. The effects of dietary rhamnolipids (RLs) supplementation on serum biochemical parameters in broilers.

Items	Unit	C	L	H	SEM	P Value
day 21
FFA	mM	445.00^A	310.03^B	211.68^C	32.54	<0.01
TC	mM	3.53	3.62	3.61	0.08	0.69
TG	mM	0.97	0.96	0.93	0.06	0.80
HDL-C	mM	2.41	2.36	2.52	0.06	0.47
LDL-C	mM	0.53	0.50	0.47	0.02	0.25
Tbil	mM	15.24	14.44	14.21	0.60	0.50
GLU	mM	13.64	12.94	13.63	0.17	0.17
URIC	mM	369.18^b	439.08^ab	508.58^a	22.53	0.04
TP	g/L	28.58	29.03	29.00	0.48	0.92
ALB	g/L	15.18	14.09	14.37	0.27	0.24
GLB	g/L	13.41	14.94	14.63	0.55	0.50
A/G		1.47	0.98	1.00	0.12	0.15
day 42
FFA	mM	196.65	246.68	193.35	21.09	0.95
TC	mM	2.97^b	3.38^a	3.40^a	0.08	0.03
TG	mM	0.50^a	0.46^ab	0.39^b	0.02	0.05
HDL	mM	2.00^B	2.38^A	2.50^A	0.07	<0.01
Tbil	mM	11.25	12.85	12.03	0.33	0.34
GLU	mM	14.01	13.47	13.96	0.27	0.67
URIC	mM	403.58	386.50	327.58	17.81	0.19
TP	g/L	32.30	31.58	30.44	0.97	0.74
ALB	g/L	14.20	14.86	14.25	0.27	0.55
GLB	g/L	15.43	16.73	16.19	0.41	0.44
A/G		0.93	0.89	0.90	0.02	0.63

Abbreviations: FFA, free fatty acid; TC, total cholesterol; TG, total triglyceride; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; Tbil, total bile acid; GLU, glucose; URIC, Uric acid; TP, total protein; ALB, albumin; GLB, globulin; A/G, the ratio of ALB and GLB; mM, mmol/L; C: 0 mg/kg RLs; L: 100 mg/kg RLs; H: 1000 mg/kg RLs.

Uric acid, which is the main form of serum nitrogen in poultry, was found to be present in higher level in the serum of broilers in the H group than that of broilers in the C group on d21 (p < 0.05). However, there were no significant differences in the serum levels of GLU, TP, ALB, GLB or the ratio of ALB and GLB(A/G)of broilers among the three groups (p > 0.05).

Lipid metabolites in the liver

As shown in Table 6, the results of this experiment revealed that the H group had higher contents of liver TG and TC than the C group (p < 0.05), and higher HDL/LDL ratio than the C and L groups (p < 0.05), but there were no significant differences in the contents of liver HDL and LDL between groups (p > 0.05).

Table 6. The effects of dietary rhamnolipids (RLs) supplementation on lipid Metabolites in the liver of broilers.

Item	Unit	C	L	H	SEM	P Value
TG	mmol/mg prot	0.12^B	0.12^B	0.27^A	0.02	<0.01
TC	mmol/mg prot	0.06^b	0.06^b	0.10^a	0.01	0.01
HDL-C	μmol/mg prot	21.75	23.65	30.72	2.78	0.39
LDL-C	μmol/mg prot	71.97	66.38	62.15	3.21	0.47
HDL/LDL		0.31^b	0.35^b	0.64^a	0.07	0.09

Abbreviations: TC, total cholesterol; TG, total triglyceride; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; HDL/LDL, the ratio of high-density lipoprotein cholesterol and low-density lipoprotein cholesterol; C: 0 mg/kg RLs; L: 100 mg/kg RLs; H: 1000 mg/kg RLs.

Expression of genes involved in lipid metabolism in the liver

The effects of dietary RLs supplementation on the expression of genes related to lipid synthesis, hydrolysis and metabolic regulation in the liver of broilers at 42 days of age are shown in Figure 1. The statistical analysis results showed that, compared with the C group, the expression of the ACLY and FAS genes, which encode proteins involved in fatty acid synthesis, was increased in the H group (p < 0.05, Figure 1a). Additionally, the expression of the LPL gene, which encodes a protein involved in lipid hydrolysis, was increased in the H group (p < 0.05, Figure 1b). In addition, the expression of the ADIPOR1 and ADIPOR2 genes, which encode proteins involved in body energy balance, GLU metabolism and fat metabolism regulation, was increased in the H group (p < 0.05, Figure 1c), but there were no significant differences in the expression of all the genes measured between the L and C groups (p > 0.05).

Figure 1. The effects of dietary rhamnolipids (RLs) supplementation on the expression of genes involved in lipid synthesis (panel a), lipolysis (panel b) and lipid metabolism regulation (panel c) in the liver of 42-day-old broilers. ACLY, ATP- citrate lyase; ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; ATGL, adipose triglyceride lipase; LPL, lipoprotein lipase; C: 0 mg/kg RLs; L: 100 mg/kg RLs; H: 1000 mg/kg RLs.

Discussion

Broiler diets generally contain high levels of fats and oils, making them a good animal model for a high energy diet for humans. The higher the energy level of the diet, the more it improves the broiler’s performance in terms of weight and slaughter rate, but the body’s use of fats and oils decreases as their content increases. Meanwhile, high energy rations usually lead to increased fat deposition and reduced protein deposition in poultry, resulting in a loss of feed energy. Oil and grease adhere to feed particles and prevent the body from absorbing nutrients, which can lead to inadequate nutrient intake if the animal’s body is inefficient in absorbing oil and grease from the feed. Several studies have shown that emulsifiers can compensate for the lack of bile secretion in animals, which can promote the secretion of digestive enzymes and facilitate the digestion of nutrients in the intestine. As RLs have a strong oil-water emulsifying capacity and an excellent human safety profile, they have been proposed as a potential supplement emulsifier. However, there is still limited experimental data on the effects of dietary RLs on the performance of broilers.

Consistent with the findings of Zhang et al. (2021), in this study, dietary supplementation with1,000 mg/kg RLs significantly increased the ADFI, and ADG in the finisher phase and over the entire period, but had no significant effect on the FCR. In this study at the end of the experiment (day 42), dietary supplementation with 1,000 mg/kg RLs significantly increased dressed yield and eviscerated yield, but decreased the abdominal fat index compared to the C group. However, dietary supplementation with 100 mg/kg RLs did not significantly improve the growth performance or carcase yield of broilers. Thus, the results indicated that dietary supplementation with RLs up to 1,000 mg/kg can improve ADG and carcase yield of broilers at the late growth stage.

In fact, the type of oil and the type and level of emulsifier added to the diet may alter the effect of emulsifier on performance. Siyal et al. (2017b) reported that supplementation with soy lecithin at 0.10% improved the ADFI and ADG and decreased the FC in AA broilers. DM digestibility, EE digestibility and protein digestibility were significantly improved by adding 0.1% soy lecithin. Meanwhile, Zampiga et al. (2016) reported that the use of an emulsifier based on lysophospholipids improved feed efficiency, while showing a limited effect on carcase quality traits. In addition, the results of a meta-analysis of 33 independent trials by Wealleans et al. (2020) revealed that the dietary supplementation of broiler diets with 125 mg/kg and above of haemolytic lecithin improved growth performance and feed efficiency across a range of basal dietary ingredients and fat sources. As a result, in terms of growth promotion, RLs are used at higher doses than soy lecithin and lysolecithin. Unfortunately, because feed cost was not considered in this study, FCR was higher than that in production environment, and the average weight of 42d was also higher, the results we obtained are still instructive to production practice

We believe that the digestibility of nutrients might be responsible for the positive changes in growth performance. Many studies have confirmed that the dietary supplementation with exogenous emulsifiers can improve the digestibility of dietary nutrients in livestock and poultry (Arshad et al. 2021; Kaczmarek et al. 2015; Liu et al. 2020; Saleh et al. 2020). However, slightly different from the ADFI and ADG results, the addition of 100 mg/kg and 1,000 mg/kg RLs to the diet both significantly increased the apparent digestibility of DM, CP and EE at day 21 and day 42. However, no significant differences were observed in the digestibility of DM, CP and crude fat between birds in the 1,000 mg/kg RLs group and the 100 mg/kg RLs group in this study.

There are two mechanisms by which emulsifiers improve the digestion and absorption of nutrients. First, they increase the water solubility of lipids in the broiler gut, promote the formation of coeliac particles, increase the contact between lipids and the corresponding enzymes and improve the solubility of fatty acids and other fat-soluble components (such as phospholipids, cholesterol and fat-soluble vitamins) in the gut, thus promoting the digestion, absorption and transfer of lipids. Second, they promote the secretion and activity of digestive enzymes, such as lipase and protease. Poultry bile is slightly acidic, which promotes fat absorption through the emulsification and activation of pancreatic lipase. Some studies have also shown that the addition of emulsifiers to diets can also improve lipase activity.

However, it is not the case that the higher the amount of emulsifier added to the diet, the better the outcome. When the amount added did not exceed the critical micelle concentration, the emulsifying capacity increased with the amount of emulsifier used, but when the amount added exceeded the critical micelle concentration, the increase in emulsifying capacity was slow and essentially unchanged, which explains the non-significant difference in nutrients digestibility that was observed between the 100 mg/kg and 1,000 mg/kg RLs groups of broilers observed in this trial.

Zhang et al. reported that dietary supplementation with 1,000 mg/kg RLs significantly reduced the jejunal crypt depth and increased the jejunal villus length and the intestinal villus/crypt ratio (Zhang et al. 2021). The intestine is the main organ of digestion and absorption in the body and its increased length and weight facilitates the digestion and absorption of feed nutrients and also reflects to some extent the development of the digestive system. Although we did not observe the morphology of the intestinal villi in broilers, we found a trend towards an increase in intestinal length in RL-treated broilers, but this increase did not reach significance, suggesting that RLs may also improve feed digestibility by promoting the development of the digestive tract, increasing the digestion and absorption area and prolonging the digestion and absorption time of the digesta.

The serum biochemical profile reflects the integrated function and nutritional metabolism of the body’s organs and can also indirectly reflect the health status of the body. Therefore, in order to further understand the overall effect of dietary supplementation with RLs on broilers, we investigated the changes in serum biochemical parameters. The test results showed that dietary supplementation with 1,000 mg/kg RLs only caused an increase in serum uric acid levels, without significant effect on other serum biochemical parameters. Uric acid is the main form of serum nitrogen present in birds, and the increase in serum uric acid in the 1,000 mg/kg RLs group (H group) in this study may be related to the increased utilisation of dietary protein. Thus, the serum biochemical results indicate that the addition of 1,000 mg/kg RLs to the diet has no adverse effect on the health of broilers.

The ability to synthesise lipids in the extrahepatic tissues of birds is very limited, and plasma TG is mainly derived from the diet or synthesised by the liver. In addition, the liver is the site of HDL synthesis in animals, whereas LDL is produced by the metabolism of TG-rich lipoproteins in blood. Ge et al. reported significantly increased TG levels in the liver of broilers in the high-fat diet group, leading to lipid deposition in the liver. Additionally, it has been reported that the addition of bile acids to the diet reduced the abdominal fat accumulation rate and TG content in the liver of broilers (Ge et al. 2019).

Siyal et al. (2017b) reported that the addition of soya lecithin to the diet increased HDL levels and decreased serum LDL levels. To date, there are no reports on the effects of adding RLs to diets on lipid metabolism in broiler chickens. Consistent with the results of the above emulsifier studies, the dietary supplementation with RLs significantly reduced serum non-esterification fatty acids (NEFA) and TG levels and increased serum HDL levels and liver HDL/LDL ratio. However, there were differences with our study in that in our study there was no significant effect on liver TG and TC when 100 mg/kg RLs was added to the diet, but there was a significant increase in liver TG and TC when 1,000 mg/kg RLs was added to the diet.

Body fat deposition depends on the dynamic balance between fat anabolism and catabolism. When anabolism exceeds catabolism and decreases, fat deposition increases and vice versa. In view of the increased TG and TC levels and increased HDL/LDL ratio but decreased serum TG levels of broilers in the high-dose (1,000 mg/kg RLs) treatment group in this study, it is suggested that high-dose RLs may promote hepatic fat synthesis while accelerating fat translocation and catabolism, and the rate of catabolism may be greater than the rate of synthesis, thus explaining the significantly lower abdominal fat index of broilers in the high-dose RLs group compared with the control group.

To further test our hypothesis, we quantified the gene expression levels of key enzymes and regulatory proteins or receptors involved in lipid synthesis and metabolism. ADIPOR1 and ADIPOR2 are two receptors for lipocalin, which has been shown to regulate energy homeostasis, GLU and lipid metabolism in organisms, and whose expression is negatively correlated with lipid deposition (Zhang et al. 2017). Yan (2013) reported that overexpression of adiponectin can inhibit the differentiation of chicken preadipocyte, while silencing the adiponectin gene promoted chicken adipocyte differentiation and lipid droplet production. Additionally, overexpression of lipocalin inhibited the expression level of FAS and induced the expression of adipose triglyceride lipase (ATGL), which promoted mitochondrial development in chicken adipocytes and activated the function of glycolipid metabolism in mitochondria. However, the results of this study indicated that dietary supplementation with 1,000 mg/kg RLs upregulated the expression levels of ADIPOR1 and ADIPOR2 genes, as well as the gene expression levels of ACLY, FAS and LPL, with no significant effect on the gene expression of ATGL.

ACLY converts citric acid to acetyl coenzyme A for fatty acid and cholesterol synthesis and is a key enzyme linking carbohydrate and lipid metabolism (Feng et al. 2020). FAS catalyses the formation of long-chain fatty acids from acetyl coenzyme A and malonyl coenzyme A and is a key enzyme for fatty acid synthesis (Clarke 1993). LPL is a rate-limiting enzyme in lipid metabolism, catalysing the hydrolysis of TGs to fatty acids and glycerol for tissue oxidation and storage. Reduced LPL activity can result in elevated serum TG levels, and inhibition of very low-density lipoproteins (VLDL) hydrolysis by LPL can lead to the return of VLDL to the liver, causing excessive fat deposition in the liver (Davail et al. 2020). In this study, supplementation with 1,000 mg/kg RLs upregulated the mRNA expression of liver ACLY and FAS by more than 4-fold, and that of LPL by more than 32-fold, suggesting that the high dose of RLs promoted the synthesis and catabolism of fat, and the catabolism promoting effect was greater than that on synthesis. However, no changes were detected in the mRNA levels of peroxisome proliferator-activated receptor alpha (PPARA), which mediates lipid catabolism influenced systemic lipid and energy homeostasis (Li et al. 2020).

Conclusion

In summary, this study found a dose-dependent promoting effect of rhamnolipid on feed intake, the rhamnolipids had a dose-dependent effect on the promotion of average daily weight gain. The FCR of broiler chickens was not significantly different in all data (p > 0.05); compared with the group C, the FCR of the group H before, after and the whole period were reduced by 7%, 2% and 3%, respectively. The addition of rhamnolipid to the feed not only increased the evisceration index of broilers, but also reduced the rate of abdominal fat; and total cholesterol of the group H were significantly higher than those of the other groups (p < 0.05); the mRNA expression of Lipoprotein lipase (LPL), fatty acid synthase (FAS), and citrate lyase (ACLY) in the group H were significantly higher than those in the group C (p < 0.05). It is suggested that adding rhamnolipid to feed may promote the utilisation of fat.

Considering the positive results of USEPA in RLS safety testing, this study hints at the potential benefits and commercial value of adding RLs to poultry feed.

Ethical approval

The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been adhered to and the appropriate ethical review committee approval has been received. The authors confirm that they have followed China’s Animal Welfare Law (Regulations on the Administration of Experimental Animals), and the Ethics Committee of Shanghai Academy of Agricultural Sciences approved the study (authorization number: SAASPZ0520008).

Acknowledgements

The authors would like to thank Zhang Chenting and Liu Hongfei for their contribution to this experiment.

Disclosure statement

The authors declare no conflict of interest.

Data availability statement

The data presented in this study are available on request from the corresponding author.

Additional information

Funding

This study was funded by the SAAS program for excellent research team (2022-021)