Polymorphism of Transporter Genes Contributes to Variations in Treatment Outcomes and Adverse Events in Platinum Based- Chemotherapy- Treated Oral Cancer Patients

Figures & data

Table 1. Primer sequences metabolizing gene and their respective restriction enzymes.

Sl. No	Genes/Accession No.	Primer Sequences	Restriction enzymes/	Gel Pattern
1	ABCG2 (rs4693924)	Forward-5’GCAGCCAGGCCAATACATAA3’ Reverse −5’TGATGGTAGTGTGGTGCATGT3’	BtSIMUI	wt/wt160;wt/mt-160 + 121;mt/mt-160 + 121 + 39
2	ABCC2 (rs2804398)	Forward −5’GGCAGTCCTGAGAGTGAAGG3’ Reverse −5’GCCCCAGTGACCTCATCTT3’	RSaI	wt/wt; 221 wt/mt 221 + 169,mt/mt-221 + 169 + 52
3	ABCC4 (rs943288)	Forward −5’CACTGAGCGGAGGCTTTAGT 3’ Reverse − 5’GCAGGCTGGTCTCAAGATTC3’	BSTN1	wt/wt236;wt/mt-236 + 187;mt/mt-236 + 187 + 69
4	ABCC1 (rs9332430)	Forward −5’GTGGGTGGGGAAACCTATTT3’ Reverse −5’CATGCCCAGCTGAAGAATTT3’	HPY188I	wt/wt161;wt/mt-161 + 105;mt/mt-161 + 105 + 56

Wt-Wild Type; Mt-Mutant.

Table 2. Clinical and pathological characteristics.

Characteristics (N = 120)	Category/Class	Frequency (%)
Age	18–40 Years	38(31.4)
	41–60 Years	59(48.8)
	>60 Years	23(19.8)
Sex	Male	109(90.9)
	Female	11(9.1)
Body weight(median)	48 (32.0–80.0)
ECOG PS	0–1	93(77.7)
	2	27(22.3)
Clinical Stage	III	18(17)
	IV	102(83)
Treatment Regimen	TPF- Taxane Platinum 5-Flurouracil	38(31.4)
	PC- Paclitaxel, Carboplatin	82(68.6)
Clinical Outcome	CR- Complete Response	15(12.4)
	PR -Partial Response	19(15.7)
	SD -Stable disease	86(71.9)

ECOGPS - Eastern Cooperative Oncology Group Performance Status.

Figure 1. (a) 12% Native gel RFLP of ABCG2(rs 4693924) M-50bp Marker, 1, 4,5-mt/mt genotypes type;2,3-wt/mt genotypes; (b) ABCC2(rs2804398) M-50bp Marker 2-wt/wt genotype, 1, 3-8-mt/mt genotypes; (c) ABCC4 (rs 943288) M-50bp Marker, 1,2,3,5,6-mt/mt genotypes; 4-wt/mt; genotype;7-wt/wt genotype (d) ABCC1 (rs 9332430) M-50bp Marker, 1,2,4,5,8-mt/mt genotypes; 6-wt/mt genotype, 7-wt/wt genotype

Table 3. Transporter genes and allele frequency of SNPs.

SNP Gene (N = 120)	Transporters	Frequency (%)	Allele Frequency (%)
			Wild Type	Mutated Type
ABCG2 (rs4693924)	wt/wt	25.6	0.43	0.56
	wt/mt	36.4
	mt/mt	38
ABCC2 (rs2804398)	wt/wt	37.2	0.55	0.44
	wt/mt	37.1
	mt/mt	25.6
ABCC4 (rs943288)	wt/wt	8.3	0.492	0.508
	wt/mt	81.8
	mt/mt	9.9
ABCC1 (rs9332430)	wt/wt	9.1	0.4545	0.5455
	wt/mt	72.7
	mt/mt	18.2

wt/wt-wild/wild; wt/mt-wild/mutant; mt/mt-mutant/mutant.

Table 4. Association between genetic polymorphisms and toxicity.

Polymorphism	Metabolizers	Adverse effect	Grade		OR (≥Grade II)	95%-CI	p-value
			I (0-I)	II (II-V)
ABCG2 (rs4693924)	wt/wt	Anemia (n = 14)	4	1	-1.237 1.270	-(1.134–1.349) (1.164–1.385_	-.001 .001
	wt/mt		4	1
	mt/mt		4	1
	wt/wt	Diarrhea (n = 47)	8	2	-0.828 0.861	-0.586–1.171 0.610–1.215	-.287 .395
	wt/mt		14	4
	mt/mt		13	6
	wt/wt	Fever (n = 38)	6	4	-0.900 0.687	-0.900–1.599 0.687–1.178	-.215 .442
	wt/mt		6	6
	mt/mt		11	5
	wt/wt	Dysphasia (n = 36)	1	5	-0.657 1.250	-0.218–1.980 0.410–3,816	-.456 .695
	wt/mt		5	10
	mt/mt		8	7
	wt/wt	Nausea (n = 44)	5	2	-0.718 0.574	-0.493–1.045 0.398–0.827	-.083 .003
	wt/mt		10	6
	mt/mt		14	7
	wt/wt	Vomiting (n = 41)	8	4	-1.130 1.953	-0.611–2.088 0.976–3.908	-.697 .059
	wt/mt		7	11
	mt/mt		3	8
	wt/wt	Neutropenia (n = 5)	0	1	--3.00	--0.312–28.841	--.341
	wt/mt		0	0
	mt/mt		1	3
	wt/wt	Febrile Neutropenia (n = 5)	1	0	–	–	–
	wt/mt		0	0
	mt/mt		3	1
	wt/wt	Mucositis (n = 8)	0	2	-1.500 0.500	-0.251–8.977 0.045–5.514	-.657 .571
	wt/mt		0	3
	mt/mt		2	1
ABCC2 (rs2804398)	wt/wt	Anemia (n = 14)	4	2	-0.944 1.086	-0.526–1.695 0.546–2.160	-.847 .814
	wt/mt		5	1
	mt/mt		3	0
	wt/wt	Diarrhea (n = 47)	17	6	-1.790 1.234	-1.309–2.449 0.897–1.699	-.001 .196
	wt/mt		8	4
	mt/mt		10	2
	wt/wt	Fever (n = 38)	8	10	-1.617 0.817	-0.624–4.190 0.357–2.127	-.322 .762
	wt/mt		6	2
	mt/mt		9	3
	wt/wt	Dysphasia (n = 36)	2	11	-2.678 0.767	-0.483–14.862 0.227–2.588	-.260 .669
	wt/mt		0	8
	mt/mt		10	5
	wt/wt	Nausea (n = 44)	9	4	-0.903 0.624	-0.646–1.261 0.440–0.885	-.549 .008
	wt/mt		9	7
	mt/mt		11	4
	wt/wt	Vomiting (n = 41)	7	11	-1.154 1.961	-0.628–2.120 0.963–3.812	-.645 .064
	wt/mt		3	8
	mt/mt		8	4
	wt/wt	Neutropenia (n = 5)	0	2	-0.500 0.500	-0.045–5.514 0.045–5.514	-.571 .571
	wt/mt		0	1
	mt/mt		1	1
	wt/wt	Febrile Neutropenia (n = 5)	2	0	–	–	–
	wt/mt		0	1
	mt/mt		2	0
	wt/wt	Mucositis (n = 8)	1	0	-5.644E8 1.000	-(0.000-*) (0.000-*)	-.998 1.00
	wt/mt		0	6
	mt/mt		1	0
ABCC4 (rs943288)	wt/wt	Anemia (n = 14)	0	0	-2.620E–6 5.154E–6	-2.989E-7-2.290E-5 5.154E-6-5.154E-6	-.000-
	wt/mt		12	2
	mt/mt		0	1
	wt/wt	Diarrhea (n = 47)	4	0	-1.146 1.478	-0.490–2.678 0.461–4.734	-.753 .511
	wt/mt		28	12
	mt/mt		3	0
	wt/wt	Fever (n = 38)	1	2	-0.771 1.890	-0.317–1.874 0.443–8.057	-.566 0.390
	wt/mt		21	13
	mt/mt		1	0
	wt/wt	Dysphasia (n = 36)	2	4	-2.272 9.11	-1.306–3.954 1.675–49.571	.004 .011
	wt/mt		5	24
	mt/mt		0	1
	wt/wt	Nausea (n = 44)	4	0	-1.266 2.039	-0.582–2.753 0.636–6.539	-.552 .231
	wt/mt		24	13
	mt/mt		1	2
	wt/wt	Vomiting (n = 41)	1	3	-0.956 2.519	-0.325–2.810 0.389–16.337	-.956 .333
	wt/mt		16	20
	mt/mt		1	0
	wt/wt	Neutropenia (n = 5)	0	0	-2.186E8-	-0.00-*-	-.998-
	wt/mt		1	4
	mt/mt		0	0
	wt/wt	Febrile Neutropenia (n = 5)	0	0	–	–	–
	wt/mt		4	1
	mt/mt		0	0
	wt/wt	Mucositis (n = 8)	0	0	-5.000 0.200	-0.584–42.797 0.023–1.712	-.142 .142
	wt/mt		2	5
	mt/mt		0	1
ABCC1 (rs9332430)	wt/wt	Anemia (n = 14)	1	0	-1.130 0.496	-0.374–3.412 0.160–1.534	-.828 .160
	wt/mt		5	3
	mt/mt		6	0
	wt/wt	Diarrhea (n = 47)	4	0	-1.088 1.000	-0.243–4.874 0.178–5.620	-.912 1.000
	wt/mt		26	6
	mt/mt		5	6
	wt/wt	Fever (n = 38)	3	1	-1.222 1.317	-0.695–2.1148 0.672–2.581	-.487 .422
	wt/mt		17	10
	mt/mt		3	4
	wt/wt	Dysphasia (n = 36)	0	2	-0.638 0.886	-0.098–4.156 0.115–6.826	-.638 .908
	wt/mt		7	20
	mt/mt		0	7
	wt/wt	Nausea (n = 44)	1	1	-0.574 0.372	-0.340–0.969 0.212–0.652	-.38 .001
	wt/mt		19	12
	mt/mt		9	2
	wt/wt	Vomiting (n = 41)	2	0	-0.791 0.650	-0.105–5.96 0.070–6.075	-0.820 0.706
	wt/mt		14	14
	mt/mt		2	9
	wt/wt	Neutropenia (n = 5)	0	1	-2.00 1.00	-0.181–22.056 0.063–15.988	-.571 1.00
	wt/mt		0	2
	mt/mt		1	1
	wt/wt	Febrile Neutropenia (n = 5)	0	0	---	---	---
	wt/mt		4	1
	mt/mt		0	0
	wt/wt	Mucositis (n = 8)	0	0	-2.000 0.500	-0.366–10.919 0.092–2.730	-.423 .423
	wt/mt		2	4
	mt/mt		0	2

wt-wild type, mt- mutated type Multinomial logistic regression model was used for estimating odd ratio and 95%-confidence interval.

Figure 2. (a) The Kaplan—Meier curve showing the association between the ABCG2 rs4693924genotypes and progression -free survival of patients treated with induction chemotherapy. (b) The Kaplan—Meier curve showing the association between the ABCC2 rs2804398 genotypes and progression -free survival of patients treated with induction chemotherapy. (c) The Kaplan—Meier curve showing the association between the ABCC4 rs943288 genotypes and progression -free survival of patients treated with induction chemotherapy. (d) The Kaplan—Meier curve showing the association between the ABCC1 rs9332430 genotypes and progression -free survival of patients treated with induction chemotherapy

Table 5. Univariate and multivariate analysis of progression-free survival of chemotherapy treated oral cancer patients.

Characteristics	Clinical factors	No of Patients	Kaplan-Meier Survival (Univariate)			Cox Regression survival (Multivariate)
			Median PFS	95% Confidence Interval	P-value	HR	95% Confidence Interval	P-value
Sex	Male	109	5	3.921–6.079	.970	1.011	0.528–1.936	.975
	Female	11	2	-
Age (Years)	18–40	37	3	1.014–4.986	.565	0.939	0.718–1.228	.647
	41–60	59	5	3.357–6.643
	61–80	24	5	2.068–7.392
ECOG	0–1	94	5	4.055–5.945	.009	0.591	0.377–0.928	.022
	2	26	2	0.572–3.428
Stage	III	17	5	2.614–7.386	.691	0.912	0.538–1.546	.729
	IV	103	5	3.778–6.222
Clinical Responses	CR	15	8	5.769–10.231	.000	1.713	1.284–2.286	.000
	PR	19	8	5.867–10.133
	SD	86	3	2.196–3.804
ABCG2 (rs4693924)	wt/wt	31	5	3.025–6.975	.086	1.186	0.945–1.487	.139
	wt/mt	44	4	2.050–5.950
	mt/mt	45	5	3.406–6.594
ABCC2 (rs2804398)	wt/wt	45	3	1.548–4.452	.103	0.843	0.663–1.071	.161
	wt/mt	44	6	4.593–7.407
	mt/mt	31	5	2.638–7.362
ABCC4 (rs943288)	wt/wt	10	1	-	.176	0.777	0.511–1.182	.238
	wt/mt	98	5	3.860–6.140
	mt/mt	12	5	0.000–13.487
ABCC1 (rs9332430)	wt/wt	11	9	4.468–13.532	.416	1.118	0.818–1.529	.485
	wt/mt	87	3	1.698–4.302
	mt/mt	22	5	8.139–7.861

p-Value represents overall comparisons using Uni and Multivariate analysis PFS- Progression free survival.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.