Pathological changes of highly pathogenic Bacillus cereus on Pelodiscus sinensis

Abstract

An outbreak of a disease with a high mortality rate occurred in a Chinese Softshell Turtle (Pelodiscus sinensis) farm in Hubei Province. This study isolated a highly pathogenic Bacillus cereus strain (Y271) from diseased P. sinensis. Y271 has β hemolysis, containing both Hemolysin BL (hblA, hblC, and hblD), Non-hemolytic enterotoxin, NHE (nheA, nheB, and nheC), and Enterotoxin FM (entFM) genes. Y271 is highly pathogenic against P. sinensis with an LD₅₀ = 6.80 × 10³ CFU/g weight. B. cereus was detected in multiple tissues of the infected P. sinensis. Among them, spleen tissue showed the highest copy number density (1.54 ± 0.12 × 10⁴ copies/mg). Multiple tissues and organs of diseased P. sinensis exhibited significant pathological damage, especially the spleen, liver, kidney, and intestine. It showed obvious tissue structure destruction, lesions, necrosis, red blood cells, and inflammatory cell infiltration. B. cereus proliferating in the spleen, liver, and other tissues was observed. The intestinal microbiota of the diseased P. sinensis was altered, with a greater abundance of Firmicutes, Fusobacterium, and Actinomyces than in the healthy group. Allobaculum, Rothia, Aeromonas, and Clostridium abundance were higher in the diseased group than in the healthy group. The number of unique microbial taxa (472) in the disease group was lower than that of the healthy group (705). Y271 was sensitive to multiple drugs, including florfenicol, enrofloxacin, neomycin, and doxycycline. B. cereus is the etiological agent responsible for the massive death of P. sinensis and reveals its potential risks during P. sinensis cultivation.

Keywords:

• Chinese softshell turtle
• Trionyx sinensis
• histopathology
• bacterial load
• bacterial toxin
• gut microbiota

1. Introduction

Bacillus cereus is a Gram-positive, spore-forming bacteria, a subgroup of closely related Bacilli of the genus Bacillus and Bacillaceae family (Ehling-Schulz et al. 2019). B. cereus can cause food poisoning and is frequently one of the most closely monitored food-borne pathogenic bacteria, and the most prominent symptoms after poisoning are diarrhea and vomiting (Becker et al. 1994; Schoeni and Wong 2005). Human infection with B. cereus can trigger diseases, including pneumonia (Hoffmaster et al. 2006), sepsis (Lede et al. 2011), and meningitis (Stevens et al. 2012). B. cereus can also cause animal diseases, including horses (Büsing et al. 2013), cattle (Song et al. 2019), pigs (Calvigioni et al. 2022), Half-smooth Tongue-sole (Wang et al. 2018), and Chinese Softshell Turtle (Cheng et al. 2021).

The Chinese Softshell Turtle (Pelodiscus sinensis) has a high disease resistance and survival rate in its natural habitat. However, habitat loss and overfishing have significantly reduced the wild populations and are listed as “vulnerable” on the International Union for Conservation of Nature (IUCN) red list of threatened species (https://www.iucnredlist.org/species/39620/97401140). In China, P. sinensis has significant economic and edible value and is commercially farmed on a large scale. However, with the increase in commercial breeding density, the incidence of diseases of P. sinensis increased. Pathogenic bacteria are the primary pathogens that harm P. sinensis cultivation. The common pathogenic bacteria include Edwardsiella tarda (Zhu et al. 2018), Aeromonas veronii (Zhao et al. 2011), and A. hydrophila (Lv et al. 2021).

In July − August 2022, a serious illness occurred in P. sinensis raised on a farm in Hubei province. The primary symptoms of infected P. sinensis are unresponsiveness, limb weakness, head shaking, and quick demise. The pathogen was isolated from the diseased P. sinensis to determine the etiology. B. cereus was identified through morphological characteristics, biochemical analysis, and PCR identification. The pathological changes of B. cereus on P. sinensis were elucidated by determining the bacterial load in diseased P. sinensis tissues and observing histopathological damage and intestinal microbiota changes. This study provides diagnostic basis and drug selection for the disease of P. sinensis caused by B. cereus, and provides reference materials for the study of P. sinensis diseases.

2. Materials and methods

2.1. Animal

The diseased P. sinensis originated from a farm in Hubei Province and weighed 700 (±100) g. We made a preliminary diagnosis of the diseased P. sinensis and recorded its clinical symptoms. The diseased P. sinensis is transported to the laboratory at a low temperature to isolate the pathogen. Healthy P. sinensis with no history of the disease was purchased from Hubei Hongwang Ecological Agriculture Technology Co., LTD, weighing 35 (± 3) g. Healthy P. sinensis were kept in the laboratory for 14 days, and the water temperature was kept at 28 (± 1) °C. All animal experiments were approved by the Animal Experimental Ethical Inspection of Laboratory Animal Centre, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences (ID Number: YFI 2022-zhouyong-0516).

2.2. Pathogen isolation

The diseased P. sinensis was anesthetized, and the liver and spleen were dissected. The samples were inoculated into Brain Heart Infusion (BHI) agar medium and cultured at 37 °C for 20 h, and single colonies were purified. The purified strain was obtained and labeled Y271. The bacteria was inoculated into Columbia CNA Blood agar medium and incubated at 37 °C for 20 h. Bacterial suspensions were prepared with normal saline (0.85%), dried, fixed, and stained with Gram (Jiancheng, Nanjing, China). The morphological characteristics of the bacterial suspensions were observed by optical microscope (Olympus, Tokyo, Japan). The bacteria were fixed in 2.5% glutaraldehyde solution, dehydrated and dried, and images of the pathogens were taken with a scanning electron microscope (Hitachi, Tokyo, Japan).

2.3. Molecular identification

DNA was extracted using a bacterial genome Extraction Kit following the manufacturer’s guidelines (Tiangen, Nanjing, China). The isolated strains were PCR amplified with 16S rDNA, the gyrB gene, and primers specific for B. cereus (syj153) (Table 1). After identification by 1.5% agarose gel electrophoresis, positive PCR products were purified. The DNA was cloned into the pMD19-T vector (TaKaRa, Dalian, China) and sequenced (Huayu Gene, Wuhan, China). These sequences were compared using BLAST on the National Center for Biotechnology Information (NCBI) GenBank database (http://blast.ncbi.nlm.nih.gov/Blast). The phylogenetic tree was constructed using MEGA software (Version 11.0.13).

Table 1. Primers used in PCR identification.

Primer	Sequence (5`-3`)	Annealing temperature (°C)	Productive size(bp)	Reference
16S rDNA	AGA GTT TGA TCC TGG CTC AG AAG GAG GTG ATC CAG CC	57	1407	(Li et al. 2020)
gyrB	YGGHTATAAAGTDTCNGGHGG TCNACRTCBGCRTCBGTCATRAT	50	833
SYJ153	CTACAGGTCGCAGATAAAACAGTC GCAAGGGCTAAAAATGAAATCT	53	680	(Yuan et al. 2020)
hblA	GCAAAATCTATGAATGCCTA GCATCTGTTCGTAATGTTTT	54	884	(Song et al. 2019)
hblC	CCTATCAATACTCTCGCAA TTTCCTTTGTTATACGCTGC	54	659
hblD	AATCAAGAGCTCTCACGAAT CACCAATTGACCATGCTAAT	52	430
nheA	TACGCTAAGGAGGGGCA GTTTTATTGCTTCATCGGCT	55	500
nheB	CAAGCTCCAGTTCATGCGG GATCCCATTGTGTACCATTG	58	935
nheC	ACATCCTTTTGCAGCAGAAC CCACCAGCAATGACCATATC	58	618
bceT	TTACATTACCAGGACGTGCTT TGTTTGTGATTGTAATTCAGG	55	428
cytK	CGACGTCACAAGTTGTAACA CGTGTGTAAATACCCCAGTT	52	565
Ces	GCATTTCGTGAAGCAGAGGT CCCTTTATCCCCTTCGATGT	59	699
entFM	AGAATCTAAATCATGCCACTGC AAAGAAATTAATGGACAAACTCAAACTCA	60	596	(Kim et al. 2011)
MT17	CTCCAGGAGAGGATTCGTGG TACCAAGGCAGCGAGCTTTA	56	87	(Park et al. 2017)
16S V3-V4	ACTCCTACGGGAGGCAGCA GGACTACHVGGGTWTCTAAT	55	500

2.4. Biochemical identification

The Microbial Identification and Phenotype MicroArrays System (Biolog, CA, USA) was used to evaluate the biochemical characteristics of strain Y271. The strain was inoculated into IF-A inoculum solution. The Y271 inoculant was added to the GEN III identification plate (Biolog, CA, USA). The GEN III identification plate was placed into the Biolog microbial identification system for assay qualification (Xiao et al. 2022).

2.5. Toxin gene

PCR detected the Y271 toxin genes. The genes included Hemolysin BL, HBL (A, C, and D), Non-hemolytic enterotoxin, NHE (A, B, and C), Enterotoxin T(bcet), Enterotoxin FM (entFM), Cytotoxin K (cytK), and Cereulide (ces). PCR primers are shown in Table 1.

2.6. Pathogenicity

To determine the pathogenicity of Y271, an injection challenge was administered for healthy P. sinensis. They were divided at random into six groups of 30. For each infected group, 1.0 × 10³, 1.0 × 10⁴, 1.0 × 10⁵, 1.0 × 10⁶, 1.0 × 10⁷ Colony-Forming Units (CFU)/g body weight bacterial suspension were prepared. The control group was injected with an equal volume of saline. After infection, the deaths were recorded for 14 days, and the bacteria that killed P. sinensis were isolated and identified. The median lethal dose (LD₅₀) was calculated using the Reed-Muench method (Reed and Muench 1938).

2.7. Histopathology

The brain, spinal cord, eyelids, eyes, gill-like tissues, liver, kidneys, spleen, ovaries, and intestinal tissues of healthy and diseased P. sinensis were collected. After fixation with a 4% paraformaldehyde solution, tissues were dehydrated, embedded, and sectioned (Jiang et al. 2015). The sections were stained with hematoxylin-eosin, HE (Solarbio, Beijing, China). The histopathologic changes were observed with an optical microscope.

2.8. Bacterial load

Blood, brain, liver, kidney, spleen, intestine, and ovary tissues of diseased P. sinensis were collected. Tissues were ground in a tissue grinder (Retsch, Germany), and DNA was extracted using a DNA extraction kit (Tiangen, Nanjing, China). The DNA copy number of B. cereus within tissues was measured using a digital droplet PCR (ddPCR) instrument (Bio-Rad, USA). B. cereus ddPCR primers (MT17) are shown in Table 1.

2.9. Gut microbiota

The intestinal contents of healthy and diseased P. sinensis were collected as samples. Total DNA was extracted, and the hypervariable region was amplified using 16S v3-v4 specific primers (Table 1). Sequence libraries were prepared using Illumina TruSeq Nano DNA LT Library Prep Kit. Paired-end sequencing was performed using an Illumina MiSeq sequencer (Illumina, CA, USA). Taxonomic composition analysis was performed on qiime2 (2019.4) software.

2.10. Drug sensitivity test

Drug susceptibility testing of strain Y271 was performed using the Kirby-Bauer disk diffusion method (Barry et al. 1979). The Y271 bacterial suspensions were adjusted to 0.5 McFarland standard, spread onto Mueller-Hinton (MHA) agar plates, added drug susceptibility paper chips, and incubated at 35 °C for 20 h. The test results are classified as sensitive (S), moderately sensitive (M), and resistant (R), according to the Clinical and Laboratory Standards Institute (CLSI, M100-S32).

3. Results

3.1. Clinical signs

The diseased P. sinensis left the water body because he could not maintain body balance (Figure 1A) and showed weak motility and hyperemic skin (Figures 1A and C), neck and eyelid swelling (Figures 1B and C). The oral mucosa and gill-like tissue were red (Figure 1D) and enlarged in the liver (Figure 1E). The mucosa of kidneys, ovaries, and gastrointestinal tract was hemorrhagic (Figure 1F), and the spleen was hemorrhagic and enlarged (Figure 1G).

Figure 1. Clinical symptoms of diseased Pelodiscus sinensis. (A) Leaving the water body, the skin was congested (arrow). (B) Neck swelling (sign), eyelid swelling (asterisk). (C) Skin hyperemia (arrow), neck swelling (sign). (D) Redness of oral mucosa and gill-like tissue (triangle) (E) Enlarged liver(arrow). (F) kidney hemorrhage (triangle), ovarian hemorrhage(asterisk), bleeding from the external wall of the gastrointestinal tract (sign). (G)The spleen is hemorrhagic and enlarged (arrow).

3.2. Pathogen speciation

The Y271 strain was grown on BHI solid Petri dishes with colonies that had rough and grayish-white surfaces (Figure 2A). Y271 grew on Columbia CNA Blood agar medium and exhibited β hemolytic rings (Figure 2B). Y271 turned purple when stained with Gram (Figure 2C). It appeared rod-shaped, approximately 3-5 μm (Figure 2D).

Figure 2. Morphological features of strain Y271. (A) Bacterial colony. (B) βhemolytic ring. (C) Gram staining (bar scale: 10 μm). (D) Scanning electron microscope (bar scale: 5 μm).

3.3. Molecular identification and sequence analysis

The Y271 strain showed more than 99.86% sequence identity with 16S r DNA and gyrB genes of B. cereus from GenBank (Accession no: OR150395.1). The Y271 strain shares the same branch of the evolutionary tree as members of the genus B. cereus (Figure 3A and B). A 680 bp band was amplified with a B. cereus specific primer, and the control was negative (Figure 3C).

Figure 3. PCR identification of Bacillus cereus. (A) Phylogenetic tree of strain Y271 based on 16S rDNA gene. (B) Phylogenetic tree of strain Y271 based on gyrb gene. (C) M: 2000 marker; 1: Y271-1 2: Y271-2; 3: Y271-3; 4: Negative control. (D) Y271 toxin gene PCR assays. (E) The bacterial load in tissues of diseased P. sinensis caused by B. cereus. Brain 5.1 ± 0.8 × 10¹ copies/mg, liver 2.58 ± 0.29 × 10³ copies/mg, spleen 1.54 ± 0.12 × 10⁴ copies/mg, kidney 1.17 ± 0.18 × 10³ copies/mg, ovary 1.29 ± 0.04 × 10³ copies/mg, intestine 5.38 ± 0.42 × 10² copies/mg and blood 1.57 ± 0.19 × 10³ copies/mg.

3.4. Biochemical identification of Y271

The Microbial Identification and Phenotype MicroArrays System determined that strain Y271 is Bacillus cereus based on the results of a biochemical reaction. The specific reaction items and the decision results are shown in Table 2. Strain Y271 was positive for the biochemical reactions of D-Maltose, D-Trehalose, Sucrose, N-Acetyl-D-Glucosamine, D-Glucose-6-PO₄ and Gelatin. Y271 strain was effective againstα-D-Lactose and D-Sorbitol were negative.

Table 2. Results of Biolog identification of strain Y271.

Reaction item	Result	Reaction item	Result
A1 Negative Control	N	E1 Gelatin	P
A2 Dextrin	P	E2 Glycyl-L-Proline	B
A3 D-Maltose	P	E3 L-Alanine	B
A4 D-Trehalose	P	E4 L-Arginine	B
A5 D-Cellobiose	B	E5 L-Aspartic Acid	B
A6 Gentiobiose	B	E6 L-Glutamic Acid	B
A7 Sucrose	P	E7 L-Histidine	B
A8 D-Turanose	P	E8 L-Pyroglutamic Acid	B
A9 Stachyose	P	E9 L-Serine	P
A10 Positive Control	P	E10 Lincomycin	N
A11 PH6	P	E11 Guanidine HCl	B
A12 PH5	N	E12 Niaproof 4	N
B1 D-Raffinose	N	F1 Pectin	B
B2 α-D-Lactose	N	F2 D-Galacturonic Acid	N
B3 D-Melibiose	B	F3 L-Galactonic Acid Lactone	B
B4 β-Methyl-D-Glucoside	B	F4 D-Gluconic Acid	P
B5 D-Salicin	B	F5 D-Glucuronic Acid	B
B6 N-Acetyl-D-Glucosamine	P	F6 Glucuronamide	N
B7 N-Acetyl-β-D-Mannosamine	B	F7 Mucic Acid	B
B8 N-Acetyl-D-Galactosamine	N	F8 Quinic Acid	B
B9 N-Acetyl Neuraminic Acid	B	F9 D-Saccharic Acid	B
B10 1% NaCl	P	F10 Vancomycin	N
B11 4% NaCl	P	F11 Tetrazolium Violet	N
B12 8% NaCl	P	F12 Tetrazolium Blue	N
C1 α-D-Glucose	B	G1 P-Hydroxy-Phenylacetic Acid	B
C2 D-Mannose	B	G2 Methyl Pyruvate	N
C3 D-Fructose	B	G3 D-Lactic Acid Methyl Ester	B
C4 D-Galactose	B	G4 L-Lactic Acid	B
C5 3-Methyl Glucose	B	G5 Citric Acid	N
C6 D-Fucose	B	G6 α-Keto-Glutaric Acid	B
C7 L-Fucose	B	G7 D-Malic Acid	B
C8 L-Rhamnose	B	G8 L-Malic Acid	P
C9 Inosine	B	G9 Bromo-Succinic Acid	P
C10 1% Sodium Lactate	P	G10 Nalidixic Acid	B
C11 Fusidic Acida	N	G11 Lithium Chloride	B
C12 D-Serine	B	G12 Potassium Tellurite	B
D1 D-Sorbitol	N	H1 Tween 40	B
D2 D-Mannitol	B	H2 γ-Amino-Butyric Acid	B
D3 D-Arabitol	B	H3 α-Hydroxy-Butyric Acid	P
D4 Myo-lnositol	B	H4 β-Hydroxy-D, L-Butyric Acid	B
D5 Glycerol	P	H5 α-Keto-Butyric Acid	P
D6 D-Glucose-6-PO4	P	H6 Acetoacetic Acid	P
D7 D-Fructose-6-PO4	B	H7 Propionic Acid	P
D8 D-Aspartic Acid	N	H8 Acetic Acid	P
D9 D-Serine	P	H9 Formic Acid	P
D10 Troleandomycin	N	H10 Aztreonam	P
D11 Rifamycin SV	N	H11 Sodium Butyrate	P
D12 Minocycline	N	H12 Sodium Bromate	B

Notes: “P” = Pos; “N” = Neg; “B” = Borderline.

3.5. Toxin gene identification

According to PCR amplification results, strain Y271 contained multiple toxin genes, including hblA, hblC, hblD, nheA, nheB, nheC, and entFM genes (Figure 3D). Strain Y271 lacks bceT, cytK, and ces genes.

3.6. Pathogenicity testing

Deaths occurred in all the tested groups at different concentrations; however, there were no deaths in the control group (Figure 4). A conspicuous head shake, body surface bleeding, gill-like tissue redness, and splenomegaly were seen with moribund P. sinensis. Additionally, B. cereus was isolated from the liver and spleen of the dead P. sinensis. The LD₅₀ of strain Y271 determined was 6.80 × 10³ CFU/g weight.

Figure 4. Percentage survival of P. sinensis attacked by different concentrations of Y271.

3.7. Histopathological observations

Compared with the healthy P. sinensis, the diseased P. sinensis has significant pathological changes in multiple tissues (Figure 5). The cerebral cortex cysts of diseased P. sinensis showed increased red blood and white blood cells, and a large number of B. cereus breeding (Figure 5Ac and Ad). The diseased eye tissues of P. sinensis were swollen and lacked structural integrity, exhibited choroidal congestion, blood cell infiltration, and B. cereus proliferating (Figure 5Bc and Bd). The muscle layer structure of the diseased P. sinensis eyelid is loose and disorganized, with infiltration of blood cells and proliferation of B. cereus (Figure 5Cc and Cd). The gill-like tissue was infiltrated with blood cells and proliferating B. cereus (Figure 5Dc and Dd). Additionally, B. cereus was observed in inflammatory cell infiltration of the spinal cord (Figure 5Ec and Ed). The liver showed disorganized cell arrangement, hemosiderin deposition, hemocyte infiltration, increased inflammatory cells, and massive B. cereus proliferation (Figure 5Fc and Fd). The spleen was vacuolated, with an indistinct white to red pulp structure, increased inflammatory cells, and massive B. cereus proliferation (Figure 5Gc and Gd). The glomeruli were atrophied and infiltrated with inflammatory cells. B. cereus was present in the glomeruli (Figure 5Hc and Hd). The outer membrane of the ovary was swollen and lacked structural integrity, blood cell aggregation, inflammatory cell infiltration, and proliferating B. cereus (Figure 5Ic and Id). The epithelial cells of intestinal villi were sloughed off, the muscular mucosae were congested, red blood cells were infiltrated, B. cereus was proliferating, and the submucosa was loose and swollen (Figure 5Jc and Jd).

Figure 5. Histopathological observation of the healthy and diseased P. sinensis (scale bar: 50 μm and 10 μm). (A) a and b brain of a healthy P. sinensis, c, and brain of a diseased P. sinensis. (B) a and b eyes with healthy P. sinensis, c and d eyes with diseased P. sinensis. (C): a and b the eyelids of healthy P. sinensis, c, and d the eyelids of diseased P. sinensis. (D) a and b gill-like tissues of healthy P. sinensis, c and d gill-like tissues of diseased P. sinensis. (E) a and b spinal cords of healthy P. sinensis, c and d spinal cords of diseased P. sinensis. (F) a and b liver of healthy P. sinensis, c and d liver of diseased P. sinensis. (G) a and b spleen of healthy P. sinensis, c and d spleen of diseased P. sinensis. (H) a and b kidneys with healthy P. sinensis, c and d kidneys with diseased P. sinensis. (I) a and b ovarioles of healthy P. sinensis, c and d ovarioles of diseased P. sinensis. (J) a and b intestine of healthy P. sinensis, c and d intestine of diseased P. sinensis.

3.8. Bacterial load analysis

The B. cereus was observed in multiple tissues of diseased P. sinensis (Figure 3E). Among them, the highest bacterial load was found in the spleen (1.54 ± 0.12 × 10⁴ copies/mg), followed by the liver (2.58 ± 0.29 × 10³ copies/mg), blood (1.57 ± 0.19 × 10³ copies/mg), ovary (1.29 ± 0.04 × 10³ copies/mg), kidney (1.17 ± 0.18 × 10³ copies/mg), intestine (5.38 ± 0.42 × 10² copies/mg), and the lowest was in the brain tissue (5.1 ± 0.8 × 10¹ copies/mg).

3.9. Gut microbiota analysis

From the bacterial phylum level, the healthy and diseased P. sinensis intestinal flora was primarily composed of the Bacteroidetes, Firmicutes, Proteobacteria, and Fusobacteria phyla (Figure 6A). Additionally, the gut microbiota was analyzed at the genus level. The gut microbiota of P. sinensis is mainly composed of Chryseobacterium, Cetobacterium, Acinetobacter, and Macrococcus (Figure 6B). A total of 1607 operational taxonomic units (OTUs) were identified and confirmed through gut microbiota analysis. Among them, the healthy and diseased groups identified 705 and 472 unique OTUs, respectively, and they also contained 430 identical OTUs.

Figure 6. Gut microbiota analysis of P. sinensis. (A) Relative abundance of phylum levels. (B) Relative abundance of genus levels. (C) The Venn diagram showing the number of unique and shared operational taxonomic units (OTUs) of gut bacteria of healthy and diseased P. sinensis. (healthy P. sinensis: C; diseased P. sinensis: D).

3.10. Drug sensitivity

The Y271 strain isolated from the diseased P. sinensis was sensitive to the antimicrobials, including florfenicol, enrofloxacin, neomycin, doxycycline, clindamycin, cefradine, midecamycin, gentamicin, minocycline, tetracycline, amikacin, and erythromycin. The Y271 strain was moderately susceptible to ampicillin and sulfanilamide and resistant to penicillin, streptomycin, and carbenicillin (Table 3).

Table 3. Results of antibiotic sensitivity test for strain Y271.

Medicine name	Content (piece)	Inhibition zone (mm)	Sensitivity
Florfenicol	30μg	28	S
Enrofloxacin	10μg	22	S
Neomycin	30μg	16	S
Doxycycline	30μg	24	S
Ampicillin	10μg	8	R
Penicillin	10U	11	I
Clindamycin	2μg	21	S
Cefradine	30μg	29	S
Midecamycin	30μg	22	S
Gentamicin	10μg	16	S
Minocycline	30μg	22	S
Sulfonamide	300 IU	7	R
Tetracycline	30μg	25	S
Amikacin	30μg	20	S
Erythromycin	15μg	21	S
Streptomycin	10μg	14	I
Carbenicillin	100μg	11	I

Notes: sensitive (S), moderately sensitive (M), and resistant (R).

4. Discussion

B. cereus is a facultative aerobic, spore-producing, gram-positive bacterium. The B. cereus is widespread and can be isolated from soil, air, sewage, and some foods (Beckers 1987; Stenfors Arnesen et al. 2008). B. cereus has similar biological characteristics to B. thuringiensis, B. mycoides, and B. anthracis (Yamada et al. 1999). It is a common food-borne opportunistic pathogen. B. cereus is also a pathogenic bacterium in some animals (Büsing et al. 2013; Song et al. 2019; Calvigioni et al. 2022). The symptoms of the P. sinensis infected with Y271 strain by injection are consistent with those of natural outbreaks. Y271 strain was isolated again from the diseased P. sinensis. Pathogenicity test showed that LD₅₀ = 6.80 × 10³ CFU/g weight of P. sinensis.

B. cereus can produce a variety of toxins, the majority of which are diarrhoeogenic enterotoxins and vomiting enterotoxins (Bottone 2010). Diarrhea-causing enterotoxin includes hbl, nhe, cytK, entFM, bceT, and ces is an emetic enterotoxin (Agata et al. 1995; Bottone 2010; Dietrich et al. 2021). The hbl, nhe and cytK are the main pathogenic agents (Dietrich et al. 2021). The Y271 strain can produce hblA, hblC, hblD, nheA, nheB, nheC, and entFM. The Y271 strain proliferated in P. sinensis, and the hemolytic toxin prevented blood from clotting. These toxins cause systemic inflammation, which may be a significant factor for the high fatality rate of P. sinensis.

Histopathological observation is an important method of animal clinical pathology research (Jiang et al. 2015; Forzán et al. 2017). Multiple tissues of diseased P. sinensis have undergone variable degrees of pathological changes. Spleen and liver tissues were the most damaged, exhibiting tissue swelling and lesions, red blood cells, inflammatory cell infiltration, and proliferating B. cereus. In southern Taiwan Province, diseased P. sinensis caused by B. cereus showed consistent pathological changes (Cheng et al. 2021). The B. cereus causes central nervous system infections and meningitis in humans (Koizumi et al. 2020; Worapongsatitaya and Pupaibool 2022). We observed B. cereus from the meninges of diseased P. sinensis, which resulted in massive inflammatory cell infiltration of the meninges, triggering meningitis. Meningitis causes the disease P. sinensis to lose its balance, become unable to swim, shake its head, and ultimately die. In the B. cereus, DNA was detected in multiple tissues of diseased P. sinensis, with relatively higher B. cereus loads in the spleen and liver, consistent with pathological observations.

The gut microbiota is important for human and animal health (Sehnal et al. 2021). The gut microbiota of P. sinensis is dominated by Bacteroidetes, Firmicutes, Proteobacteria, and Fusobacteria at the phylum level (Wu et al. 2021; Kang et al. 2022). There are some differences in the gut microbiota of P. sinensis in different habitats (Wu et al. 2021). The abundances of Firmicutes, Fusobacteria, and Actinobacteria phyla in the intestinal microbiota of the diseased P. sinensis were higher than those in the healthy group. At the genus level, the genera Allobaculum, Rothia, Aeromonas, and Clostridium abundance were higher in the diseased than in the healthy group. Some bacterial genera, including Rothia and Aeromonas, have been identified as pathogenic pathogens (Parker and Shaw 2011; Fatahi-Bafghi 2021). These bacteria can cause intestinal inflammation and mucosal barrier function impairment (Evariste et al. 2019). We identified 1607 OTUs and confirmed them through the analysis of gut microbiota. Among them, the unique OTUs in the healthy group (705) were greater than those in the diseased group (472). The intestinal microbial diversity of diseased P. sinensis was decreased. Environmental stress or pathogenic infections are important causes of reduced intestinal microbial diversity (Adamovsky et al. 2018; Zhang et al. 2022). The B. cereus infection resulted in an altered intestinal microbiota of P. sinensis.

Drug sensitivity tests can provide support for the effective treatment of bacterial diseases. The Y271 strain is sensitive to many antibiotics, including flufenicol, ennofloxacin, neomycin, and doxycycline. The susceptibility results were similar to those of GXWXAA isolates, with B. cereus being moderately sensitive to penicillins and resistant to sulfonamides (Li et al. 2020). The Y271 has a higher sensitivity to amikacin, gentamicin, and midomycin than the XS0724 strain (Li et al. 2020). The drug sensitivity results of B. cereus isolated from different areas showed some differences. In treating bacterial diseases, sensitive drugs approved by the local government should be selected according to pathogenic bacteria’s drug sensitivity test results.

Additionally, B. cereus is often used as a probiotic to regulate intestinal health problems in humans and livestock (Sorokulova 2013; Lee et al. 2019). The B. cereus has also been used as a probiotic additive in some animal feeds (Scharek et al. 2007; Zhu et al. 2016). However, these additions can harm some susceptible animals (Wen et al. 2019; Calvigioni et al. 2022).

5. Conclusion

The B. cereus (Y271) isolated from diseased P. sinensis was β Hemolytic containing toxin genes including hblA, hblC, hblD, nheA, nheB, nheC, and entFM. Y271 showed high pathogenicity to P. sinensis, LD₅₀ = 6.80 × 10³ CFU/g weight. The Y271 strain proliferated in multiple tissues of P. sinensis, resulting in severe histopathological alterations in P. sinensis and eventually leading to death. The Y271 strain was sensitive to many antibiotics, including flufenicol, ennofloxacin, neomycin, and doxycycline. In conclusion, B. cereus is highly pathogenic for P. sinensis, causing severe pathological changes in P. sinensis, and reveals the potential risks of B. cereus during P. sinensis cultivation.

Compliance with ethics requirements

In this study, all experimental procedures were conducted according to guidelines of the appropriate Animal Experimental Ethical Inspection of Laboratory Animal Centre, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences (ID Number: YFI 2022-zhouyong-0516).

Acknowledgements

Thanks to Hubei Hongwang Ecological Agricultural Technology Co., Ltd. for providing healthy laboratory animals.

Disclosure statement

No potential conflict of interest was reported by the authors.

Additional information

Funding

This work was supported by the Scientific and Technological Innovation Project of Hubei Province (2023DJC102), the Central Public-interest Scientific Institution Basal Research Fund (2023TD46), National Freshwater Aquatic Germplasm Resource Center (FGRC18537) and Yinchuan Science and Technology Plan Project (2022NY03).