Effects of antibacterial peptide microcin J25 on growth performance, antioxidant capacity, intestinal barrier function and intestinal microbiota in pigeon squabs

Abstract

The present study aims to evaluate the effects of the antibacterial peptide Microcin J25 (ABP MccJ25) on growth performance, intestinal barrier function, antioxidant capacity and ileal microbiota in pigeon squabs. The 80 pairs of American Silver King pigeon parents and 240 healthy day 1 squabs were randomly divided into four groups, including 4 parent pairs and 12 pigeon squabs per group with 5 replicates. Parent pigeons were fed a basal diet (CON) or the addition of 100, 200, 300 mg/kg of ABP MccJ25 (ABP100, ABP200, and ABP300, respectively) for 4 weeks. Results showed that the group ABP200 remarkably reduced the feed conversion ratio and increased average daily gain in pigeon squabs from 7 to 21 d (p < 0.05), and improved serum antioxidant capacity in pigeon squabs from 14 to 28 d (p < 0.05). Villus height and the ratio of villus height to crypt depth in the duodenum, jejunum, and ileum were significantly increased in groups ABP200 and ABP300 (p < 0.05). In addition, group ABP200 obviously up-regulated the relative mRNA expression of intestinal antioxidant-related genes and barrier-related genes (p < 0.05). Moreover, the proportion of beneficial bacteria including Firmicutes and Lactobacillales, which were favourable to the intestinal health of pigeon squabs increased noticeably (p < 0.05). Taken together, these results indicated that group ABP200 enhanced antioxidant capacity, strengthened intestinal barrier function, and facilitated the regulation of intestinal microbiota, leading to the improvement in growth performance of pigeon squabs. Therefore, this study provides support for the application of 200 mg/kg ABP MccJ25 in pigeon production.

HIGHLIGHTS

• Dietary supplementation of ABP MccJ25 enhanced the antioxidant capacity in pigeon squabs.

• Dietary supplementation of ABP MccJ25 improved intestinal barrier function and intestinal microbiota in pigeon squabs.

• 200 mg/kg ABP of MccJ25 significantly increased growth performance in pigeon squabs.

Keywords:

• ABP MccJ25
• pigeon squab
• growth performance
• barrier function
• intestinal microbiota

Introduction

In animal husbandry, the problems of bacterial resistance and drug residues brought by antibiotics have become more prominent, threatening the health of animals (Hernando-Amado et al. 2020; Kim and Ahn 2022). The addition of antibiotics to animal feed is gradually being prohibited in more and more countries and regions. Based on the promotion of a global antibiotic-free policy, the research of new medical drugs and alternative antibiotic substances in animal feed has become a hotspot for people’s attention and research (Cheng et al. 2014; Silveira et al. 2021).

Antibacterial peptides (ABP) are broad-spectrum antibacterial and bioactive small molecule peptides that exist in various animals, plants, bacteria, viruses, and humans and play critical roles in the body’s defence system (Mookherjee et al. 2020). ABP is not only an antimicrobial agent but also has chemotactic activity and modulates the inflammatory response, which has enormous application potential (Mansour et al. 2014; Raheem and Straus 2019; Shi et al. 2021). Microcin J25 (MccJ25) is a 21-amino acid ABP that is mostly synthesised by the Enterobacteriaceae and has excellent antimicrobial activity and stability (Salomón & Farías 1992). ABP is effective in killing bacteria and not prone to drug resistance, which can enhance animal immune function, improve the composition of the intestinal microbiota, maintain intestinal health, and enhance animal production performance (Gadde et al. 2017; Patyra and Kwiatek 2023). Previous study reported that ABP improved the production performance of broiler chickens and weaned piglets, enhanced immune function and antibacterial ability (Yoon et al. 2014; Ma et al. 2020). The addition of ABP to aquaculture diets improved the growth, immune, and antioxidant capacity of Litopeneaus vannamei (Gyan et al. 2020).

Pigeons are late-adult birds, and pigeon squabs are born with unopened eyes and survive mainly on pigeon milk fed by the parental pigeons. Pigeon squabs grow extremely fast, and previous study showed that the body weight of pigeon squabs at 4 weeks of age is about 26 times of that at the time of shelling (Gao et al. 2016). The growth constant value of pigeons is 3.79 times that of broilers, and 1.96 times that of quails (Sales and Janssens 2003). Recently, the specialisation of the breeding industry in pigeons increased quickly, and the pigeon market is also growing with promising prospects for development.

Studies have shown that herbs and probiotics have excellent function in replacing antibiotics (Alagawany et al. 2023; Attia et al. 2023). ABP have been used as feed additives, but the research and application of ABP in pigeon production remains unclear. To investigate the roles of ABP MccJ25 in pigeon squabs, the growth performance, antioxidant capacity, intestinal barrier function and intestinal microbiota were measured after the addition of ABP MccJ25 to pigeon feed. The present study applied ABP MccJ25 to pigeon production for the first time and aimed to evaluate its potential effects on pigeon production and the possibility of being used as an alternative to antibiotic products. The result will provide a scientific basis for the application of ABP MccJ25 in pigeon production, promote the healthy development of the pigeon industry, and also provide support data and theoretical basis for the application of ABP in animal husbandry.

Materials and methods

Animal experimental design, management, and diet

The study was conducted under the corresponding supervision and was approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University (Nanjing, China; SYXK-2019-00085).

Random allocation was used to divide 80 pairs of American Silver King pigeon parents and 240 healthy day 1 squabs (from Dongchen Pigeon Industry Co. Ltd., Nanjing, China) into four groups, and each group included 4 parent pairs and 12 pigeon squabs with 5 replicates.

The doses of ABP were selected according to previous studies of ABP in poultry and the recommended dose of the manufacturer (Bao et al. 2009; Ma et al. 2020; Zhang et al. 2021). Parental pigeons were given basal diets (Control) or basal diets with 100, 200, or 300 mg/kg ABP MccJ25 (ABP100, ABP200, and ABP300, respectively) for 4 weeks. The level of nutrients and ingredients in the diet of parent pigeons are listed in Table 1. Every pair of parent pigeons took care of three pigeon squabs in a pen and fed the squabs with pigeon milk secreted from their crop. During the experiment, the parent pigeons were given unlimited access to feed and water in a ventilated aviary and raised in three layers of ladder cages. The ambient temperature ranged from 15 to 25 °C, with 12 h of natural light and 12 h of darkness, and a relative humidity of 55 to 70%. ABP MccJ25 with the purity of 94.7% (amino acid sequence: GYYGHVPVYPVGIGTIFSFYI) was purchased from Zhongnong Yingtai Linzhou Biological Co., Ltd (Anyang, China) and added to the diet for parent pigeons.

Table 1. Basal diet nutrient level and ingredients for parent pigeons.

Items	Content
Ingredients composition (%)
Corn	51.00
Pea	24.50
Wheat	18.00
Sorghum	3.00
Salt	0.30
Limestone	1.20
Shell powder	1.00
Premix^1	1.00
Total	100.00
Calculated nutrient (%)
Metabolizable energy (MJ/kg)	11.25
Crude protein	12.26
Lysine	0.72
Methionine	0.28
Calcium	0.78
Total phosphorus	0.53

¹The per kilogram of diet provided by the premix is as follows: vitamin A 4,000 IU, vitamin D₃ 1500 IU, vitamin E 20 IU, vitamin B₁ 2 mg, vitamin B₂ 10 mg, vitamin B₆ 2.5 mg, vitamin B₁₂ 0.05 mg, vitamin K₃ 1 mg, biotin 0.1 mg, calcium pantothenate 7.2 mg, folic acid 0.55 mg, niacin 20 mg, choline chloride 200 mg, Fe (FeSO₄·H₂O) 60 mg, Mn (MnSO₄) 50 mg, Cu (CuSO₄·5H₂O) 10 mg, Zn (ZnSO₄) 50 mg, I (KI) 0.4 mg, Se (Na₂SeO₃) 0.25 mg.

Growth performance measurement

The average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR) were calculated using weekly records of the feed intake of parental pigeons and the body weight (BW) of pigeon squabs at 1, 7, 14, and 28 days.

Sample collection

At 7, 14 and 28 days of age, a pigeon squab was randomly selected per replicate for blood collection from the wing vein. The serum was separated and kept at −20 °C after centrifuging at 4000×g at 4 °C for 15 min. At 28 days of age, one pigeon squab from each replicate was randomly selected for cervical dislocation euthanasia, and intestinal samples were collected from five pigeon squabs in each group. The intestines were removed, the intestinal contents were rinsed with phosphate buffer saline (PBS) and samples were collected from the duodenum, jejunum, ileum, and jejunum mucosa. The samples were frozen and kept at −80 °C immediately for mRNA determination. Additionally, samples from the duodenum, jejunum, and ileum were collected for intestinal morphology analysis. Ileal contents were collected in a sterile manner, rapidly frozen, and preserved at −80 °C, and four samples from each group were selected for 16SrDNA sequencing.

Antioxidant indicators

Commercial kits (from Nanjing Aoqing Biotechnology Co. Ltd., product numbers are YH1248, YH1218, YH1267, and YH1201, respectively) were used to test the total antioxidant capacity (T-AOC), malonaldehyde (MDA) content, glutathione peroxidase (GSH-Px) and superoxide dismutase (SOD) activity in the serum samples collected on days 7, 14 and 28.

Intestinal morphology

Five intestinal segments were collected from each group and fixed in 4% buffered formaldehyde, then embed in paraffin. The morphological analysis was performed after haematoxylin and eosin (H&E) staining. The villus height (VH), crypt depth (CD), and the ratio of villus height to crypt depth (V/C) were measured using the Olympus microsystem (Tokyo, Japan).

Intestinal-related gene expression

The intestine and jejunal mucosa samples were collected to extract total RNA using Trizol. Complementary DNA (cDNA) was synthesised from RNA with the cDNA Synthesis Kit (ABM, Richmond, Canada). A CFX Connect PCR detection system (Bio-Rad, Hercules, CA, USA) was used to measure the relative gene expression. The cDNA was amplified using the BlasTaq 2 X qPCR MasterMix (ABM, Richmond, Canada), the process began with initial denaturation at 95 °C for 3 min and then continued with 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The information on primer sequences is shown in Table 2. The method of 2^−ΔΔCT was used to calculate the relative mRNA expression for target genes compared with β-actin as a control.

Table 2. Specific primers used for quantitative real-time PCR.

Gene	Accession number	Primer sequences(5′→3′)	Product size
OCLN	XM_005509325.2	F:GCCTCATCTGCTTCTTCGCTCAC R:GTCCACCACATTCTTCACCCACTC	134
CLDN1	XM_005513213.2	F:ACATCATGGTATGGCAACAGAGTGG R:ACAGGAGCAGCAGAGGAAGGC	150
ZO1	XM_021299312.1	F:TGGGTGAGAAACGCTATGAG R:GCTTGTGATGTGCTGGGAGA	123
MUC2	XM_021296699.1	F:TGGCTCCACAGACAGGCAGAC R:TGGCTGACACATGAGGCACATTC	137
SOD1	XM_013370038.1	F:GCAGGGCATCATCCACTTCCAG R:ATCTCCGTCAGCCAAGCCATTG	82
SOD2	XM_013368727.2	F:AATGGAGGAGGAGAGCCTAAAGGAG R:AGCCTGATCCTTGAACACCAACTG	118
CAT	XM_005511042.2	F:CTGGAGAATCTGGCTCTGCTGATAC R:TGGATGAAGGACGGAAACAACAGTG	148
ACTB	XM_005504502.2	F:CCAGCCATGTATGTAGCCATCCAG R:AACACCATCACCAGAGTCCATCAC	90

Abbreviations: OCLN, occludin; CLDN1, claudin 1；ZO1, tight junction protein ZO 1; MUC2, mucin 2; SOD1, superoxide dismutase 1; SOD2, superoxide dismutase 2; CAT, catalase; ACTB, actin beta.

Intestinal microbiota analysis

Four samples of ileal contents from pigeon squabs in control and ABP200 groups were selected for 16SrDNA sequencing at Biomarker Technologies Co., Ltd (Beijing, China). High-throughput sequencing technology was used to measure gut microbiota indicators and the data was analysed on BMK Cloud platform (www.biocloud.net). Use QIME software to generate species abundance tables and alpha diversity indices for different classification levels. Principal component analysis (PCA), community structure maps, and principal coordinate analysis (PCoA) diagrams of the samples were drawn using R language tools. Conduct a t-test on the abundance data of the species in groups.

Statistical analysis

The Shapiro-Wilk test using SPSS 20.0 software (SPSS Inc., Chicago, IL, USA) was used to test the normality of the experimental data, and then one-way analysis of variation (ANOVA) and Tukey’s multiple comparison tests were used to evaluate the differences among the four groups. Linear and quadratic effects analyses were performed for responses to ABP levels using orthogonal polynomial contrasts. Growth performance was analysed in replicates as the experimental unit, while each individual bird was used as an experimental unit for other parameters. The statistical results were expressed as mean ± SEM, and p value < 0.05 was considered a statistically significant difference. Statistical modal: Y_ij = μ + T_i + e_ij, where Y_ij = the value of the observation treatment, μ = the overall mean, T_i = the effect of treatments, and e_ij = the random error.

Results

Effect of ABP MccJ25 on the growth performance in pigeon squabs

As shown in Table 3, BW of pigeon squabs from day 7 to day 14 increased linearly and quadratically with increasing level of dietary ABP, and FCR decreased linearly and quadratically (p-linear and quadratic < 0.05). In addition, ADG showed a quadratic increase with the increase in dietary ABP level (p-quadratic < 0.05). From day 14 to 21, pigeon squabs in the group ABP200 had an obvious decrease in FCR, and showed a remarkable increase in ADG (p < 0.05; Table 3).

Table 3. Effects of antibacterial peptide (ABP) MccJ25 on the growth performance of pigeon squabs.

Items^1	Treatment^2					p value^4
	CON	ABP100	ABP200	ABP300	SEM^3	P	L	Q
1–7d of age
BW (g/bird)	165.54	160.05	160.71	156.29	1.64	0.250	0.408	0.190
ADG (g/d/bird)	21.39	20.35	20.72	20.40	0.32	0.731	0.374	0.652
ADFI (g/d/bird)	36.96^b	33.82^ab	31.24^a	32.92^ab	0.71	0.037	0.072	0.017
FCR	1.74	1.69	1.67	1.71	0.03	0.931	0.614	0.725
7–14d of age
BW (g/bird)	317.21^a	338.93^b	350.35^b	335.46^b	2.82	< 0.000	0.001	0.006
ADG (g/d/bird)	21.56^a	23.68^ab	25.69^b	24.94^b	0.50	0.037	0.121	0.007
ADFI (g/d/bird)	61.97	62.56	63.46	63.33	1.10	0.963	0.852	0.620
FCR	3.31^b	2.75^a	2.26^a	2.50^a	0.08	< 0.000	0.003	0.000
14–21d of age
BW (g/bird)	388.32	388.58	392.28	402.70	3.54	0.456	0.762	0.207
ADG (g/d/bird)	11.68^a	11.713^a	14.48^b	12.46^ab	0.44	0.044	0.567	0.039
ADFI (g/d/bird)	73.09	71.99	69.75	71.10	1.04	0.718	0.629	0.321
FCR	6.43^b	6.55^b	5.18^a	6.23^ab	0.20	0.049	0.690	0.049
21–28d of age
BW (g/bird)	448.90	451.67	465.33	459.28	3.44	0.317	0.647	0.083
ADG (g/d/bird)	8.84	9.65	9.36	8.89	0.36	0.835	0.376	0.869
ADFI (g/d/bird)	80.06	78.49	77.76	77.63	0.96	0.803	0.620	0.428
FCR	10.10	9.00	9.12	9.58	0.35	0.686	0.243	0.773

¹ BW, body weight; ADG, average daily gain; ADFI, average daily feed intake; FCR, feed conversion ratio.

² CON: Basal diet; ABP100, ABP200, ABP300: Basal diet supplemented with 100, 200, and 300 mg/kg antibacterial peptide MccJ25, respectively.

³ SEM: pooled standard error of means.

⁴ L: linear; Q: quadratic. Orthogonal polynomials were used to evaluate linear and quadratic responses to the levels of dietary ABP (n = 24 pigeons).

^a,b The values in a row with different letters show significant differences (p < 0.05).

Effect of ABP MccJ25 on the intestinal morphology and barrier function in pigeon squabs

The impact of ABP treatment on the intestinal morphology of pigeon squabs was shown in Figure 1 and Table 4. The villi of pigeon squabs in the ABP groups were denser and higher compared to those of control, and the intestinal villi in the ABP groups were complete in morphology and structure (Figure 1A). VH in the duodenum of day 28 pigeon squabs was significantly increased in groups ABP200 and ABP300 compared with the control group, and group ABP200 had a significantly high of V/C (p < 0.05; Table 4). In the jejunum, the VH of day 28 pigeon squabs increased linearly and quadratically with increasing level of dietary ABP (p-linear and quadratic < 0.05), and the ABP200 and ABP300 groups significantly decreased the CD and significantly increased the V/C in pigeon squabs (p < 0.05; Table 4). In the ileum, different concentrations of ABP groups linearly and quadratically increased the V/C in 28-day-old pigeon squabs (p-linear and quadratic < 0.05), and the ABP200 group also significantly increased the VH of pigeon squabs (p < 0.05; Table 4).

Figure 1. Intestinal morphology and relative mRNA expression of intestinal barrier-related genes in 28-day-old pigeon squabs. Note: (A) The morphology of intestine with H&E staining. (B–E) Relative mRNA expression of tight junction genes in squab’s duodenum, jejunum, ileum, and jejunal mucosa, respectively. Abbreviations: OCLN, occludin; CLDN1, claudin 1; ZO1, tight junction protein ZO 1; MUC2, mucin 2; CON: Basal diet; ABP100, ABP200, ABP300: Basal diet supplemented with 100 mg/kg, 200 mg/kg, and 300 mg/kg antibacterial peptide MccJ25, respectively. ns, p > 0.05; *, p < 0.05, compared with CON. Scale bar, 500 μm. (n = 5 pigeons).

Table 4. Effects of antibacterial peptide (ABP) MccJ25 on the intestinal morphology of 28-day-old pigeon squabs.

Items^1	Treatment^2					p value^4
	CON	ABP100	ABP200	ABP300	SEM^3	P	L	Q
Duodenum
VH (μm)	1329.62^a	1337.64^a	1542.9^b	1533.56^b	24.95	< 0.001	< 0.001	0.374
CD (μm)	94.56^a	95.94^a	96.86^a	106.7^b	1.28	< 0.001	< 0.001	0.309
V / C	14.08^a	13.95^a	15.94^b	14.38^a	0.21	< 0.001	0.257	< 0.001
Jejunum
VH (μm)	686.68^a	736.74^b	777.6^b	767.16^b	10.24	0.001	0.018	< 0.001
CD (μm)	99.24^b	99.56^b	86.72^a	86.88^a	1.61	< 0.001	0.910	< 0.001
V / C	6.93^a	7.40^a	8.97^b	8.84^b	0.22	< 0.001	0.064	< 0.001
Ileum
VH (μm)	351.9^a	370.26^ab	390.94^b	366.86^ab	6.07	0.048	0.135	0.132
CD (μm)	83.54	80.36	80.22	77.1	1.14	0.278	0.527	0.158
V / C	4.21^a	4.61^b	4.89^b	4.76^b	0.08	0.010	0.032	0.005

¹ VH, villus height; CD, crypt depth; V/C, villus height to crypt depth ratio.

² CON: Basal diet; ABP100, ABP200, ABP300: Basal diet supplemented with 100, 200, and 300 mg/kg antibacterial peptide MccJ25, respectively.

³ SEM: pooled standard error of means.

⁴ L: linear; Q: quadratic. Orthogonal polynomials were used to evaluate linear and quadratic responses to the levels of dietary ABP (n = 5 pigeons).

^{a ,b} The values in a row with different letters show significant differences (p < 0.05).

The relative mRNA expression of intestinal barrier-related genes was measured in pigeon squabs after ABP treatment. Group ABP200 increased the relative mRNA expression of intestinal barrier-related genes in the duodenum (OCLN, CLDN1, and MUC2) and jejunum (OCLN, CLDN1, ZO1, and MUC2) (p < 0.05; Figure 1B, C). Additionally, in the jejunal mucosa and ileum, the mRNA expression of intestinal barrier-related genes OCLN, ZO1 and MUC2 was up-regulated (p < 0.05; Figure 1D, E).

Effect of ABP MccJ25 on the antioxidant capacity in pigeon squabs

At day 7, a significant increase in serum SOD activity of pigeon squabs was found in groups ABP200 and ABP300 compared to control, and ABP200 also showed a significant increase in serum GSH-Px activity and T-AOC (p < 0.05; Table 5). At day 21, there was a quadratic decrease in MDA content (p-quadratic < 0.05) and a linear increase in GSH-Px activity (p-linear < 0.05) with increasing dietary ABP levels, and the group ABP200 suggested an obvious increase in serum SOD activity compared with the control group (p < 0.05; Table 5). At day 28, pigeon squabs in the groups ABP200 and ABP300 exhibited activity enhancement in serum SOD compared with the control group (p < 0.05; Table 5). The ABP200 group also experienced a significant increase in serum GSH-Px activity and T-AOC, and a significant decrease in MDA content (p < 0.05; Table 5).

Table 5. Effects of antibacterial peptide (ABP) MccJ25 on the serum antioxidative parameters of pigeon squabs.

Items^1	Treatment^2					p value^4
	CON	ABP100	ABP200	ABP300	SEM^3	P	L	Q
7d of age
T-AOC (U/mL)	36.34^a	42.46^ab	55.29^b	45.89^ab	2.92	0.039	0.236	0.050
MDA (nmol/mL)	0.83	0.76	0.81	0.71	0.03	0.400	0.667	0.524
GSH-Px (nmol/min/mL)	23.94^a	29.66^ab	35.02^b	32.51^ab	1.59	0.047	0.096	0.017
SOD (U/mL)	1.01^a	2.42^ab	4.26^c	3.01^bc	0.14	0.016	0.050	0.007
14d of age
T-AOC (U/mL)	30.46	36.70	39.07	35.43	1.71	0.375	0.280	0.177
MDA (nmol/mL)	0.72	0.65	0.64	0.71	0.02	0.550	0.228	0.724
GSH-Px (nmol/min/mL)	26.8	34.13	35.02	31.62	1.43	0.162	0.051	0.280
SOD (U/mL)	2.36	2.60	3.06	4.11	0.33	0.248	0.907	0.102
21d of age
T-AOC (U/mL)	30.02	35.82	37.05	36.34	1.47	0.334	0.147	0.280
MDA (nmol/mL)	0.72^b	0.71^b	0.60^a	0.65^ab	0.02	0.047	0.461	0.020
GSH-Px (nmol/min/mL)	30.02^a	31.62^ab	35.73^bc	38.23^c	1.14	0.009	0.002	0.208
SOD (U/mL)	3.33^a	4.84^ab	6.48^b	5.09^ab	0.41	0.023	0.041	0.014
28d of age
T-AOC (U/mL)	34.41^a	42.54^ab	43.49^b	38.83^ab	1.49	0.041	0.226	0.030
MDA (nmol/mL)	0.84^b	0.83^b	0.62^a	0.77^ab	0.03	0.049	0.384	0.025
GSH-Px (nmol/min/mL)	36.09^a	38.41^a	49.67^b	41.63^a	1.71	0.003	0.087	0.001
SOD (U/mL)	3.45^a	4.50^ab	6.8^bc	7.08^c	0.32	0.004	0.001	0.313

¹ T-AOC, total antioxidant capacity; MDA, malonaldehyde; GSH-Px, glutathione peroxidase; SOD, superoxide dismutase.

² CON: Basal diet; ABP100, ABP200, ABP300: Basal diet supplemented with 100, 200, and 300 mg/kg antibacterial peptide MccJ25, respectively.

³ SEM: pooled standard error of means.

⁴ L: linear; Q: quadratic. Orthogonal polynomials were used to evaluate linear and quadratic responses to the levels of dietary ABP (n = 5 pigeons).

^a,b,c The values in a row with different letters show significant differences (p < 0.05).

The relative mRNA expression of intestinal antioxidant genes was tested in pigeon squabs after ABP treatment. The relative mRNA expression of antioxidant-related genes (SOD1, SOD2, and CAT) in the duodenum and ileum was up-regulated in group ABP200 (p < 0.05; Figure 2A, C). Additionally, group ABP200 also up-regulated the relative mRNA expression of antioxidant-related genes in the jejunum (SOD1 and SOD2), and jejunal mucosa (SOD2 and CAT) (p < 0.05; Figure 2B, D).

Figure 2. The relative mRNA expression of genes related to intestinal antioxidants in 28-day-old pigeon squabs. Note: (A–D) Relative mRNA expression of antioxidant genes in squab’s duodenum, jejunum, ileum, and jejunal mucosa, respectively. Abbreviations: SOD1, superoxide dismutase 1; SOD2, superoxide dismutase 2; CAT, catalase; CON, Basal diet; ABP200, Basal diet supplemented with 200 mg/kg ABP MccJ25. ns, p > 0.05; *, p < 0.05, compared with CON. (n = 5 pigeons).

Effect of ABP MccJ25 on the ileal microbiota diversity in pigeon squabs

Group ABP200 exerted roles in antioxidant capacity, growth performance, and intestinal barrier function in squabs, as well as the gut microbiota. In this study, 16s Illumina sequencing was performed on the ileal contents of control and ABP200 pigeon squabs. From all samples, 560,794 sequences were obtained, of which 559,107 were high-quality after screening and then classified into 644 operational taxonomic units (OUTs) at 97% similarity. The Chao1 and Ace indices indicated the richness of the ileal microbiota, while the Shannon and Simpson indices reflected its diversity (Figure 3). The Ace, Chao1 and Shannon indexes of group ABP200 decreased significantly (p < 0.05; Figure 3A–C) compared to those of control. The PCA and PCoA results showed that the samples between the two groups aggregated individually and showed differences between the two groups (Figure 3E, F).

Figure 3. Alpha and beta diversity in the ileal microbiota of 28-day-old pigeon squabs. Note: (A–D) OTU level alpha diversity. (E) PCA plot of ileal microbiota at out level. (F) PCoA plot of ileal microbiota at out level. Abbreviations: CON, Basal diet; ABP200, Basal diet supplemented with 200 mg/kg ABP MccJ25. ns, p > 0.05; *, p < 0.05, compared with CON. (n = 4 pigeons).

Effect of ABP MccJ25 on the ileal microbiota composition in pigeon squabs

The relative abundance of ileal microbiota was further analysed at the level of phylum and genus. The dominant bacterial phylum of the ileum in pigeon squabs were Firmicutes, Proteobacteria, Actinobacteriota, Bacteroidota, and Cyanobacteria, which account for over 90% of the total bacterial community (Figure 4A). Compared with control, supplementation with ABP 200 increased the relative abundance of Firmicutes, (p < 0.05; Table 6), whereas that of Proteobacteria, Actinobacteriota, Bacteroidota, Cyanobacteria, Acidobacteriota, Gemmatimonadota, and Verrucomicrobiota decreased significantly (p < 0.05; Table 6). The dominant bacteria at the level of the genus were Lactobacillus, Streptococcus, Ligilactobacillus, Bacillus, Limosilactobacillus, unclassified_Cyanobacteriales, Klebsiella, unclassified_Bacteria, unclassified_Muribaculaceae, and Leptotrichia (Figure 4B). There was a trend of increase in the relative abundance of Streptococcus, Ligilactobacillus, Bacillus, Ligilactobacillus and Lactobacillus in group ABP 200 compared with control (p > 0.05; Table 7), whereas that of unclassified_Cyanobacteriales, unclassified_Bacteria, and unclassified_Muribaculaceae showed a significant decrease in the ileal microbiota of group ABP200 (p < 0.05; Table 7).

Figure 4. The microbial community in the ileal contents in 28-day-old pigeon squabs. Note: the percentage of microbial abundance at the phylum (a), and genus (B) levels in the ileum. Abbreviations: CON, Basal diet; ABP200, Basal diet supplemented with 200 mg/kg ABP MccJ25. (n = 4 pigeons).

Table 6. Effects of the antibacterial peptide (ABP) MccJ25 on the relative abundance of the ileal microbial community at the phylum level of 28-day-old pigeon squabs.

	Treatment^1
Phylum	CON (%)	ABP200 (%)	p value^2
Firmicutes	53.38 ± 8.47^a	90.64 ± 4.72^b	0.009
Proteobacteria	16.62 ± 2.54^b	3.59 ± 1.84^a	0.006
Actinobacteriota	9.32 ± 2.49^b	2.00 ± 1.09^a	0.036
Bacteroidota	6.24 ± 1.44^b	0.26 ± 0.09^a	0.006
Cyanobacteria	4.99 ± 0.63^b	0.34 ± 0.11^a	< 0.001
unclassified_Bacteria	2.28 ± 0.41^b	0.14 ± 0.07 ^a	0.002
Fusobacteriota	0.38 ± 0.14	2.48 ± 1.48	0.207
Acidobacteriota	2.08 ± 0.32^b	0.09 ± 0.06^a	0.001
Gemmatimonadota	1.02 ± 0.20^b	0.08 ± 0.07 ^a	0.004
Verrucomicrobiota	1.05 ± 0.47	0.02 ± 0.01	0.073

¹ CON: Basal diet; ABP200: Basal diet supplemented with 200 mg/kg antibacterial peptide MccJ25.

² P-value was obtained by ANOVA.

^a,b The values in a row with different letters show significant differences (p < 0.05). Data were in the form of percentages (%) and presented as mean ± SEM (n = 4 pigeons).

Table 7. Effects of the ABP MccJ25 on the relative abundance of the ileal microbial community at the genus level of 28-day-old pigeon squabs.

	Treatment^1
Genus	CON (%)	ABP200 (%)	p value^2
Lactobacillus	29.29 ± 11.59	44.91 ± 17.08	0.478
Streptococcus	3.77 ± 1.69	23.02 ± 16.05	0.278
Ligilactobacillus	3.32 ± 1.14	9.33 ± 4.38	0.232
Bacillus	3.67 ± 0.82	7.22 ± 3.31	0.337
Limosilactobacillus	1.36 ± 0.53	3.62 ± 0.86	0.067
unclassified_Cyanobacteriales	4.57 ± 0.54^b	0.27 ± 0.09^a	< 0.001
Klebsiella	1.96 ± 1.12	0.77 ± 0.40	0.357
unclassified_Bacteria	2.28 ± 0.41^b	0.14 ± 0.07^a	0.002
unclassified_Muribaculaceae	2.13 ± 0.49^b	0.09 ± 0.03^a	0.006
Leptotrichia	0.12 ± 0.09	2.47 ± 1.48	0.163

¹ CON: Basal diet; ABP200: Basal diet supplemented with 200 mg/kg antibacterial peptide MccJ25.

² P-value was obtained by ANOVA.

^a,b The values in a row with different letters show significant differences (p < 0.05). Data were in the form of percentages (%) and presented as mean ± SEM (n = 4 pigeons).

The linear discriminant analysis (LDA) and linear discriminant analysis effect size (LEfSe) analyses were used to determine the major bacterial taxa of the ileal microbiota. The taxa significantly enriched in ABP200 were shown in blue in Figure 5A. According to the LEfSe results (LDA score > 4.0), it was shown that Firmicutes, Lactobacillales and Bacilli were the markers of ileal microbiota in group ABP200, and Proteobacteria, Gammaproteobacteria, Clostridia, Actinobacteriota, Bacteroidia, Bacteroidota, Bacteroidales, Cyanobacterialse, Cyanobacteria, Cyanobacteriia, Alphaproteobacteria, Oscillospirales, Lachnospirales, Lachnospiraceae, Enterobacterales, Enterobacteriaceae, Muribaculaceae, Ruminococcaceae were the markers of ileal microbiota in control (Figure 5B).

Figure 5. Taxon biomarkers in the ileal contents in 28-day-old pigeon squabs. Note: (A) Cladogram of LEfSe analysis. (B) LDA value distribution histogram. Circles from the inside to the outside in the cladogram indicate from the phylum level to the species level, and small circles within each level represent different classifications at that level. Bacteria enriched in the control group are stated in orange and the ABP200 group in blue, with yellow showing no difference in the two groups. Biomarkers with an LDA score >4.0 indicate statistical significance. Abbreviations: CON, Basal diet; ABP200, Basal diet supplemented with 200 mg/kg ABP MccJ25. (n = 4 pigeons).

Discussion

Currently, new alternative antibiotic products are being sought due to the restriction of antibiotics in feed. ABP is considered an alternative to antibiotics due to its antimicrobial properties, chemotactic activity, and ability to modulate the inflammatory response (Raheem and Straus 2019; Rima et al. 2021; Shi et al. 2021). Previous research suggested that the addition of ABP significantly increased the BW, reduced the FCR and improved growth performance in broilers (Bao et al. 2009; Zhu et al. 2022).

The digestive and absorptive capacity and health of the intestinal were determined by VH, CD, and VH/CD (Brudnicki et al. 2017; Wang et al. 2023). Our results indicated that ABP MccJ25 boosted VH and VH/CD of the small intestine in pigeon squabs, improved intestinal morphology, and thus enhanced nutrient digestion and absorption and improved growth performance. This finding was consistent with previously reported studies showing that ABP improved small intestine morphology, increased VH, decreased CD, and increased VH/CD in broilers (Sholikin et al. 2021; Zhu et al. 2022). The addition of 200 mg/kg ABP containing fly larvae extract (HLE) to the diet remarkably improved the production performance of Ross 308 broilers (Park, 2023). Similarly, this study showed that the addition of 200 mg/kg and 300 mg/kg ABP MccJ25 had a significantly positive effect on growth performance and gut health compared with control in pigeon squabs. However, high dose of ABP300 group had no additional positive effects than that of ABP200 group. From the result of the present study, the addition of 200 mg/kg was the optimal dose in pigeon squabs. MccJ25 had strong antibacterial and anti-inflammatory activity and it has been reported in the literature that low doses of chitosan nanoparticles Microcin J25 (CNM) increased body weight and immunity and improved intestinal health in mice (Yu et al. 2022a). However, the high levels of CNM were damaging to the intestinal health of mice, causing severe adverse effects (Yu et al. 2022b). Therefore, attention need be paid that high doses of ABP MccJ25 will cause damage to the organism and have negatively effects in production performance. The present study showed that the best results were obtained by adding 200 mg/kg ABP MccJ25 to pigeon feed.

The gut has physical, chemical, immune, and microbiological barriers that collaborate to combat external stimuli (Pellegrini et al. 2023). Epithelial cells played a crucial role in maintaining normal intestinal function by forming a physical barrier through the formation of tight junctions (TJ), whereas disruption of the tight junctions disrupts the barrier structure, leading to the incensement of intestinal permeability and the impairment of entestinal health (Zhao et al. 2021; Zhang et al. 2022). Claudins, occludin, and the tight junction protein ZO1 are the primary components of the intestinal TJ. MUC2 is a significant mucin present in the intestinal mucosa, playing a crucial role in protecting against bacteria and maintaining mucosal barrier function (Johansson et al. 2011). The addition of ABP NK-lysin to the feed significantly up-regulated the mRNA expression level of OCLN, ZO1 and MUC2 in the broiler intestine, increased intestinal integrity and improved growth performance (Wickramasuriya et al. 2021). The above study indicated that barrier-associated proteins were crucial in preserving intestinal barrier function, and the mRNA expression levels of these proteins were increased by ABP. A previous study reported that a supplement with recombinant ABP cLFchimera in the chicken diet resulted in increased mRNA expression levels of CLDN1 and OCLN (Daneshmand et al. 2020). Consistent with the previously mentioned studies, the intestinal barrier function was enhanced in pigeon squabs when supplied with 200 mg/kg ABP MccJ25, as well as up-regulated the mRNA expression levels of OCLN, CLDN1, ZO1 and MUC2 in the intestinal and jejunum mucosa to promote intestinal health. The improvement of intestinal morphology and the enhancement of intestinal barrier function in pigeon squabs may be related to the alteration of intestinal flora. It has been shown that the addition of ABP to broiler feeds significantly reduced the content of intestinal Escherichia coli, and increased the mRNA expression level of intestinal barrier genes CLDN3 and ZO1 (Zhang et al. 2021).

In the process of animal breeding, several factors, such as transshipment and feeding environment, may lead to an imbalance of free radicals in the animal body, resulting in oxidative stress and affecting production performance. The production and elimination of free radicals in the organism are kept in relative balance, and when there is an excess of free radicals, proteins and other biomolecules are damaged, resulting in cell and tissue damage as well as instability of the internal environment (Singh et al. 2019). Various antioxidant molecules and enzymes in the organism determine the organism’s overall antioxidant level. SOD and GSH-Px clear free radicals in the organism to counteract oxidative damage, and their activities can indirectly reflect the organism’s ability to clear free radicals (Chueh et al. 2019; Xiong et al. 2020). The MDA level in blood and tissues indirectly indicates the extent of oxidative damage in the organism, as it is a relatively stable lipid peroxide (Samarghandian et al. 2017). ABP increased SOD activity in intestinal tissues, decreased MDA content, and improved the antioxidant capacity of broiler intestines (Xie et al. 2020). The study found that high doses of ABP MccJ25 (200 and 300 mg/kg) significantly boosted the antioxidant capacity of pigeon squabs by increasing serum T-AOC, SOD, and GSH-Px activities while decreasing the MDA content. Notably, in contrast to the control group, different concentrations of ABP groups improved the serum antioxidant capacity of pigeon squabs, but there was no dose-dependent effect of ABP on the antioxidant capacity of pigeons, and the effect of ABP MccJ25 at a concentration of 200 mg/kg was better than that of 300 mg/kg group. This may be due to the fact that ABP MccJ25 has a dose-cumulative effect similar to that of antibiotics, and an overdose can adversely affect the health of the organism. Moreover, our study indicated that ABP MccJ25 increased the relative mRNA expression of antioxidant-related genes SOD1, SOD2, and CAT in the intestinal and jejunal mucosa of pigeon squabs, suggesting that ABP also elevated the antioxidant capacity of the intestinal tract of pigeon squabs, which is beneficial to the health of pigeon squabs.

The microbiota is crucial in the intestines and has a significant impact on the host’s nutrient absorption and immune system (Kogut 2013; Dai et al. 2022). In this study, beta diversity results such as PCA and PCoA showed differences in intestinal microbiota between CON and ABP200 groups, and the alpha diversity indices Chao1, Ace, and Shannon declined, indicating that a diet supplemented with ABP resulted in a decrease in the abundance and diversity of the intestinal microbiota of pigeon squabs. However, it was reported that ABP increased the diversity of intestinal microbiota in broilers (Xie et al. 2020). We speculate that it may be due to differences in species and types of ABP used; their study added a combination of ABP Pratt and origin plant essential oil, and this study added ABP MccJ25. MccJ25 is a potent antibacterial lasso peptide (Martin-Gómez et al. 2019), and it was reported that recombinant ABP MccJ25 has significant antibacterial properties against Salmonella and Escherichia coli O157: H7 (Yu et al. 2019). In a previous study, it was shown that ABP MccJ25 reduced the number of Escherichia coli in broiler faeces and reduced the infection rate of Salmonella in broilers (Wang et al. 2020). The exact reasons for this need to be further explored. In addition, this study found that ABP MccJ25 significantly decreased the relative abundance of the harmful bacteria Proteobacteria and Enterobacteriaceae, and the relative abundance of Firmicutes and Lactobacillales increased significantly. Lactobacillales acted as a probiotic that promotes intestinal health, indicating that ABP MccJ25 inhibited the growth of harmful bacteria such as Enterobacteriaceae, promoted the proliferation of probiotics such as Lactobacillales, and is conducive to the intestinal health of pigeon squabs.

It was previously reported that 200 mg/kg ABP was the best addition in broiler production (Zhang et al. 2021). The present study also showed that the addition of 200 mg/kg ABP MccJ25 to pigeon diets got the best effects in pigeon squabs, which promoted the growth performance and was beneficial to the health of pigeons. Results indicated that ABP MccJ25 can be used as an antibiotic alternative in pigeon production, which will promote the development of the pigeon industry and also provide a basis for further application of ABP MccJ25 in animal husbandry.

Conclusion

This study demonstrated that the supplementation of ABP MccJ25 elevated the serum antioxidant capacity and up-regulated the relative mRNA expression of intestinal antioxidant and barrier-related genes, which enhanced the intestinal barrier function and antioxidant capacity of pigeon squabs and promoted intestinal health. In addition, ABP 200 increased the abundance of beneficial bacteria and decreased the abundance of harmful bacteria in the intestines of pigeons, and improved the intestinal morphology, which promoted the digestion and assimilation of nutrients and promoted the growth and development of pigeon squabs. The addition of 200 mg/kg ABP MccJ25was recommend to be used as an alternative to antibiotics in pigeon production.

Ethical approval

All experimental procedures were implemented according to the Local Experimental Animal Care Committee and approved by the ethics committee of Nanjing Agricultural University (Nanjing, China, SYXK-2019-00085).

Disclosure statement

The authors reported no potential conflict of interest.

Data availability statement

The data that support the findings of this study are available from the corresponding author, Minli Yu, upon reasonable request.

Additional information

Funding

This work was supported by the National Natural Science Foundation of China [32372825], the Fundamental Research Funds for the Central Universities [KYZ201724] and the Rural Revitalisation of Industrial Development Fund of Nanjing Luhe, China [No. HY0075].