Silencing Glypican-1 enhances the antitumor effects of Pictilisib via downregulating PI3K/Akt/ERK signaling in chemo-resistant esophageal adenocarcinoma

Figures & data

Table 1. Sequence of GPC-1 shRNA and GPC-1 overexpression plasmid.

Clone	Gene	Location	Length	Sequence
shGPC-1α	GPC-1 (NM_002081.2)	2,965	21	CCAAACATGCATCCATTTACT
shGPC-1β	GPC-1 (NM_002081.2)	956	21	GTGCTCGAGAGCTGTCATGAA
shGPC-1Δ	GPC-1 (NM_002081.2)	1,029	21	GACTATTGCCGAAATGTGCTC
SCR			19	GCTTCGCGCCGTAGTCTTA
EV	GPC-1 (NM_002081.2)	1,677	24	GATAGCACTGAGCACCTGTTCCAG

Table 2. Primer sequences.

Gene	Sequence
GPC-1	Forward sequence: 5’-TGAAGCTGGTCTACTGTGCTC-3’
	Reverse sequence: 5’-CCCAGAACTTGTCGGTGATGA-3’
Beta actin	Forward sequence: 5’-TTGGCCAGGGGTGCTAAG-3’
	Reverse sequence: 5’-AGCCAAAAGGGTCATCATCTC-3’

Table 3. List of antibodies.

Antibody	Manufacturer	Catalogue	Concentration
Glypican 1	Abcam	ab199343	1:750
ZEB-1	Proteintec	21544–1-AP	1:1000
N-Cadherin	Cell Signaling	13116S	1:1000
E-Cadherin	Cell Signaling	3195	1:1000
c-myc	Cell Signaling	18583	1:1000
KLF-4	Cell Signaling	12173	1:1000
Nanog	Cell Signaling	8822	1:1000
OCT-4	Cell Signaling	2750	1:1000
p-PI3Kp85	Cell Signaling	17366	1:1000
PI3K	Cell Signaling	4292	1:1000
pAkt(Ser 473)	Cell Signaling	4060	1:1000
p-PRAS40(Thr 476)	Proteintec	29072–1-AP	1:1000
PRAS40	Proteintec	21097–1-AP	1:1000
p-P70S6K (Thr 379)	Proteintec	28735–1-AP	1:1000
P70S6K	Proteintec	66638–1-Ig	1:1000
p-ERK1/2	Cell Signaling	Cell Signaling	1:1000
ERK1/2	Cell Signaling	Cell Signaling	1:1000
AKT	Cell Signaling	4691	1:1000
F-Actin	Abcam	ab130935	1:1000
SNAIL 1	Proteintec	13099–1-AP	1:1000
Vimentin	Proteintec	10366-AP	1:1000
Beta Actin	Proteintec	66009–1-Ig	1:10,000
Secondary HRP Rabbit	Proteintec	SA-00001-2	1:5000
Secondary HRP Mouse	Proteintec	SA-00001-1	1:3000

Figure 1. Expression of GPC-1 and PI3K/Akt is upregulated in esophageal adenocarcinoma.(a-c) GPC-1, Akt, and PI3K expression in tumor (n = 230) and paratumor tissue (n = 135) samples in TCGA project through the utilization of Student’s t-test. The tumor tissues are marked with red color and paratumor tissues are denoted by gray color. (d-e) Pearson’s correlation of GPC-1 expression with Akt and PI3K in TCGA project.

Figure 2. Expression of GPC-1 is upregulated in poorly differentiated esophageal adenocarcinoma. (a) Esophageal adenocarcinoma (EAC) tissues were observed to manifest an upregulation of GPC-1 expression compared to normal para tumor tissue in 25 paired tissues with poorly differentiated chemoresistant EAC at the University of Colorado. (b) Representative IHC photographs of normal paratumor gastroesophageal junction stained for GPC-1 (a-c) and tumor tissue stained for GPC-1(d-f) showing GPC-1 staining of normal paratumor gastroesophageal junction (black arrows). GPC-1 immunoreactivity is seen in basal and suprabasal layers of normal stratified epithelium. The normal paratumor stroma (red star), crypt epithelium, or columnar epithelium does not stain with GPC-1. Moderate to intense staining is noted in the stroma and columnar epithelium (red star). (c-d) Real-time q-PCR and western blot analysis of GPC-1 mRNA and protein in 10 paired tumor and paratumor tissue. The bar chart represents mean ±SD, n = 3. **, P < 0.01.

Table 4. Univariate and multivariate analysis of prognostic variables in chemo-resistant PDEAC.

Variable	Univariate Analysis			Multivariate Analysis
	P value	HR	95% CI	P value	HR	95% CI
GPC-1 expression (Low/High)	0.001**	1.22	1.116–2.121	0.001**	1.02	1.001–2.130
TNM stage(I+II/III+IV)	<0.001	2.233	1.744–2.912	0.002	1.31	1.012–2.301
T stage(T1+T2/T3+T4)	<0.001**	2.129	1.243–3.554	0.04*	1.68	1.002–2.650
N stage(N0/N1+N2+N3)	<0.001**	2.432	1.732–3.102	0.001**	1.878	1.221–2.602
Age (<60/>60)	0.34	1.045	0.786–1.478
Sex (Male/Female)	0.26	1.066	0.810–1.430

Figure 3. Expression and localization of GPC-1 in PDEAC cell lines. (a) Western blot analysis of GPC-1 expression in seven PDEAC cell lines compared to normal esophageal cell line HET-1A and Barrett’s cell lines (CP-A and CP-B). Bar chart of densitometry analysis of GPC-1 protein expression in PDEAC cell lines. (b) Representative immunofluorescence staining of normal HET-1A cells and PDEAC cells (ESO-26, OE-33). Cells were stained with DAPI (blue), GPC-1(FITC), and Tubulin (Texas red). The scale bar represents 50 µm. (c) Representative images of insitu Proximity ligation assays (PLA) of two EAC cell lines with anti GPC-1 and anti β-tubulin antibodies. Scale bar 100 µm. DAPI, 4’,6-diamidino-2-phenylindole; FITC, fluorescein isothiocyanate; ns; not significant, **** p < .0001.

Figure 4a. Glypican 1 mediates growth and proliferation in esophageal cancer (a) the results of the Gene Set Enrichment Analysis (GSEA) identify pathways that exhibit a significantly impactful relationship of GPC-1 in EAC. (b) Stably expressing SCR and shGPC-1β expressing cell lines ESO-26 and OE-33 cells were evaluated for cell viability by CCK-8 assay at various time points. (c-d) Light microscopy images (magnification 20×) of scratch assay taken at 0 and 72 h after transfection. (e)light microscopy images (magnification 20×) of Transwell assay in either uncoated (for migration) or Matrigel-coated (for invasion) polycarbonate 8 µm chambers. Migrated cells at the bottom of inserts were stained with 0.1% crystal violet. (f) ESO-26 and OE-33 cells were transfected with scramble shRNA and shGPC-1β and grown for 14 days, stained with crystal violet, and the number of colonies was counted. (g) Western blot analysis (left) and densitometric analysis(right) of key proteins in EMT and stemness. Bar charts represent mean ±SD, n = 3. ns; not significant, *p < .05,**p < .01, ***p = .002, ****p < .001.

Figure 4b. Continue

Figure 5. PDEAC cells have constitutively activated PI3K/Akt signaling driven by GPC-1 (a) Western blot analysis of key proteins of PI3K/Akt pathway was probed in normal HET-1A and PDEAC cell lines (ESO-26 and OE-33 cells). (b) Western blot analysis of PI3K/Akt pathway proteins after overexpression of GPC-1 in SK-GT4 cells. Bar chart of densitometry analysis of the ratio of phosphorylated to non-phosphorylated protein normalized to β-actin. Data represent mean ±SD, n = 3. EV, empty vector.

Figure 6. Upregulated GPC-1 expression promotes resistance to Pictilisib treatment. Cell viability was assessed using CCK-8 assay with treatment with Pictilisib (0.1 to 10 μM) for 48 h in (a) ESO-26 (b)OE-33 and (c) SK-GT4 cells. (d-e) Western blot analysis showing expression of p-Akt (Ser473) with varying concentrations of Pictilisib. Beta-actin was used as a loading control. (f- g) GPC-1^High stably expressing SCR and shGPC-1β expressing cell lines were treated with a range of concentrations (0.1 to 10 μM) of Pictilisib. CCK-8 assay was used to measure cell viability and IC₅₀ 48 h after treatment. The IC₅₀value of ESO-26shSCR and ESO-26shGPC-1β 3.54 µM and 0.32 µM respectively. The IC₅₀value of OE-336shSCR and OE-33shGPC-1β 1.34 µM and 0.309 µM respectively. (h) Clonogenic survival assays in GPC-1^High stably expressing SCR and shGPC-1β expressing cell lines (ESO-26 and OE-33) treated with the indicated doses (µM) of Pictilisib for 48 hours. Media was changed and cells were then cultured for 14 days without inhibitor, fixed with 4% paraformaldehyde and stained with 0.1%crystal violet. Colonies were counted and expressed as a percentage of the SCR control. **p < .01; ***p < .001.

Figure 7. GPC-1knockdown sensitized GPC-1^high expressing PDEAC cells to antitumor effects of low dose Pictilisib via downregulating Akt signaling. (a) GPC-1^High stably expressing SCR and shGPC-1β expressing cell lines were treated with low dose Pictilisib (IC₂₅) for 48 h and CCK-8 assay was used to measure cell viability. (b) Clonogenic survival assays in GPC-1^High stably expressing SCR and shGPC-1β expressing cell lines (ESO-26 and OE-33) treated with Pictilisib (IC25, µM) for 48 hours. Media was changed, cells were cultured for 14 days without inhibitor, fixed with 4% paraformaldehyde and stained with 0.1%crystal violet. Colonies were counted and expressed as a percentage of the SCR control. (c-d) Western blot showing expression of p-AKT(Ser473) levels at shown time points after treatment of GPC-1^High shGPC-1β expressing cell lines (ESO-26 and OE-33 cells) with low dose Pictilisib (IC₂₅). Combinatorial treatment with low dose Pictilisib synergistically reduced p-AKT level in both cell lines at 48 h. ns, not significant; ***p < .001.

Figure 8. Silencing GPC-1 alone or in combination with Pictilisib effectively downregulates PI3K/Akt/ERK pathway. (a-b) GPC-1^High stably expressing SCR and shGPC-1β expressing cell lines were treated with low dose Pictilisib (IC₂₅) for 48 h and cell lysates were subjected to western blot analysis with antibodies for GPC-1, p-AKT(Ser473), total Akt, p-PRAS(Thr246), total PRAS, p-P70S6K, total P70S6K, p-ERK1/2 and total ERK1/2. Beta-actin was used as a loading control.

Figure 9a. Knockdown of GPC-1 enhanced Pictilisib induced apoptosis and cell cycle arrest in G0/G1 phase in PDEAC cells. (a) GPC-1^High stably expressing SCR and shGPC-1β expressing cell lines were treated with low dose Pictilisib (IC₂₅) for 48 h and evaluated for apoptosis using Annexin V/FITC using flow cytometry. the downregulation of GPC-1 synergized with low-dose Pictilisib to induce apoptosis in ESO-26 and OE-33 cells. (b\) GPC-1^High stably expressing SCR and shGPC-1β expressing cell lines were treated with low dose Pictilisib (IC₂₅) for 48 h and evaluated for the cell cycle stage using Propidium iodide staining followed by flow cytometry Data represents n = 3, mean ± SD; ordinary one ANOVA with multiple comparisons, *, P < 0.05, SCR, negative scrambled control; shGPC-1β, GPC-1 knockdown plasmid; FITC, fluorescein isothiocyanate.

Figure 9b. Continue

Figure 10a. Combination of GPC-1 knockdown and Pictilisib results in greater tumor growth inhibition in-vivo. (a) Knockdown of GPC-1 notably inhibited the growth of ESO-26 which was more significant after combination with Pictilisib. (b-c) Tumor volumes and weight of xenografts were significantly reduced with combination treatment. (d) Immunohistochemistry staining for Ki67. Scale bar: 10 µm. (e) Fluorescent images of xenograft tissue sections stained for TUNEL staining using a TUNEL/CF-594 staining kit. Blue denotes DAPI, red denotes CF-594 and pink denotes merged condensed chromatin within the nucleus. Scale bar: 50 µm. (f) Western blot analysis of EMT proteins at the treatment endpoint of 15 days. Data represents the mean ± SD of 4 animals. **p < .01; ***p < .001.

Figure 10b. Continue

Data availability statement

The data that support the findings of this study are available from the corresponding author, [AP], upon reasonable request to [email protected].