Multiple roles of LncRNA-BMNCR on cell proliferation and apoptosis by targeting miR-145/CBFB axis in BMECs

Abstract

Bovine mastitis is one of the most serious and costly disease affecting dairy cattle production. The present study explored the inflammatory response and autoprotective mechanism of a novel specific high expression BMNCR (bovine mastitis related long non-coding RNA) in S. aureus induced mastitis by miR-145/CBFB axis in dairy cows from the perspective of molecular genetics. In bovine mammary epithelial cells, we preformed loss of function experiments to detect changes in cytokine, proliferation and apoptosis by qRT-PCR, western blot, flow cytometry and EdU staining. The results demonstrated that BMNCR significantly increased cell apoptosis, and inhibited cell proliferation. However, the secretion of IL-1α, IL-2, IL-6, IL-8 and IL-12 were enhanced after knock-down BMNCR. Bioinformatics analysis demonstrated that BMNCR could target 8 miRNAs, in-depth analyses indicated that BMNCR acts as a molecular sponge for bta-miR-145 and CBFB was one of 23 target gene of bta-miR-145 . The results of the present study demonstrated that the role of BMNCR in S. aureus induced mastitis can be mediated by sponge bta-miR-145 activating CBFB expression. BMNCR could be a potential target for mastitis diagnosis and therapy, which may enrich the theoretical research of therapeutic intervention, and further increase milk yield and improve milk quality.

Keywords:

• Bovine mastitis
• lncRNA BMNCR
• bta-miR-145
• CBFB
• inflammatory response
• cell proliferation
• cell apoptosis
• BMECs

Introduction

Bovine mastitis is one of the most serious and costly disease affecting dairy cow production, which not only reduce the milk yield and milk quality, but also affect the normal physiological functions (Rana et al. 2022). Inflammatory development occurs mainly in bovine mammary epithelial cells (BMECs), Staphylococcus aureus (S. aureus) is one of the main pathogens causing mastitis in the pasture (Rainard et al. 2018), moreover, long-term antibiotic treatment could exacerbate the resistance of pathogenic bacteria and increase the hidden dangers caused by drug residues (Ngaywa et al. 2019; Khazaie and Ahmadi 2021). With the development of the next-generation sequencing technology, long noncoding RNAs (lncRNAs) are gradually recognized as an important epigenetic regulation method, and has been gradually used in the field of prevention and treatment of dairy cow mastitis.

Variety lncRNAs involved in epigenetic regulation, genomic imprinting, RNA alternative splicing and miRNA regulation (Flippot et al. 2016)。Previous studies have demonstrated that lncRNAs play significant roles on inflammatory response (Castellanos-Rubio et al. 2017; Du et al. 2017; Mathy and Chen 2017; Chew et al. 2018). LncRNA-IL7R was obviously up-regulated in LPS-treated cells, and could diminish the LPS-induced inflammatory response (Cui et al. 2014). Inflammatory factor TNF- α could activate the expression of lncRNA lethe, and the activated lethe binds with NF-κB subunit RelA to inhibit inflammatory signaling (Rapicavoli et al. 2013). RBM15 could regulate megakaryocyte differentiation in the inflammatory environment, which protein was enhanced by lncRNA AS-RBM15 with a CAP-dependent manner (Tran et al. 2016).

Nowadays, many scholars have studied the biological function and mechanism of lncRNAs act as competitive endogenous RNAs (ceRNAs) by sponging microRNAs (miRNAs) to regulate downstream gene expression (Li et al. 2013; Tian et al. 2014). LINC00265 promoted hepatocyte proliferation, inhibited cell apoptosis and accelerated cell cycle by sponging miR-28-5p during liver regeneration (Sheng et al. 2021). LINC00963 increased tumorigenesis through modulating miR-324-3p to upregulate the expression of ACK1 in breast cancer (Zhang et al. 2019). lncRNA BCRT1 commonly functions as a tumor promoter by targeting miR-1303 to attenuate its repressive effect on PTBP3 in various cancers (Liang et al. 2018, 2020). However, there are rare investigations on the biological function and mechanism of lncRNA in dairy cow mastitis.

Our earlier work confirmed a novel specific high expression bovine mastitis related lncRNA (BMNCR). Bioinformatics analysis identified that the regulatory mechanism of BMNCR mediated by miR-145/CBFB axis. Bta-miR-145 has been identified to be a major immune-related miRNA involved in immune response by NF-κB signaling pathway (Zhang et al. 2020), Li found that miR-145 was involved in the regulation of BMECs function by detecting transcriptome microRNAs in S. aureus induced BMECs (Li et al. 2015). CBFB (core binding factor subunit β) is a critical tumor suppressor and have a certain impact on the occurrence of breast cancer (Zhao et al. 2007; Malik et al. 2021), stable expression of miR-145 reduced the expression of endogenous CBFB (Li et al. 2021). The present study elucidated the inflammatory response and autoprotective mechanism of BMNCR in BMECs through miR-145/CBFB axis from the perspective of molecular genetics. BMNCR could be a potential target for mastitis diagnosis and therapy, which may enrich the present theories and further increase milk yield and improve milk quality.

Materials and methods

Primer synthesis

Specific small interfering RNA (siRNA) against BMNCR (siBMNCR-161, siBMNCR-1535, siBMNCR-2554), CBFB (siCBFB-236, siCBFB-465, siCBFB-644) and siRNA scrambled control (siRNA-NC) were synthesized from GenePharma (Shanghai, China). miR-145 mimic and its negative control mimic-NC, miR-145 inhibitor and its negative control inhibitor-NC were purchased from GenePharma (Shanghai, China). Primers of BMNCR, miR-145, CBFB, inflammation related genes (IL-1α, IL-2, IL-6, IL-8, IL-12), housekeeping genes (GAPDH, β-actin and U6) were listed in Table 1. Primers of lncRNAs (lncRNA 1-18 except lncRNA 5), miRNAs (miR-2284p, miR-126-5p, miR-1185, miR-2441, miR-877, miR-1777b, miR-423-5p, miR-2346, miR-455-5p, miR-451) and genes (GNB1, ANK1, OSBPL1A, ITGB8, TMOD1, ARG1, DCUN1D5, CFL2, KPNA1, PSME3, SOD2, A1BG, DERL2, TNPO1, RTN4, ACOT13, SLC4A4, ANO6, ST13, PSAT1, TAGLN2, LOX) were listed in Tables S1–S3. All primers were designed by Primer Premier 5.0 software (PREMIER Biosoft International, USA) and synthesized from GenePharma (Shanghai, China).

Table 1. qRT-PCR primer sequences.

Items	Primers sequence(5′-3′)
BMNCR	F: TGATGTGGGTGTCTGAGTTTC
	R: GCGAGTTTGCCTTTGGTTG
bta-miR-145	F: GTCCAGTTTTCCCAGGAA
	R: TGGTGTCGTGGAGTCG
	RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGGGATTC
IL-1α	F: GCTCAAAATGAAGACGAACCC
	R: CAACTTTGGATGGGCAACTG
IL-2	F: GCACCTACTTCAAGCTCTACG
	R: GGGCGCGTAAAAGTCAAATG
IL-6	F: AGAACGAGTATGAGGGAAAT
	R: TGGCTGGAGTGGTTATTAG
IL-8	F: AAGAATTGAGAGTTATTGAGAGT
	R: CAGACCTCGTTTCCATTG
IL-12	F: CACCAAAGATAAAACCAGCACAG
	R: GGCACAGGGTTGTCATAAAAG
CBFB	F: CCCGAAGAAGGACACGTGAA
	R: GTCTTGTTGTCTTCTTGCCAGT
GAPDH	F: GGCAAGTTCAACGGCACA
	R: ACCACATACTCAGCACCAGCA
β-Actin	F: TTCTAGGCGGACTGTTAG
	R: TGCCAATCTCATCTCGTT
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT

Cell culture and cell treatment

BMECs lines were isolated and obtained from cow mammary epithelial tissue as our previously described (Chen et al. 2019). The resuscitated BMECs were cultured in an incubator with 5% CO₂ and suitable humidity at 37 °C. The culture medium DMEM/F-12 (Gibco, Waltham, MA, USA) contained 10% fetal bovine serum (FBS, Gibco, Waltham, MA, USA), 10 U/L penicillin/streptomycin and 5 μg/mL bovine insulin (Invitrogen, Carlsbad, CA, USA).

Cells were cultured to 70–80% confluence in culture dishes, small RNA chemical synthesis reagents or mimic or inhibitor were transfected by lipofectamine 2000 (Invitrogen, USA) following the manufacturer’s protocol. Subsequent experiments were performed after 48h. Each treatment was carried three biological replicates.

RNA isolation, qRT-PCR and Western blot

Total RNA from each sample was obtained using Trizol reagent (catalog no R401-01, Vazyme, Nanjing, China). Reverse transcription was performed using a HiScrip Q RT SuperMix for qPCR kit (catalog no R123-01, Vazyme, Nanjing, China) with gDNA wiper according to the manufacturer’s instructions.

RT-qPCR was conducted using AceQ Universal SYBR qPCR Master Mix kit (Vazyme, Nanjing, China). The PCR procedure was performed according to our previous work protocol (Ma et al. 2023). Transcription levels were normalized to the levels of the housekeeping gene(GAPDH, β-actin and U6), and the 2−^ΔΔ(CT) method was used for relative quantitative analysis (Schmittgen and Livak 2008).

RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China) was used to collect and lyse total proteins from BMECs. Monoclonal rabbit anti-CBFB (catalog#ab133600, Abcam, Cambridge, UK) and anti-β-actin (catalog#ab8227, Abcam, Cambridge, UK) were purchased as primary antibodies. Anti-immune rabbit IgG-HRP (LK2001; Sungene Biotech, China) was used as secondary antibody. The gray values of protein bands were evaluated using Image J.

5-Ethynyl-2’-deoxyuridine (EdU) proliferation and CCK8 assay

Proliferation test will be performed after RNA oligos were transfected into BMECs 24 h. Firstly, BMECs were incubated in culture medium containing 10 μM EdU solution for 2 h. Then, BMECs were treated with 4% paraformaldehyde and immunostaining permeabilizer sequentially, the medium was discarded afterwards. Finally, cells were stained using the Cell Proliferation Assay Kit (C0075S, Beyotime, Shanghai, China), and images were collected on the Inverted Fluorescence Microscope (DMi8, Leica, Germany). The cell viability of BMNCR were assessed by cell counting kit-8 (CCK8, C0037, Beyotime, Shanghai, China) at the 450 nm wavelength following the manufacturer’s instruction.

Apoptosis assay

To evaluate cell apoptosis, 10 × 10⁵ cells were collected in trypsin without EDTA. After 24h post-transfection, BMECs were washed with 1 mL cold PBS twice and centrifuged at 1,000 × g and 4 °C for 5 min. Added 100 mL binding buffer to resuspend cells, then added 5 µL annexin V‑FITC and 5 µL PI-PE (E412-01 Vazyme Biotech, Nanjing, China) to incubate in the dark for 10 min. After that, 400 mL binding buffer was added and flow cytometer was used to determine the cell apoptosis (CytoFLEX, Beckman Coulter, Inc). The result was analyzed using CytExpert software.

Dual luciferase report assay

The miRanda, RNAhybrid, TargetScan and PicTar online bioinformatics software were used to predict the binding sites of BMNCR and miR-145, miR-145 and CBFB. psiCHECK^TM-2 (Promega, USA) vectors containing the sequences of BMNCR and CBFB wild type (WT) or mutant type (MUT) were co-transfected with miR-145 mimic or mimic NC into BMECs. The Renilla luciferase activities were normalized to the firefly luciferase activities, which were measured using Dual-Luciferase Reporter Assay Kit (DL101-01, Vazyme Biotech, Nanjing, China).

Statistical analysis

Graphpad 8.0 and ImageJ were used for graphing. Measurement data were expressed as mean ± standard error, the significance of differences between groups was analyzed with LSD-t-test (for two groups) and analysis of variance (more than two groups). p < .05 or p < .01 exhibited a statistical significance or highly significant.

Results

Expression screening and localization of BMNCR in S. aureus BMECs

By high throughput sequencing, we screened out 35,737 predicted lncRNAs and 505 aligned lncRNAs by high-throughput sequencing (Figure 1(A)). Differentially expressed lncRNAs were identified through fold change as well as p value calculated with t-test. The threshold set for up- and down-regulated genes was a fold change > = 2.0 and a p value < = .05. This analysis retained 283 up-regulated and 346 down-regulated lncRNAs in S. aureus induced mammary gland tissues compared to normal mammary gland tissues (Figure 1(B)). To further perceive the potential function of lncRNAs on inflammatory response, we specifically examined the dynamic levels of 18 differentially expressed lncRNAs on S. aureus induced BMECs and normal BMECs by qRT-PCR (Figure 1(C)). Data showed that the expression of CUFF.43696.1 (lncRNA5) was significantly enhanced in S. aureus BMECs, we renamed BMNCR (Figure 1(D)). BMNCR was a novel and unannotated lncRNA, predicted sequences 4206 nt mapped on the third intron of TCF7L2 of bovine chromosome 26, whereas, knock-down BMNCR has no significantly effect on TCF7L2 expression (Figure S1). The full-length sequence 5964 nt of BMNCR obtained by rapid-amplification of cDNA ends (RACE) (Figure 1(E), Supplementary data). Subcellular localization analysis indicates that BMNCR was observed in the nucleus and cytoplasm of BMECs (Figure 1(F)).

Figure 1. Expression screening and localization of BMNCR in S. aureus BMECs. (A) The number of predicted and aligned lncRNAs by high-throughput sequencing in dairy cows. (B) The number of differentially expressed lncRNAs in S. aureus induced mammary gland tissues compared to normal mammary gland tissues. (C) The expression levels of 18 differentially expressed lncRNAs on S. aureus induced BMECs (E, experiment group) and normal BMECs (C, control group) were detected by qRT-PCR (n = 3). (D) The expression level of BMNCR on S. aureus induced BMECs (inflammatory cells) and normal BMECs (normal cells). (E) The full-length sequence of BMNCR obtained by RACE. M, DL2000 DNA marker. (F) Distribution of BMNCR in nucleus and cytoplasm in BMECs. Data are means ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. **, p < .01.

BMNCR facilitated proliferation and attenuated apoptosis in BMECs

Based on our previous experiments, we further explored the potential biological effects on BMECs proliferation and apoptosis through loss-of function of BMNCR. qRT-PCR data showed that the expression of BMNCR significantly downregulated after transfected siBMNCR-161, renamed it siBMNCR (Figure 2(A)). Some interleukin family inflammation-related cytokines were regulated after knock-down BMNCR, increased the expression of IL-2, IL-8, IL-12 (p < .05 or p < .01), decreased the expression of IL-6 (p < .05) and the expression of IL-1α has not altered significantly (Figure 2(B)). CCK8 assay indicated that siBMNCR decreased the proliferation viability of BMECs (Figure 2(C)). EdU incorporation analysis further demonstrated that absence of BMNCR reduced the number of EdU-positive cells (Figure 2(D,E)). Flow cytometry was applied to detect cell apoptosis, the percentage of apoptotic cells was obviously increased after knock-down BMNCR (Figure 2(F,G)), siBMNCR enhanced cell apoptosis ratio in BMECs (Figure 2(H)). There data demonstrated that BMNCR might facilitate proliferation and attenuated Apoptosis in BMECs.

Figure 2. BMNCR Facilitated proliferation and attenuated apoptosis in BMECs. (A) qRT-PCR detected the expression efficiency of BMNCR after transfected three BMNCR siRNAs, respectively. (B) The expression levels of inflammation-related cytokines were validated by RT‐qPCR after treated siBMNCR for 48 h. (C) CCK8 assay exploring the function of BMNCR on the viability of BMECs. (D) EdU assay detected the number of BMECs treated with siBMNCR. (E) The proportion of EdU positive cells was counted by ImageJ. (F) Cell apoptosis was determined by flow cytometry after transfected with siBMNCR. (G) Distribution map of BMECs apoptosis. (H) Cell apoptosis index was counted by the sum of early and late apoptosis. Data are means ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. *, p < .05 and **, p < .01.

BMNCR bind with miR-145 and downregulated miR-145 expression

BMNCR located in cytoplasm and might exert its biological functions through ceRNA mechanism (Figure 1(F)). RNAhybrid and miRanda predicted that 11 miRNAs could target with BMNCR. Absence of BMNCR up-regulated the expression of miR-145, miR-2284p, miR-126-5p, miR-1185 (p < .05 or p < .01), down-regulated miR-2441, miR-877, miR-1777b (p < .01) (Figure 3(A)). Among them, miR-145 level showed the maximum increase (about 7 times) after knock-down BMNCR (Figure 3(B)), the potential binding seeds between BMNCR and miR-145 were predicted by RNAhybrid (Figure 3(C)). Dual-luciferase reporter assay was carried out to identify the binding capacity using psi-Check2 vector (Figure 3(D)). Luciferase activity of BMNCR-WT was significantly increased when co-transfected with miR-145 mimic (p < .01), and there was no significant difference in BMNCR-MUT (p > .05) (Figure 3(E)). These results proved that BMNCR could negatively regulate the expression of miR-145 in BMECs.

Figure 3. BMNCR Bind with miR-145 and downregulated miR-145 expression. (A) After transfected siBMNCR into BMECs for 48 h, the expression levels of 11 miRNAs which predicted by RNAhybrid and miRanda were detected by qRT-PCR. (B) BMNCR negatively regulated the expression of miR-145. (C) The potential binding seeds between BMNCR and miR-145 were predicted by RNAhybrid. (D) Insert BMNCR-WT or MUT sequences into psi-Check2 vector to identify the binding capacity. (E) Dual-luciferase reporter assay was carried out to identify the binding capacity between BMNCR and miR-145. Data are means ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. *, p < .05 and **, p < .01.

Functional roles of miR-145 on proliferation and apoptosis of BMECs

In order to explore the function of miR-145 in BMECs, we transfected miR-145 mimic or inhibitor into BMECs. The expression level of miR-145 was remarkably up-regulated or down-regulated after treated mimic or inhibitor (p < .01) (Figure 4(A)). Whereas, inflammation-related cytokines were not affected by miR-145 mimic (Figure 4(B)), IL-1α, IL-2 and IL-12 mRNA levels were decreased after treated miR-145 inhibitor in BMECs (Figure 4(C)). EdU incorporation assay showed that the rate of EdU-positive cells was significantly decreased in miR-145 mimic group and obviously increased in miR-145 inhibitor group (Figure 4(D,E)). The rate of cell apoptosis was conspicuously increased in miR-145 mimic group compared to mimic-NC group; however, no significant apoptosis appears in miR-145 inhibitor group (Figure 4(F–H)). To a certain extent, miR-145 could inhibit proliferation and promote apoptosis in BMECs.

Figure 4. Functional roles of miR-145 on proliferation and apoptosis of BMECs. (A) qRT-PCR detected the overexpression (mimic) or Interference (inhibitor) efficiency of miR-145. The expression levels of inflammation-related cytokines were validated by RT‐qPCR after treated miR-145 mimic (B) or miR-145 inhibitor (C). (D) EdU assay detected the number of BMECs after treated with miR-145 mimic or inhibitor. (E) The proportion of EdU positive cells was counted by ImageJ. (F) Cell apoptosis was determined by flow cytometry after transfected with miR-145 mimic or inhibitor. (G) Distribution map of BMECs apoptosis. (H) Cell apoptosis index was counted by the sum of early and late apoptosis. Data are means ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. *, p < .05 and **, p < .01.

BMNCR could regulate CBFB by sponge miR-145

To explore a potential signaling pathway affected by miR-145, TargetScan was used to construct a map of miR-145 and 23 potential mRNA targets interaction network (Figure 5(A)). In the data analysis found that CBFB gene was down-regulated after transfection with miR-145 mimic and was up-regulated after transfection with miR-145 inhibitor (Figure 5(B)). Western blot (Figure 5(C)) and grayscale analysis (Figure 5(D)) of CBFB were consistent with that of the mRNA expression (Figure 5(B)). Moreover, we analyzed the presence of target seeds in the 3’UTR of CBFB in 10 different species, the results identified the strong conservation of miR-145 binding sites (Figure 5(E)). Deleted the seeds of CBFB to identify the binding capacity by using psi-Check2 vector (Figure 5(F,G)). Dual-luciferase report assay elucidate that miR-145 mimic enhanced the luciferase activity of CBFB-WT vector (Figure 5(H)).

Figure 5. CBFB was the direct target gene of miR-145 and negatively regulated by miR-145. (A) the expression levels of 23 potential target genes were detected by qRT-PCR after transfected miR-145 mimic or inhibitor into BMECs for 48 h. (B) the mRNA level of CBFB was explored by qRT-PCR. (C) the protein level of CBFB was explored by Western blot. (D) the relative protein level of CBFB was calculated by ImageJ. (E) the Conservative binding seeds in the 3’UTR of CBFB were predicted by TargetScan in 10 different species. (F) The potential binding sites between miR-145 and CBFB. (G) Insert CBFB-WT or MUT sequences into psi-Check2 vector. (E) Dual-luciferase reporter assay was carried out to identify the binding capacity between miR-145 and CBFB. Data are means ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. *, p < .05 and **, p < .01.

Several studies have suggested that lncRNAs could regulate mRNAs expression in ceRNA mechanism. We conducted the experiment to investigate whether CBFB expression level would be affected by BMNCR. qRT-PCR indicated that absence of BMNCR would suppress CBFB mRNA level (Figure 6(A)). Western blot assay and grayscale analysis were also applied to detect the ceRNA mechanism, the protein level of CBFB was attenuated after knock-down BMNCR (Figure 6(B,C)). These studies elaborated that BMNCR could regulate CBFB expression by sponge miR-145.

Figure 6. BMNCR could regulate the expression of CBFB in BMECs. After transfected siBMNCR into BMECs for 48 h. (B) The mRNA level of CBFB was explored by qRT-PCR. (C) The protein level of CBFB was explored by Western blot. (D) The relative protein level of CBFB was calculated by ImageJ. Data are means ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. *, p < .05 and **, p < .01.

BMNCR modulated BMECs proliferation and apoptosis via miR-145/CBFB axis

To gain further insight into the function of CBFB, qRT-PCR data indicated that CBFB mRNA levels conspicuously reduced after transfected siCBFB-236 or siCBFB-465 or siCBFB-644 (Figure 7(A)), the expression level had most decreased when siCBFB-644 treated, siCBFB- 644 will be used in subsequent experiments, renamed siCBFB (Figure 7(B)). Western blot assay and grayscale analysis verified the protein level of CBFB, the protein content was obviously reduced after transfection with siCBFB (Figure 7(C,D)). The inflammation-related cytokines were up-regulated after knock-down CBFB in BMECs (Figure 7(E)). In addition, cell proliferation and apoptosis were also affected by CBFB. EdU proliferation test revealed that the number of BMECs grown less than that of the control group after transfection with siCBFB, and the down-regulation of CBFB inhibited the proliferation of BMECs (Figure 7(F,G)). Apoptosis analysis revealed that the downregulation of CBFB promoted the apoptosis ratio of BMECs (Figure 7(H–J)). Therefore, CBFB stimulated cell proliferation and arrested cell apoptosis. BMNCR could modulate BMECs proliferation and apoptosis via miR-145/CBFB axis.

Figure 7. CBFB could modulate proliferation and apoptosis in BMECs. (A) qRT-PCR detected the expression efficiency of CBFB after transfected three siRNAs of CBFB, respectively. After transfected siCBFB into BMECs for 48 h, (B) mRNA level of CBFB was explored by qRT-PCR. (C) The protein level of CBFB was explored by Western blot. (D) The relative protein level of CBFB was calculated by ImageJ. (E) The expression levels of inflammation-related cytokines were validated by RT‐qPCR after treated siCBFB into BMECs for 48h. (F) EdU assay detected the number of BMECs treated with siCBFB. (G) The proportion of EdU positive cells was counted by ImageJ. (H) Cell apoptosis was determined by flow cytometry after transfected with siCBFB. (I) Distribution map of BMECs apoptosis. (J) Cell apoptosis index was counted by the sum of early and late apoptosis. Data are means ± SE of n = 3 independent experiments, each performed in triplicate, and normalized to GAPDH. *, p < .05 and **, p < .01.

Discussion

Mastitis is known as one of the dairy cow diseases that cause significant economic losses worldwide, it is directly influences milk yield and quality (Kromker and Leimbach 2017). Epigenetic modification affects gene regulation directly without altering the sequence, which makes an increasing research focus on the mechanisms of ncRNAs. Although lncRNAs have been revealed to be essential modulator in pathogenesis and immunoregulation, the specific regulatory mechanisms of lncRNAs need to be further excavated in bovine mastitis (Yang et al. 2020). Here, we identified a novel lncRNA BMNCR which highly expressed in S. aureus induced bovine mastitis tissues by high-throughput sequencing. The expression level of BMNCR was closely related to the mRNA levels of inflammation-related cytokines in BMECs. Further investigated the potential regulatory mode of BMNCR in BMECs, found that knockdown BMNCR could attenuate cell proliferation, facilitate cell apoptosis. Our preliminary findings demonstrated that BMNCR may function as potential novel targets for diagnosis or treatment of S. aureus induced bovine mastitis.

Since ceRNA mechanisms of lncRNAs have gradually become widely known (Salmena et al. 2011), functional and mechanistic studies on lncRNA/miRNA axis have been increasingly described in the occurrence and development of various mammary diseases, some lncRNAs such as lnc SNHG20 (Guan et al. 2018) and lnc-408 (Qiao et al. 2021) were found that can promote invasion and metastasis of breast cancer cells via miRNA/transcription factor axis, indicating that lncRNA might be a potential target of diagnosis and treatment of breast cancer. Tucker et al. (Tucker et al. 2021) identified lncRNAs, miRNAs and transcription factors could regulate the host immune response to bovine mastitis via in silico analyses. In this study, we found that BMNCR negatively regulate miR-145 expression. miR-145 can enhance the viability of nerve cells and inhibit apoptosis and the expression of inflammatory factors IL-1β and TNF-α (Hou et al. 2022). Previous related studies have demonstrated that miR-145 exerts a role in mammary gland development and regulation of milk fat synthesis, it was significantly up-regulated in the mammary glands of high-fat dairy cows in mid-lactation, and involved in mammary gland cell proliferation through ESR1, MYC and TP53 (Wang et al. 2012; Jena 2017; Xia et al. 2021). Our study elucidated that overexpression of miR-145 reduced the proliferative capacity and accelerated apoptosis of BMECs, whereas knockdown of miR-145 led to the opposite effects and affect the levels of inflammation-related cytokines, which is consistent with Chen’s report (Chen et al. 2019).

To elucidate the detailed molecular mechanism of bta-miR-145, we first predicted its potential downstream targets, and assessed the function of target genes through NCBI websites, a total of 23 correlation genes related to immunity or inflammation were screened. CBFB was identified to be negatively regulated by miR-145 through qRT-PCR experiments and western blot analysis. Dual-luciferase reporter assay also confirmed the direct binding sites of miR-145 to CBFB. At present, the molecular mechanism of miR-145/CBFB expression regulation in dairy cow mastitis is still unclear. Many reports showed that CBFB can be significantly negatively regulated by miR-145 and affect the occurrence or development of various cancers by promoting cell proliferation, migration, invasion, and inhibiting cell apoptosis (Ostenfeld et al. 2010; Wang et al. 2021).

In this study, we demonstrate that downregulation of CBFB stimulates apoptosis and suppresses proliferation in BMECs. This is consistent with the proof-of-concept provided by Malik that upregulation of CBFB reduces tumorigenic ability of breast cancer cells (Malik et al. 2019). Meanwhile, the significant changes in the expression levels of IL-1α, IL-2, IL-6, IL-8, and IL-12α confirmed that CBFB may be one of the genes associated with immunity or inflammation. Some research also found that CBFB is involved in the regulation of T helper cell differentiation (Tuomela et al. 2009) and is able to affect GATA-3 function in T cells, regulating the expression of IL-5 (Miyamoto et al. 2019). Furthermore, CBFB is generally higher in malignant tissue than in corresponding normal tissue (Morita et al. 2017). Collectively, CBFB plays an integral role in the occurrence of inflammation and is one of the possible targets for the treatment of dairy cow mastitis. Since the function of CBFB is consistent with that of BMNCR on BMECs proliferation and apoptosis, especially in regulating the changes of inflammation-related cytokines, BMNCR may exert a positive role in BMECs through the miR-145/CBFB axis.

Taken together, this study investigated the role and mechanism of BMNCR in BMECs. The results indicated that BMNCR serve as miR-145 sponge to activate CBFB expression, and influence the proliferation and apoptosis of BMECs. Based on ceRNA theory, we constructed a novel BMNCR/miR-145/CBFB regulatory network in BMECs, which will provide benefit for precise molecular breeding and the development of mastitis targeted drugs in dairy cows, and are of great significance for increasing milk yield and improving milk quality (Figure 8).

Figure 8. A proposed model of BMNCR regulating CBFB by sponge miR-145 in BMECs.

Ethics statement

All experimental procedures were approved and conducted under the established standards of Yangzhou University (License number: SYXK [Su] 2017-0044), Yangzhou, China.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The authors confirm that the data supporting the findings of this study are available within the article.

Additional information

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 31902147, 31872324).