ABSTRACT
Doubled haploid (DH) production accelerates the development of homozygous lines in a single generation. In maize, haploids are widely produced by the use of haploid inducer Stock 6, earlier reported in 1959. Three independent studies reported haploid induction in maize which is triggered due to a 4 bp frame-shift mutation in matrilineal (ZmPLA1) gene. The present study was focused on the generation of mutants for ZmPLA1 gene in maize inbred line LM13 through site-directed mutagenesis via CRISPR/Cas9-mediated ribonucleoprotein (RNP) complex method to increase the haploid induction rate. Three single guide RNAs (sgRNAs) for the ZmPLA1 gene locus were used for transforming the 14 days old immature embryos via bombardment. 373 regenerated plants were subjected to mutation detection followed by Sanger’s sequencing. Out of three putative mutants identified, one mutant depicted one base pair substitution and one base pair deletion at the target site.
In light of the changing climatic scenario, it is important to accelerate climate-resilient line development. Doubled haploid (DH) technology based on in vivo haploid induction and the successive doubling of haploids is a promising method to develop homozygous lines in 2–3 generations.Citation1,Citation2,Citation3 Thus the DHs can acquire conventional plant breeding to speed up the breeding of high yielding varieties and resistant to the biotic and abiotic stresses.
The successful in vivo maternal haploid induction is triggered by using the inducer line as male, which is a unique mechanism in maize DH production system. CRISPR-Cas9 system has been established as a revolutionary technique with wide applications in plant biology.Citation4 In maize, genome modification has been reported previously for different traits.Citation5 Many quantitative trait loci (QTLs) which significantly affect the haploid induction rate (HIR) have been mapped.Citation6 Among these qhir1 QTL locus has the most significant effect on the haploid induction.
Prigge et al.Citation7 reported that two key quantitative trait loci, qhir1 and qhir8, lead to high-frequency haploid induction in maize. Fine mapping and sequence analysis studies of these QTLs led to the conclusion that mutations in PHOSPHOLIPASE A1 (ZmPLA1)Citation8 and DOMAIN OF UNKNOWN FUNCTION 679 MEMBRANE PROTEIN (ZmDMP)Citation9 have been shown to generate haploids in maize. Both ZmDMP and ZmPLA1 have shown similar expression patterns and subcellular localization in maize. Recent findings reveal that knockout of ZmDMP along with ZmPLA1 triggered haploid induction and exhibited a greater ability to increase the HIR by 5–6 folds.Citation10
There are some newly developed protocols which can be used for the regeneration of the plantlets from the immature embryos of maize,Citation11 In vitro transcription of the sgRNA,Citation12 the modified gene gun bombardment technique for an effortless gene transformationCitation13 and in vitro cleavage of the DNA using CRISPR/Cas9 RNP complex for the pre-validation, functionality and efficiency of CRISPR genome editing system.Citation14 The present study aims at generating mutants for ZmPLA1 gene in maize inbred line of PAU (LM13) through RNP complex-based genome editing to obtain higher HIR.
Materials and Methods
Maize inbred line LM13 (JCY-3-7-1-1-1) was selected to generate the mutants for the target gene, as this line is better responsive to the agronomical practices and a good combiner in hybrid breeding programme. ZmPLA1 gene from the LM13 was cloned, sequenced and aligned to ZmPLA1 locus (GRMZM2G471240) and conserved regions were identified to design sgRNA. The guide RNA was designed using CRISPR Plant v2.0 software (http://crispr.hzau.edu.cn/CRISPR2/) and comparative analysis was done with other software known as CHOP CHOP (http://chopchop.cbu.uib.no/) (). sgRNA synthesis was followed according to the protocols provided with Thermo Fisher Kit. T7 promotor region was used for the in vitro transcription of sgRNA from its DNA template. in vitro transcribed product purified and maintained for further experiments. Ribonucleoprotein complex was prepared by taking 2 µg of Truecut Cas9 protein (Thermofisher) and 2 µg of sgRNA at optimal 1:1 concentration and was used for the in vitro cleavage assay and then for the bombardment reactions. in vitro cleavage assay was performed, to check the cleavage efficiency for all these sgRNAs.
Table 1. List of sgRNA’s (with protospacer adjacent motifs) with their parameters.
Immature embryos were placed on the 0.4 M mannitol containing osmoticum MS medium and used for bombardments. These bombarded embryos were then transferred into the half MS medium to obtain the desired growth of plantlets. Genomic DNA was isolated from the regenerated plantlets using CTAB method.Citation15 The ZmPLA1 gene-specific primers were designed for first exon using Primer 3 software (ZmPLAEX1MDF–5“GTCCATGCAATACCTGTAGC3,”
ZmPLAEX1MDR–5“AAAGTGGTTGATGTCCTTGG3,”
ZmPLAEX1MDF1–5“CCATGCAATACCTGTAGCACG3,”
ZmPLAEX1MDR1–5“GGATGGATGCAAGAACAATGG3”). PCR amplified products from all the 288 regenerated plantlets were resolved on 2.5% agarose gel. Cleavage mutation detection assay was performed by GeneArt® genomic cleavage detection kit (ThermoFisher Scientific) to identify the putative mutants. The cleavage detection enzyme T7E1 recognizes and cleaves the heteroduplex loops formed by insertion or deletion of nucleotides. Due to limitations of this assay rest of the remaining samples were sent for the Sanger’s sequencing in duplicates. After sequencing, various bioinformatic tools like Chromas software, clustalX 2.0 software, BLAST analysis by NCBI, CRISPR ID and DsDecodedM, were used to align the sequences with reference control (LM13) to identify any mutations like insertion/deletion.The monoallelic and biallelic mutations were detected using the DsDecodedM online web tool. ExPASy and ORF finder were used to track the disturbance in open reading frame or the replacements and rearrangements in amino acids.
Results and Discussion
In the present study, efforts were made to edit the ZmPLA1 locus through site-directed mutagenesis to generate a novel haploid inducer stock in tropical maize background. As previously reported, haploids were produced using crosses to Stock 6Citation16 and the mechanism of haploid induction was studied later on by three independent laboratories.Citation8,Citation17,Citation18 The mechanism of haploid induction is triggered by a 4 bp mutation in the ZmPLA1 geneCitation8,Citation18 and further edits in this gene could lead to increase in haploid induction rate of 6–7%.
The sgRNA DNA templates of 120 bp for the sgRNAs namely sg166, sg17 and sg20 were synthesized followed by in vitro transcription that resulted in 100 bp intact CRISPR fragment of sgRNAs (). Similarly, Hu et al.Citation19 observed 120 bp of sgRNA DNA template synthesized using four overlapping primers for targeting the EGFR genes. Moreover, Liang et al.Citation20 transcribed a 100 bp intact fragment of sgRNA from the template while working on isolated cell lines of Jurkat cells. Jinek et al.Citation21 observed cleaved fragments of ≈ 2230 bp and≈3100 bp from 5332 bp intact fragment of human clathrin light chain (CLTA) gene which was an indicator of Cas9 mediated cleavage. Therefore, in vitro cleavage assay was performed on the transcribed gRNAs for determining their cleavage efficiency. The assay resulted in two cleaved bands of size≈210 bp and≈165 bp and≈230 and≈150 bp in case of sg166 and sg17 respectively. However, the sgRNA sg20 resulted in an intact band of 376 bp depicting no proper cleavage (Supp ); hence the sgRNA sg166 and sg17 were selected for further study.
Figure 1. sgRNA DNA template−120 bp fragment (M = 50 bp ladder).
Figure 2. in vitro transcription of sgRNA- 100 bp fragment (M = 50 bp ladder).
Figure 3. in vitro cleavage assay gel picture.
Previous reports available in maize suggest successful regeneration from mature embryos,Citation22 nodal culture,Citation23 splited seeds,Citation24 and immature embryos as an explant.Citation25–27 However, immature embryos are the material of choice in maize for the efficient production of transgenic lines through particle bombardment or Agrobacterium transformation.Citation28 The advantages of particle bombardment over Agrobacterium mediated transformation were studied by Mookkan.Citation13 In the present study, a total of 2315 embryos were bombarded using both the sgRNAs and 373 plants were regenerated and survived upto hardening. Malini et al.Citation29 reported that the concentrations of BAP (0.5, 1.0 and 1.5 mg/l), NAA (0.1, 0.2 and 0.3 mg/l) and kinetin (1.0 mg/l) to be used for plant regeneration in case of immature embryos. Whereas Guruprasad et al.Citation28 regenerated plantlets from immature embryos using MS medium formulations.
The cleavage detection assay was performed on the few samples to detect the mutations in the targeted region along with LM13 (Non-transformed) as a control. The cleaved bands in the positive control validated the efficiency of the sgRNAs; meanwhile, the single band in negative control LM13 against the two cleaved bands in the sample no. 102 showed the presence of mutation. All the edited plants (288) obtained were further validated through Sanger’s Sequencing. The sequences obtained were aligned with the LM13 sequence (as reference) using ClustalX 2.0. Mutations were identified in only three samples after alignment of the sequences. Two sequences were found to have mutations just near the target site of sgRNA and only one sequence showed one nucleotide of substitution and deletion at the target site of sgRNA. The results of the BLAST for the edited plant no. 258, 287 and 21 are given in Supp . In case of a diploid organism, it is very important to disrupt both the copies of a gene to suppress its expression. Homozygous biallelic mutant for the plant no. 21 has the substitution in both the alleles as depicted in Supp . The monoallelic mutant in the plant no. 258 has one base substitution in a single allele as represented in .
Figure 4. BLAST result of plant no. 258 with parent LM13 (NCBI BLAST).
Figure 5. BLAST result of plant no. 287 with parent LM13 (NCBI BLAST).
Figure 6. BLAST result of plant no. 21 with parent LM13 (NCBI BLAST).
Figure 7. Homozygous biallelic mutant for plant no. 21 (DsDecodedm online web tool).
Figure 8. the monoallelic mutant in the plant no. 258 (DsDecodedm online web tool).
At the protein level, the ExPASy tool had shown the disruption of the 33 amino acids chain in the putative mutant sample no. 287. These results were cross-checked with the ORF finder online web tool. The putative sample was then self-pollinated to obtain T1 seeds from the edited T0 mutant. A single cob containing 48 seeds was obtained from this mutated plant. These T1 edited seeds are being maintained for the generation of T2 progeny and further needs screening to evaluate the haploid induction ability by crossing with different maize inbred lines.
Although the undesirable effects coupled with backcrossing and other conventional methods are reduced using biolistic delivery of RNP complexes into plant cells. Current methods of genetic transformation together with low efficiency of DNA delivery into target regions and less regeneration rate of plants create hindrance for editing plant genomes. Feng et al.Citation30 targeted a marker gene Zmzb7 for genome editing which is responsible for leaf coloration in plants. Wang et al.Citation31 edited the ZmLG1 gene, which is a major determinant of leaf angle in maize. The loss of function of this gene resulted in a reduction of leaf angle due to the absence of auricle and ligules. Our research shows the successful utilization of ZmPLA1 gene for inducing haploid induction in tropical maize line. There are recent studies based on the identification of genes such as ZmDMPCitation9 and ZmPLD3Citation10 that are responsible for haploid induction.
In-vitro cleavage assay can be successfully used to pre-evaluate the efficiency of the designed sgRNA’s in the CRISPR Cas9 genome editing experiments. Immature embryos about 12–14 days after pollination can be successfully used for the gene gun bombardment via ribonucleoprotein complex delivery. Disruption of one of the 33 AA protein frame in first exon shows possibility of haploid induction.
Abbreviations
| T1 | = | First Transgenic generation |
| LM13 | = | Ludhiana maize 13 |
| bp | = | Base pair |
| CRISPR | = | Clustered Regularly Interspaced Short Palindromic Repeats |
| Cas9 | = | CRISPR-associated protein 9 |
Authors Contribution
Conceptualization of research (Priti Sharma, Yogesh Vikal, Gagandeep Singh); Designing of the experiments (Priti Sharma, Yogesh Vikal); Contribution of experimental materials (Yogesh Vikal, Gagandeep Singh); Execution of field/lab experiments and data collection (Sagar K Rangari, Manjot Kaur, Harjot Kaur, Nidhi Uppal); Analysis of data and interpretation (Sagar K Rangari, Manjot Kaur); Preparation and editing of the manuscript (Sagar K Rangari, Harjot Kaur, Priti Sharma).
Supplemental Material
Download MS Word (2.3 MB)Acknowledgments
The funding provided by the Department of Biotechnology, Ministry of Science and Technology, Government of India, in the form of various grants is gratefully acknowledged. G.H-G acknowledges the award of National Talent Scholarship by Indian Council of Agricultural Research (ICAR-NTS).
Disclosure statement
No potential conflict of interest was reported by the author(s).
Supplemental data
Supplemental data for this article can be accessed online at https://doi.org/10.1080/21645698.2023.2197303
Additional information
Funding
References
- Forster BP, Thomas W. Doubled haploids in genetics and plant breeding. Plant Breed Rev. 2005;25:57–88.
- Chang M, Coe E. Molecular genetics approaches to maize improvement. In: L KA A LB, editors. Biotechnology in agriculture and forestry. Berlin, Heidelberg, Germany: Springer; 2009. pp. 127–42.
- Gordillo G, Geiger H. Alternative recurrent selection strategies using doubled haploid lines in hybrid maize breeding. Crop Sci. 2008;48(3):911–22. doi:10.2135/cropsci2007.04.0223.
- Shan Q, Zhang Y, Chen K, Zhang K, Gao C. Creation of fragrant rice by targeted knockout of the OsBADH2 gene using TALEN technology. Plant Biotechno. 2015;l13(6):791–800. doi:10.1111/pbi.12312.
- Svitashev S, Schwartz C, Lenderts B, Young JK, Cigan MA. Genome editing in maize directed by CRISPR–Cas9 ribonucleoprotein complexes. Nat Com. 2016;7(1):1–7. doi:10.1038/ncomms13274.
- Hu H, Schrag TA, Peis R, Unterseer S, Schipprack W, Chen S, Lai J, Yan J, Prasanna M, Nair SK, et al. The genetic basis of haploid induction in maize identified with a novel Genome-Wide association method. Genetics. 2016;202(4):1267–76. doi:10.1534/genetics.115.184234.
- Prigge V, Xu X, Li L, Babu R, Chen S, Atlin GN, Melchinger AE. New insights into the genetics of in vivo Induction of maternal haploids, the backbone of doubled haploid technology in maize. Genetics. 2012;190:781–93. doi:10.1534/genetics.111.133066.
- Kelliher T, Starr D, Richbourg L, Chintamanani S, Delzer B, Nuccio ML, Green J, Chen Z, McCuiston J, Wang W, et al. Matrilineal, a sperm-specific phospholipase, triggers maize haploid induction. Nature. 2017;542(7639):105–09. doi:10.1038/nature20827.
- Zhong Z, Liu C, Xi Q, Jiao Y, Wang D, Wang Y, Liu Z, Chen C, Chen B, Tian X, et al. Mutation of ZmDMP enhances haploid induction in maize. Nature Plant. 2019;5(6):575–80. doi:10.1038/s41477-019-0443-7.
- Li Y, Lin Z, Yue Y, Zhao H, Fei X, Liu C, Chen S, Lai J, Song W, Song W. Loss-of-function alleles of ZmPLD3 cause haploid induction in maize. Nature Plant. 2021;7(12):1579–88. doi:10.1038/s41477-021-01037-2.
- Abhishek A, Chikkappa GK, Ravindra N, Meenakshi B, Ramteke PW, Pradyumn K, Sain D, Sai KR. Differential effect of immature embryo’s age and genotypes on embryogenic type II callus production and whole plant regeneration in tropical maize inbred lines (Zea mays l.). Ind J Gen Plant Breed. 2014;74(3):317–24. doi:10.5958/0975-6906.2014.00849.9.
- Beckert B, Masquida B. Synthesis of RNA by in vitro transcription. Method Mol Bio. 2011;703:29–41.
- Mookkan M, Mookkan. Particle bombardment – mediated gene transfer and GFP transient expression in Setaria viridis. Plant Signalling Behav. 2018;13(4):67–76. doi:10.1080/15592324.2018.1441657.
- Mehravar M, Shirazi A, Mehrazar MM, Nazari M. In vitro pre-validation of gene editing by CRISPR/Cas9 ribonucleoprotein. Avicenna J Med Biotechnol. 2018;11:259–63.
- Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980;8(19):4321–25. doi:10.1093/nar/8.19.4321.
- Coe E. A line of maize with high haploid frequency. Amer Naturalist. 1959;93(873):381–82. doi:10.1086/282098.
- Gilles LM, Khaled A, Laffaire J, Chaignon S, Gendrot G, Laplaige J, Berges H, Beydon G, Bayle V, Barret P, et al. Loss of pollen-specific phospholipase not like dad (NLD) triggers gynogenesis in maize. Embo J. 2017;36(6):1–11. doi:10.15252/embj.201796603.
- Liu H, Ding Y, Zhou Y, Jin W, Xie K, Chen L. CRISPR-P 2.0: an improved CRISPR-Cas9 tool for genome editing in plants. Mol Plant. 2017;10(3):530–32. doi:10.1016/j.molp.2017.01.003.
- Hu Z, Wang L, Shi Z, Jiang J, Li X, Chen Y, Li K, Luo D. Customized one-step preparation of sgRNA transcription templates via overlapping PCR Using short primers and its application in vitro and in vivo gene editing. Cell Bisci. 2019;9(1):1–7. doi:10.1186/s13578-019-0350-7.
- Liang X, Potter J, Kumar S, Zou Y, Quintanilla R, Sridharan M, Carte J, Chen W, Roark N, Ranganathan S, et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. J Biotechnol. 2015;7098:1–10. doi:10.1016/j.jbiotec.2015.04.024.
- Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA–Guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337(6096):816–21. doi:10.1126/science.1225829.
- Huang X, Wei Z. High-frequency plant regeneration through callus initiation from mature embryos of maize (Zea Mays L.). Plant Cell Rep. 2004;22(11):793–800. doi:10.1007/s00299-003-0748-9.
- Vladimir S, Gilbertson L, Adae P, Duncan D. Agrobacterium-mediated transformation of seedling-derived maize callus. Plant Cell Rep. 2006;25(4):320–28. doi:10.1007/s00299-005-0058-5.
- Al-Abed D, Rudrabhatla S, Talla R, Goldman S. Split seed: a new tool for maize researchers. Planta. 2006;223(6):1355–60. doi:10.1007/s00425-006-0237-9.
- Bohorova NE, Luna B, Brito RM, Huerta LD, Hoisington DA. Regeneration potential of tropical, subtropical, mid-altitude and highland maize inbreds. Maydica. 1995;4:275–81.
- Duncan DR, Williams ME, Zehr BE, Widholm JM. The production of callus capable of plant regeneration from immature embryos of numerous Zea mays genotypes. Planta. 1985;165:322–32. doi:10.1007/BF00392228.
- Furini A, Jewell DC. Somatic embryogenesis and plant regeneration from immature and mature embryos of tropical and subtropical Zea Mays L. Genotypes. Maydica. 1994;39L:155–64.
- Guruprasad M, Sridevi V, Kumar BK, Kumar G, Kumar S. An efficient regeneration and genetic transformation of maize through Agrobacterium and particle bombardment in immature embryos. Indian J Agric Res. 2016;50:414–20.
- Malini N, Kumar S, Ramakrishnan SH. Regeneration of Indian maize genotypes (Zea mays L.) from immature embryo culture through callus induction. J Appl Nat Sci. 2015;7(1):131–37. doi:10.31018/jans.v7i1.576.
- Feng C, Yuan J, Wang R, Liu Y, Birchler JA, Han F. Efficient targeted genome modification in maize using the CRISPR/Cas9 system. J Genet Genomics. 2015;43(1):37–43. doi:10.1016/j.jgg.2015.10.002.
- Wang J, Meng X, Hu X, Sun T, Li J, Wang K, Yu H. xCas9 expands the scope of genome editing with reduced efficiency in rice. Plant Biotechnol J. 2019;17(4):709–11. doi:10.1111/pbi.13053.