Arbovirus surveillance in febrile patients attending selected health facilities in Rwanda

Figures & data

Figure 1. Map of Rwanda indicating the selected health centres sampled in the study (red boxes).

Table 1. Description of CCHFV, CHIKV, ONNV, DENV, RVFV, WNV, and ZIKV primers.

Virus	Primer name	Sequence 5’ to 3’	Target gene	Source
CCHFV	CCHFV-F2	CTCAAAGAAACACGTGC CGCTTAC	Nucleocapsid gene	This study
	CCHFV-R155	AGTTTGTGAAGGTGTCC ACAAGTCC	Nucleocapsid gene	This study
CHIKV	CHIKV 2F without tail	GGCAACGTAAAGATCACAGTCA	Partial structural genes E2/E1	[9]
	ONNV/CHIKV 2 R	TTGCAGTTATTWATSACTTTGTC	Partial structural genes E2/E1	[9]
ONNV	ONNV 2F	GGGGCGGGGCGGGGGGGGCGGAAACGTTAAGATCACAGTTG	Envelope protein E2	[9]
	ONNV/CHIKV 2 R	TTGCAGTTATTWATSACTTTGTC	Partial structural genes E2/E1	[9]
DENV	Den238 forward	ATTAGAGAGCAGATCTCTG	Serotypes 1, 2 and 3 polyprotein (POLY) gene	[15]
	Den239 probe	6FAM-TCAATATGCTGAAACGCG-BHQ1	Serotypes 1, 2 and 3 polyprotein (POLY) gene	[15]
	Den240 reverse	TGACACGCGGTTTC	Serotypes 1, 2, & 3 polyprotein (POLY) gene	[15]
RVFV	qPCR RVF forward	TGAAAATTCCTGAGACACATGG	RVFV segment L polymerase gene	[16]
	qPCR RVF reverse	ACTTCCTTGCATCATCTGATG	Segment L polymerase gene	[16]
	qPCR RVF probe	6FAM-CAATGTAAGGGGCCTGTGTGGACTTGTG-BHQ1	Segment L polymerase gene	[16]
WNV	WNVV1-F1	TTGGAATGAGCAACAGAGACTTCTTG	Envelope (E) gene	This study
	WNVV1-R149	GCCTCCATATTCATCATCTTCACATC	Envelope (E) gene	This study
	WNVV2-F572	AGCCACGGTCAGGAATAGACAC	Envelope (E) gene	This study
	WNVV2-R683	GCACTGCTCCATGGCAGGTTC	Envelope (E) gene	This study
ZIKV	qPCR ZIKV forward	AAGTTTGCATGCTCCAAGAAAAT	Envelope (E) gene	[17]
	qPCR ZIKV reverse	CAGCATTATCCGGTACTCCAGAT	Envelope (E) gene	[17]
	ZIKV probe	ACCGGGAAGAGCATCCAGCCAGA	Envelope (E) gene	[17]

Table 2. Demographic characteristics of febrile patients from selected health centres in Rwanda.

Health centre	N	Mean age ± SD	Sex (Male: Female)	Farmer (%)	Office worker (%)	Other (%)	Vocational Worker (%)
Gesetsa	302	38.6 ± 14.8	1: 2.4	96.7	0	3.3	0
Karangazi	184	40.5 ± 16.1	1: 1.1	38.6	23.9	20.1	17.4
Kirinda	197	40.7 ± 17.0	1: 2.1	87.8	2.0	7.1	3.1
Mayange	29	33.8 ± 8.5	1: 1.1	27.6	69.0	0	3.6
Muhoza	58	29.2 ± 9.2	1: 1.6	65.5	15.5	17.2	1.7
Ntoma	266	37.2 ± 15.3	1: 1.8	90.2	3.4	4.5	1.9
Nzangwa	287	37.9 ± 15.5	1: 2.1	97.9	0	0.4	1.7
Rubengera	193	33.9 ± 14.1	1: 1.1	70.5	2.1	25.4	2.1
Rusatira	147	40.1 ± 15.5	1: 1	91.2	6.1	2.7	0
Rwaniro	236	45.9 ± 16.6	1: 3.4	97.9	0	2.1	0
Zaza	385	48.4 ± 17.0	1: 1.2	93.5	1.6	0.3	4.7
Total	2284	40.5 ± 16.3	1: 1.7	86.0	4.6	6.7	3.2

Table 3. Blast results for ONNV sequences obtained from the NCBI database.

Sequence ID	GenBank ID	Matching species ID	Percent Identity	E- Value	Query Coverage
Haplotype 1
EGK294	AF079456	O’nyong-nyong virus strain SG650	100%	0.00	72.86
EGK292	AF079456	O’nyong-nyong virus strain SG650	100%	0.00	72.86
Haplotype 2
EGK269	AF079456	O’nyong-nyong virus strain SG650	100%	0.00	72.82
EGK275	AF079456	O’nyong-nyong virus strain SG650	100%	0.00	72.82
EGK296	AF079456	O’nyong-nyong virus strain SG650	100%	0.00	72.82
Haplotype 3
EGK271	AF079456	O’nyong-nyong virus strain SG650	100%	0.00	72.86
EGK273	AF079456	O’nyong-nyong virus strain SG650	100%	0.00	72.86
EGK410	AF079456	O’nyong-nyong virus strain SG650	100%	0.00	72.86

Table 4. Demographic factors and clinical symptoms in relation to o’nyong-nyong and Zika virus infection status (N = 230 pools).

Covariate	Total population	Positive pools	Negative pools
O’nyong-nyong virus
Mean age (years) ± SD	40.5 ± 16.3	48.5 ± 18.2	40.1 ± 16.1
Sex: proportion of patients that are females	0.620	0.775	0.612
Mean temperature (^oC) ± SD	38.1 ± 0.5	38.5 ± 0.7	38.0 ± 0.5
Mean fever duration (days) ± SD	2.5 ± 2.1	2.7 ± 1.9	2.4 ± 2.1
Mean illness duration (days) ± SD	3.6 ± 3.8	3.6 ± 2.3	3.6 ± 3.9
Joint pain: proportion of patients reporting symptom	0.218	0.742	0.189
Peripheral Neuropathy: proportion of patients reporting symptoms	0.045	0.500	0.020
Zika virus
Mean age (years) ± 95% Confidence Interval	40.5 ± 16.3	44.2 ± 16.0	40.5 ± 16.3
Sex: proportion of patients that are females	0.623	0.364	0.630
Mean temperature (^oC) ± SD	38.1 ± 0.5	37.9 ± 0.4	38.1 ± 0.5
Mean fever duration (days) ± SD	2.5 ± 2.1	2.0 ± 0.6	2.5 ± 2.1
Mean illness duration (days) ± SD	3.6 ± 3.8	2.9 ± 1.6	3.6 ± 3.9
Joint pain: proportion of patients reporting symptom	0.218	0.083	0.219
Peripheral Neuropathy: proportion of patients reporting symptoms	0.045	0.0	0.046

Figure 2. Temporal variations in ONNV (upper panel) and ZIKV (bottom panel) infections in Rwanda as a proportion of the population sampled.

Lwande OW, Luande VN, Pereira de Freitas A, et al. Traumatic myiasis in free-ranging eland, reported from Kenya. Parasites Vectors. 2013;6: doi: 10.1186/1756-3305-6-89

 PubMed Web of Science ®Google Scholar

Conceição TM, Da Poian AT, Sorgine MHF. Sorgine MHJJovm. A real-time PCR procedure for detection of dengue virus serotypes 1, 2, and 3, and their quantitation in clinical and laboratory samples. J Virol Methods. 2010;163(1):1–9. doi: 10.1016/j.jviromet.2009.10.001

 PubMed Web of Science ®Google Scholar

Bird BH, Bawiec DA, Ksiazek TG, et al. Highly sensitive and broadly reactive quantitative reverse transcription-PCR assay for high-throughput detection of Rift Valley fever virus. J Clin Microbiol. 2007;45(11):3506–13. doi: 10.1128/JCM.00936-07

 PubMed Web of Science ®Google Scholar

Persson BD, Nord S, Lindqvist R, et al. BAF45b is required for efficient Zika virus infection of HAP1 cells. Viruses. 2021;13(10):2007. :

 PubMed Web of Science ®Google Scholar

Data availability statement

ONNV sequences from this study are provided in the supplementary materials to this paper.