Individual and combined effects of moringa leaf, ginger and garlic powder on growth and innate immune response of Clarias gariepinus juveniles

Figures & data

Table 1. Formulation of experimental diets.

Ingredients	Control diet (CT)	Moringa based diet (A)	Ginger based diet (B)	Garlic based diet (C)	Combined additives (D)
Fishmeal (70)	20	20	20	20	20
Additive (A)	0	2	0	0	0
Additive (B)	0	0	2	0	0
Additive (C)	0	0	0	2	0
Additive (A, B, C)	0	0	0	0	2
SBM (defatted) (43)	40	39	39	39	39
Cassava (10)	36.3	35.3	35.3	35.3	35.3
Vit/min	0.5	0.5	0.5	0.5	0.5
Veg oil	2.5	2.5	2.5	2.5	2.5
Vit C	0.5	0.5	0.5	0.5	0.5
Anti-mould	0.2	0.2	0.2	0.2	0.2

Table 2. Percentage proximate composition of moringa leaf, ginger and garlic powder.

Parameter	Moringa leaf	Ginger	Garlic
Moisture %	7.8	10.6	9
Crude protein %	25.0	10.26	18.58
Crude fat %	4.64	4.64	0.54
Fiber %	2.97	2.97	0.88
Ash %	9.5	9.5	4.33
CHO %	50.12	50.12	66.67

Table 3. Primers used for nucleic acid quantification and qPCR in this study.

Primer	Forward sequence	Reverse sequence	Tm (°C)	Band size (pb)
GAPDH	GCCCTCTGGTAAAATGTGGA	ATTCCCTTCATGGGTCCTTC	54	450
β-actin	TGGCCGTGACCTGACTGAC	CCTGCTCAAAGTCAAGAGCGAC	60	180
TNF-α	GGATGGTGGTGTGTGTTGTG	CTGGTACTCTGGTCACGACTC	60	150

Table 4. Growth performance and nutrient utilization of experimental fish.

Parameters	CT	A	B	C	D
IBW (g)	128.7	133.7	132	130	138
TWF (g)	992.41	635.67	1019.88	1010.71	552.93
FBW (g)	481.6	222	477.4	511.2	171
WG (g)	352.96 ± 28.3^b	88.61 ± 21.3^a	345.4 ± 134^b	381.6 ± 71^b	32.8 ± 26.8^a
FCR	2.8 ± 0.14^a	7.2 ± 1.54^b	3 ± 0.84^a	2.7 ± 0.39^a	8.2 ± 0.63^b
SGR (%)	0.819 ± 1.33^b	0.315 ± 0.62^a	0.798 ± 0.25^b	0.849 ± 1.72^b	0.133 ± 0.41^c
RGR (%)	2.742 ± 1.52^b	0.66 ± 0.37^a	2.617 ± 1.95^b	2.932 ± 0.23^c	0.239 ± 1.03^a

Notes: Treatment A: fish-fed moringa leaf-based diet; treatment B: fish-fed ginger-based diet; treatment C: fish-fed garlic-based diet; treatment D: fish-fed combination of moringa, ginger, and garlic-based diet; treatment CT: fish fed control-based diet. Values are mean ± standard deviation of three replicates. Mean within the same row with different superscripts are significantly different from each other at p < .05, n = 20. FCR: feed conversion ratio; SGR: specific growth rate; RGR: relative growth rate: TWF: total weight of fish per tank.

Figure 1. Gel image capture cDNA quantification of samples done in triplicate, GAPDH with expected amplicons band size of 450 bp.

Table 5. Nucleic acid quantification showing the Δ260/280 values and concentrations in ng/µl of RNA isolated from Clarias gariepinus.

Sample	Concentration (µl)	Purity (Δ260/280)
CT	18.45	2.12
A	16.325	1.90
B	20.35	2.00
C	15.525	1.91
D	19.35	1.90

Note: Treatment A: fish fed with moringa leaf-based diet; treatment B: fish fed with ginger-based diet; treatment C: fish fed with garlic-based diet; treatment D: fish fed with a combination of moringa, ginger, and garlic-based diet; treatment CT: fish fed with control diet without supplements. Values are means of three replicates.

Table 6. The gene expression level of different experimental fish fed with different fed supplements.

Sample	Fold change
CT	1.436 ± 0.791
A	0.124 ± 0.034
B	0.196 ± 0.145
C	0.288 ± 0.088
D	0.097 ± 0.30

Notes: Treatment A: fish-fed moringa leaf-based diet; treatment B: fish-fed ginger-based diet; treatment C: fish-fed garlic-based diet; treatment D: fish-fed combination of moringa, ginger, and garlic-based diet; treatment CT: fish-fed control-based diet. Values are mean ± standard deviation of three replicates for each fish-fed supplement.