Effect of a garlic drench on Galectin gene expression in ovine whole blood

Abstract

Garlic, known for its immune-modulating and antibiotic properties, contains lectins that possess antimicrobial and immunomodulatory effects. Galectins (Gals), which bind β-galactosides, play a role in modulating immunity and pathological processes. It is hypothesized that garlic’s lectin components interfere with animal lectins. St. Croix sheep, known for their resistance to parasites and adaptability, are influenced by dietary supplements for innate immunity. This study evaluated the impact of garlic drench on Galectin gene expression in St. Croix sheep. Adult non-lactating ewes received either garlic juice concentrate or sterile distilled water for four weeks. Blood samples were collected, and plasma and whole blood cells were separated. Galectin secretion was assessed using a Sheep-specific ELISA, while Galectin gene transcription was analyzed through real-time PCR. Garlic administration upregulated LGALS-3 gene expression and significantly increased total plasma protein concentration. Garlic supplementation also affected Galectin secretion, with Gal-1, Gal-3, and Gal-9 showing differential effects.

Keywords:

• Garlic
• Galectins
• sheep

Introduction

Among the medicinal plants, Allium sativum (commonly known as garlic) is widely used. Garlic has various medicinal properties, including prevention of hypertension,¹ promotion of healing potential,² hepatoprotection,³ hematinic activities⁴ and anthelminthic potential against naturally occurring gastrointestinal nematode’s⁵ and flukes.⁶ Garlic contains high levels of bioactive compounds, such as organosulfur compounds, the micronutrient selenium (Se), and flavonoids, which serve as antioxidants and have the potential to enhance the immune system.⁷ Garlic has similar anthelmintic properties to ivermectin and can be used as a substitute for ivermectin.⁸

Galectins are a family of multifunctional lectins that play pivotal roles in host–pathogen host innate and adaptive immunity. Galectins produced by different hosts can act as pattern recognition receptors (PRR) detecting conserved pathogen-associated molecular patterns (PAMPs) of parasites, while galectins produced by pathogens can modulate host responses, immune intervention and therapies of the parasitic infection.⁹

Galectin-1, known for its immunomodulatory properties, exerts regulatory effects on T cell apoptosis and differentiation, as well as on the suppression of inflammation.¹⁰ Galectin-3, a structurally unique multifunctional protein, functions as a key mediator of immune responses and is involved in various processes such as cell adhesion, chemotaxis, and regulation of inflammation.¹¹ Furthermore, Galectin-3 has been implicated in cancer progression and metastasis.¹² Galectin-9, on the other hand, has gained attention for its involvement in diverse immune processes, including T cell homeostasis, regulation of immune cell function, and modulation of inflammatory responses.¹³ It has also been identified as a regulator of autoimmune diseases and has shown promise as a therapeutic target.¹⁴ These galectins exert their effects by binding to glycans¹⁵ both self and non-self, on cell surfaces and within the extracellular matrix, thereby influencing important cellular functions and contributing to various physiological and pathological processes.

Lectin, Galactoside-Binding, Soluble (LGALS) genes encode Galectin (GAL) proteins i.e., glycan-binding proteins.¹⁶ Differential modulation in LGALS expression and GAL secretion was correlated with immune suppression as well as parasite infection in St Croix Sheep (Table 1).¹⁷ Garlic has been studied as an alternative anthelmintic in sheep.¹⁸ In light of the central role of Galectins in innate immunity and increased interest in use of garlic in animal production systems,¹⁹ the possible role of Garlic supplementation on Galectins and immune modulation needs evaluation.

Table 1. Lectin galactose binding soluble (LGALS) genes primer sequence¹⁷.

Sequence of primers
Gene	Primer	Sequence 5’ to 3’
LGALS1	Forward	ACCATCGTGTGTAACAGCAAGGAC
	Reverse	GCTTGATGGTTAGGTCTGTCTCG
LGALS3	Forward	CATTGAAGCGTGGGTTAAAGT
	Reverse	CCCTCTCTTGAAATCTAAAGC
LGALS9	Forward	ATTCCTGTTGCAGAAGTCTACCTGGACA
	Reverse	GAACATCTTCCACACGGTAGGGGT
RPLP0	Forward	CAACCCTGAAGTGCTTGACAT
	Reverse	AGGCAGATGGATCAGCCA
UCHL5	Forward	ACAAAGACAACTTGCTGAGGAACCC
	Reverse	GGCAACCTCTGACTGAATAGCACTT

Despite these findings, there has been a dearth of information regarding the efficacy of garlic as an anthelmintic in sheep. The objective of the present study was to evaluate the effects of administering a garlic drench on Galectin gene expression and secretion in the blood of sheep.

Materials and methods

Animals and experimental design

Twelve adult female St. Croix sheep, non-lactating, matched in age and in good health, were selected from North Carolina Agricultural and Technical State University’s Small Ruminant Research Unit in Greensboro, North Carolina. The Institutional Animal Care and Use Committee (IACUC) approved all protocols and handling procedures with the assigned IACUC ID: 21-008.0. The sheep grazed in pastures during the daytime and were housed indoors at night. They were fed Southern States Sheep Feed (Southern States, Richmond, VA.) and had access to hay, water, salt, and mineral blocks ad libitum. The study was conducted during the summer. The animals were randomly assigned to different treatment groups.

Garlic preparation and drench administration

Garlic Barrier, a concentrated garlic juice purchased from a company in Glendale, CA, was used. Five hundred ml of garlic barrier was taken in autoclaved 1 L flask, and 500 ml of DEPC-treated distilled water was added to the same flask. The mixture was then stirred slowly using a magnetic stirrer for 45 minutes and stored at room temperature. Fresh drench was prepared every week for administration. For the treatment group, 10 ml of the prepared drench²⁰ was aliquoted into 15 ml polypropylene tubes, while for the control group, 10 ml of distilled water was aliquoted. The treatment group (n = 6) animals were drenched with 10 ml of garlic preparation. The control group animals were drenched with 10 ml of distilled water daily in the morning between 8 am and 10 am for a duration of 30 days. All adult non-lactating ewes were weighed, and the average initial body weight was 63.2 lbs.

Sample collection and laboratory analysis

Blood samples were collected before the start of drenching as baseline or control samples, and then once every week for four weeks after drenching. Blood samples were taken from the jugular vein of the sheep using BD vacutainer needles and single-use needle holders. Approximately 18 ml of blood was collected into three vacutainer tubes (BD, Franklin lakes, NJ) containing 0.9% acid citrate dextrose for analysis of packed cell volume, total cell count, cell viability, and white blood cell differential count. For RNA extraction, blood was collected in 2.5 ml PAXgene RNA tubes (QIAGEN Inc., Valencia, CA). After collection, the tubes were immediately placed on ice and transported to the laboratory for further analysis. The samples were transported on ice to the Worku Laboratory for Studies in Animal Genetic Diversity and Biotechnology, located in the Department of Animal Science at North Carolina Agricultural and Technical State University.

To further profile gene expression, plasma and cell pellets were separated to evaluate changes in protein concentration and gene expression, respectively. A 1.5 ml aliquot of blood was taken and placed in an Eppendorf tube. It was then centrifuged at 14000 rpm at 4 °C for 15 minutes. The plasma was carefully separated and stored in labeled 1.5 ml tubes at −80 °C. Trizol (Qiagen) was added to the cell pellet at a 1:3 ratio and homogenized using a vortex. The homogenized solution was labeled and stored at −80 °C. Before further analysis, the cell pellet, stored at −80 °C, was brought to room temperature.

RNA isolation, cDNA synthesis and real-time PCR (RT-PCR) analysis

In the RNA isolation and cDNA synthesis process, total RNA was extracted from cell pellets using the PureLink® RNA Mini Kit (Invitrogen™ 12183018 A) according to the manufacturer’s instructions. The purity of the isolated RNA was assessed using the Nanodrop Spectrometer ND 1000 (Thermo Scientific. Inc, Waltham, MA). To prevent RNA degradation, cDNA synthesis was carried out utilizing the SuperScript™ First-Strand Synthesis System for RT-PCR (Invitrogen, San Diego, CA) Kit. For real-time PCR (RT-PCR) and fold change analysis, the CFX Connect real-time system (Bio-Rad Laboratories, Hercules, CA) was employed. Sheep-specific Galectin LGALS-1, 3, and 9 primers were designed and commercially sequenced by Eurofins Genomics (Louisville, KY), with subsequent testing through blasting in The NCBI database. The assay was performed in duplicates following the protocol described by Asiamah.²¹ Ribosomal Protein Lateral Stalk Subunit P0 (RPLP0) and Ubiquitin C-Terminal Hydrolase L5 (UCHL5) were used as internal control housekeeping genes. Gene expression was normalized to internal controls RPLPO (housekeeping genes) to determine the fold change in gene expression between test and control samples using the 2^−ΔΔCt method.²²

Quantification of concentrations of total protein and secreted Galectins in sheep plasma

The total concentration of secreted protein in plasma was analyzed using the Pierce Bicinchoninic Acid Protein Assay Kit (Thermo Scientific, Waltham, MA). The standards and working reagents were prepared following the manufacturer’s protocol (Thermo Scientific, Rockford, IL). Duplicate measurements were taken to determine the protein concentrations. The concentrations of secreted Galectins 1, 3, and 9 in plasma were determined using Galectin-specific ELISA kits designed for sheep (My BioSource, San Diego, CA) according to the manufacturer’s instructions.

Results and discussion

Galectin gene expression

Galectins, encoded by the lectin galactose binding soluble (LGALS) gene play crucial roles in various biological processes. Using specific sheep primers,²³ we amplified the galectin genes and analyzed their expression levels. Our results demonstrated that LGALS1 and LGALS3 genes exhibited upregulation in response to garlic treatment. Among them, LGALS-3 showed a more significant fold-change. A decreasing but not significant change was observed for LGALS 9. This finding further supports the role of garlic in modulating galectin gene expression. These findings can contribute valuable insights into the biological mechanisms that underlie the observed potential health benefits of garlic, as demonstrated in preclinical studies.²⁴

Besides, studies on the mouse Gal-1 gene promoter have revealed the significance of specific cis-elements and promoter methylation in regulating gene expression.²⁵ Moreover, in-vitro studies in humans investigating the effects of s-allyl cysteine sulfoxide (SACSO), a garlic component, have shown upregulation of LGAL-3.²⁶ These findings are consistent with our study, as LGAL-3 was upregulated. This finding provides further evidence for the potential health effects of garlic and highlights the importance of Gal in mediating its biological effects. Future studies could explore the specific mechanisms by which garlic modulates galectin gene expression and investigate the functional implications of these changes in various physiological contexts (Figure 1).

Figure 1. Effect of garlic on LGALS 1,3,9 gene expression. The significance of least-square means at P < 0.05 level is indicated by different letters.

Total plasma protein concentration

A significant elevation in the total plasma protein concentration was observed following garlic supplementation when compared to the control group (p < 0.05) (Figure 2). This finding supports the notion that garlic can stimulate protein release by cells in response to various stimuli, including pathogenic agents, stress, and immune proteins like cytokines.²⁷ This aligns with existing literature,²⁸ which suggests that the effect of garlic on protein secretion is influenced by the immune status and protein production of the animals. Ex-vivo studies have demonstrated that the effects of different types of garlic on protein concentration can vary. Ex vivo Allicin has been found to decrease plasma protein concentration, whereas no change was observed with fresh garlic and garlic barrier in goat blood.²⁹ The composition and concentration of garlic compounds and animal species, should be considered in determining its impact on protein secretion.

Figure 2. Effect of garlic on total plasma protein concentration. The significance of least-square means at P < 0.05 level is indicated by different letters.

Changes in Galectin secretion

The current experiment revealed interesting results regarding the impact of garlic supplementation on Galectin (Gal) secretion in adult non-lactating ewes. Garlic supplementation exerted a significant influence on Gal-1 secretion, as evidenced by a notable time effect observed in the treatment group when compared to the control group (p < 0.05) (Figure 3). In relation to Gal-3 secretion, garlic supplementation resulted in a significant increase (p < 0.05) in the secretion of Gal-3 within the treatment group compared to the control group. The initial garlic treatment stimulated Gal-3 secretion, leading to a notable increase. However, in the second week, an increase in the control group was observed, possibly due to a high fecal egg count (FEC) during that specific week. Following the subsiding of the infection, the garlic-treated group maintained higher Gal-3 levels than the control group (Figure 4). As for Gal-9 secretion, garlic supplementation significantly increased Gal-9 secretion in non-lactating ewes (p < 0.05).

Figure 3. Effect of garlic on GAL-1 secretion. The significance of least-square means at P < 0.05 level is indicated by different letters.

Figure 4. Effect of garlic on GAL-3 secretion. The significance of least-square means at P < 0.05 level is indicated by different letters.

Figure 5. Effect of garlic on GAL-9 secretion. The significance of least-square means at P < 0.05 level is indicated by different letters.

Similar studies have been observed when garlic was added to sheep blood ex-vivo.³⁰ The concentration of Gal-1 and Gal-3 was significantly increased by garlic at a concentration of 10 µg/ml. However, Gal-9 showed no significant effect (Figure 5). On the other hand, when the garlic concentration was increased to 50 and 100 µg/ml, all indicators, including Gal-1, Gal-3, and Gal-9, exhibited a decrease.³⁰

Galectin secretion was modulated by garlic treatment. There was a differential effect on the structurally distinct Gal types. It is important to note that the functional implications of garlic supplementation on galectin secretions may vary depending on the dosage, duration, and individual variations. However, these findings contribute to our understanding of the potential benefits of garlic as a dietary supplement for enhancing Gal secretion in ewes. Further research is needed to explore the potential therapeutic applications of garlic and its impact on galectin secretion in different physiological contexts.

Conclusions

In conclusion, our findings indicate that supplementation with garlic modulate galectin gene expression and secretion. These findings contribute to our understanding of the potential benefits of garlic as a dietary supplement for modulating Galectin gene expression and secretion to impact innate immunity in ewes. Future studies could focus on elucidating the specific mechanisms by which garlic modulates galectin gene expression and exploring the functional implications of these changes in different physiological contexts.

Disclosure statement

The authors declare that they have no conflicts of interest to this work.

Correction Statement

This article has been corrected with minor changes. These changes do not impact the academic content of the article.

Additional information

Funding

This work is supported by the USDA National Institute of Food and Agricuture, [Eans-Allen] project [The accession number is 7000376 and the project number is NC.X 349-5-22-120-1]. Characterization of Galectins for Genome to Phenome Integration. Mulumebet Worku. PI. North Carolina Agricultural and Technical State University.