Molecular mechanism of triptolide in myocardial fibrosis through the Wnt/β-catenin signaling pathway

Abstract

Objective. Myocardial fibrosis (MF) is a common manifestation of end-stage cardiovascular diseases. Triptolide (TP) provides protection against cardiovascular diseases. This study was to explore the functional mechanism of TP in MF rats via the Wnt/β-catenin pathway. Methods. The MF rat model was established via subcutaneous injection of isoproterenol (ISO) and treated with low/medium/high doses of TP (L-TP/M-TP/H-TP) or Wnt agonist BML-284. Cardiac function was examined by echocardiography. Pathological changes of myocardial tissues were observed by HE and Masson staining. Col-I/Col-III/Vimentin/α-SMA levels were detected by immunohistochemistry, RT-qPCR, and Western blot. Collagen volume fraction content was measured. Expression levels of the Wnt/β-catenin pathway-related proteins (β-catenin/c-myc/Cyclin D1) were detected by Western blot. Rat cardiac fibroblasts were utilized for in vitro validation experiments. Results. MF rats had enlarged left ventricle, decreased systolic and diastolic function and cardiac dysfunction, elevated collagen fiber distribution, collagen volume fraction and hydroxyproline content. Levels of Col-I/Col-III/Vimentin/α-SMA, and protein levels of β-catenin/c-myc/Cyclin D1 were increased in MF rats. The Wnt/β-catenin pathway was activated in the myocardial tissues of MF rats. TP treatment alleviated impairments of cardiac function and myocardial tissuepathological injury, decreased collagen fibers, collagen volume fraction, Col-I, Col-III, α-SMA and Vimentin levels, HYP content, inhibited Wnt/β-catenin pathway, with H-TP showing the most significant effects. Wnt agonist BML-284 antagonized the inhibitive effect of TP on MF. TP inhibited the Wnt/β-catenin pathway to repress the proliferation and differentiation of mouse cardiac fibroblasts in vitro. Conclusions. TP was found to ameliorate ISO-induced MF in rats by inhibiting the Wnt/β-catenin pathway.

Keywords:

• Isoproterenol
• myocardial fibrosis
• triptolide
• collagen I
• collagen III
• wnt/β-catenin signaling pathway

Introduction

MF is the main pathological process of myocardial remodeling after myocardial infarction, which is characterized by excessive accumulation of collagen fibers and deposition of extracellular matrix, of which collagen I and collagen III are the main collagen types [1,2]. Once activated by injury or inflammation, cardiac fibroblasts (CFs) produce more collagen fibers to stabilize the heart but excessive fibrosis impairs cardiac function [3]. When myocardial infarction or myocardial injury occurs, CFs are activated from the resting state to undergo cell proliferation, migration and differentiation to myofibroblasts, which can cause excessive extracellular matrix deposition, and the damaged tissue is replaced by fibrotic scars produced by fibroblasts and myofibroblasts, resulting in a decrease in the ventricular wall compliance, a reduction in the heart’s diastolic and systolic function, and ultimately leading to serious consequences such as heart failure or even cardiac rupture [4,5]. Therefore, it’s of great importance to explore novel therapeutic targets for MF management.

Guanxin V demonstrates potential in mitigating acute myocardial infarction by attenuating fibrosis, apoptosis, and oxidative stress damage via modulation of the TGF-β1 pathway [6]. Guanxin V has been shown to alleviate cardiomyocyte apoptosis and MF, thereby decelerating ventricular remodeling following an acute myocardial infarction [7]. Triptolide (TP) is an active component of extracts that is derived from Tripterygium wilfordii Hook F which possesses effects such as immune modulation, anti-inflammation, anti-proliferation and pro-apoptosis [8]. TP can alleviate cardiac ischemia/reperfusion injury in rats by inducing activation of the Nrf2/HO-1 pathway [9]. TP is the active ingredient in a hydrogel platform (TPL@PLGA@F127) that inhibits MF, enhances cardiac function, and protects cardiomyocytes in rats with myocardial infarction [10]. TP curbs the expression of pro-inflammatory cytokines (IL-1β and IL-6) and pro-fibrotic factors and represses pressure-overload-induced MF in rat hearts [11]. TP inhibits isoproterenol-induced cardiac fibrosis and angiotensin II-led CFs collagen production and exhibits anti-fibrotic effects by suppressing the activation of NLRP3 inflammasome to reduce MF. [12]. Moreover, different doses of TP prominently repressed levels of immune mediators, macrophage infiltration, pro-inflammatory cytokines, and chemokines, and MF pathways including TGF-β1, α-SMA, and collagen accumulation in diabetic cardiomyopathy [13]. However, the functional mechanism of TP in MF rats has not been fully elucidated yet.

The Wnt/β-catenin signaling pathway plays a pivotal role in heart development, myocardial cell formation and differentiation [14]. The association of the Wnt/β-catenin signaling pathway with MF has been extensively investigated. For instance, Mizutani et al. have reported that MF of the neonatal mouse heart after cryoinjury is accompanied by activation of the Wnt signaling [15]. The inhibition of β-catenin signaling has also been found to be able to suppress Ang II-induced MF [16]. Aldehyde dehydrogenase-2 could protect against myocardial infarction-related MF by modulating the Wnt/β-catenin signaling pathway [17]. Hence, we concluded that suppression of the Wnt/β-catenin signaling pathway might mitigate and treat MF. Thus, we speculated that TP might ameliorate MF by inhibiting the Wnt/β-catenin signaling pathway in myocardial tissues. On the premise that whether TP alleviates MF on the basis of the Wnt/β-catenin signaling pathway has not been elicited, this study explored the functional mechanism of TP in MF via the Wnt/β-catenin signaling pathway and thus provided a reference for the clinical drug development of MF.

Material and methods

Animal grouping and treatment

A total of 72 Sprague-Dawley male rats (aged 8 weeks, weighing 220 ± 20 g) obtained from Hongli Medical Animal Experimental Research (Jinan, Shandong, China) were housed in separate cages at 23 ± 1 °C with a 12-h light/dark cycle and given feed and water freely. Following 1-week acclimation, the rats received a subcutaneous injection of isoproterenol hydrochloride (ISO; Sigma-Aldrich, St. Louis, MO, USA) to establish the MF rat model in accordance with the literature [18]. ISO was dissolved in normal saline and injected into rats at a dose of 5 mg/kg/d for 14 d. The 72 rats were randomly and equally divided into 6 groups: normal control group (NC group), ISO group, low/medium-/high-dose TP + ISO group (L/M/H-TP + ISO group) and BML-284 + H-TP + ISO group. Rats in the ISO, L/M/H-TP + ISO, and BML-284 + H-TP + ISO groups were subcutaneously injected with ISO to establish the MF model. Rats in the NC group were subcutaneously injected with an equivalent amount of normal saline. Rats in the L/M/H-TP + ISO group were subcutaneously injected with TP [high performance liquid chromatography (HPLC) > 98%, D0777; Baomanbio, Shanghai, China)] at concentrations of 10, 50, 150 μg/kg and the dosage and method were referred to the literature [18] followed by dissolving with dimethyl sulfoxiderats (DMSO) and diluting in normal saline. Rats in the BML-284 + H-TP + ISO group received an intravenous injection of 500 µL Wnt agonist BML-284 (2 mg/mL, M00507-AEW; Biolab, Beijing, China) and a subcutaneous injection of high-dose TP (150 µg/kg) and ISO (5 mg/kg), and the method of BML-284 conformed to the literature [19]. The same treatments were carried out for 14 consecutive days.

Echocardiography

After 14 days of consecutive treatment, all rats were anaesthetized by intraperitoneal injection of 2% pentobarbital sodium (0.2 mL/100 g, T0894-25G, Merck, Rahway, NJ, USA) with chest hair shaved and couplant applied. Rats were placed on the test bench for the determination of cardiac function using color Doppler ultrasonography (Voluson-i, GE, Milwaukee, WI, USA). Specifically, the ultrasonic probe was placed on the left chest of rats and then shifted to the left, forming an angle of 15°–30° with the sternum to display the long-axis images of the left ventricle with the image depth adjusted to 2–4 cm at a frequency of 7.5 MHz. The measurement indexes included left ventricular end diastolic diameter (LVEDD) and left ventricular end systolic diameter (LVESD). The left ventricular ejection fraction (LVEF) was calculated using the formula: LVEF = [(LVEDD³ − LVESD³)/LVEDD³] × 100%. The left ventricular fraction shortening (LVFS) was calculated using the formula: LVFS = [(LVEDD − LVESD)/LVEDD] × 100%. For the evaluation of cardiac diastolic function, Doppler blood flow of the mitral valve, aortic valve and pulmonary valves on the parasternal long axis view and the pulmonary artery long axis view was detected and the ratio of the peak early diastolic velocity (E peak) and the peak late diastolic velocity (A peak) of mitral valves was analyzed. All measurement results were detected by a single examiner blinded to the experiment. The data were calculated as the average value of 4 cardiac cycles.

Preparation of paraffined sections

Rats were euthanized using 4% pentobarbital sodium (0.1 mL/100 g). The heart was removed. The myocardial tissues of the left ventricle were taken and fixed with 4% paraformaldehyde for 24 h. Subsequently, myocardial tissues were washed with running water for 30 min, rinsed with phosphate buffer saline (PBS) 3 times, dehydrated with gradient ethanol, cleared with xylene for 30 min, paraffin-embedded and sliced at 5 μm with a slicer (Thermo Fisher Scientific, Waltham, MA, USA).

HE staining

Paraffined sections prepared above were conventionally dewaxed, rinsed with deionized water and stained with Harris hematoxylin solution (BB-4409; BestBio, Shanghai, China) for 10 min. Differentiation procedures were conducted after the sections were washed with running water. In brief, sections were rinsed with 1% ethanol hydrochloride and immediately observed under the microscope (Olympus-CH20, Tokyo, Japan) and color development time was controlled. The stained part outside the nucleus was washed with running water for 10 min and with deionized water for 1 min. Subsequently, sections were stained with eosin solution (BB-4410; BestBio) for 5 min, dehydrated with ethanol, cleared with xylene, sealed with neutral gum, observed and photographed under the microscope.

Masson staining

The prepared paraffin sections were conventionally dewaxed and washed with running water and distilled water. Masson staining was performed using a Masson staining kit (BB-4422; BestBio) as per the provided instructions. Sections were dehydrated with gradient ethanol, cleared with xylene, sealed with neutral gum, observed and photographed under the microscope after drying. The Image pro plus6.0 (Media Cybernetics, Rockville, MD, USA) software was adopted to calculate collagen volume fraction (CVF): CVF = the blue collagen fiber area in the visual field/the total area of the myocardial tissue in the visual field.

Immunohistochemistry

The prepared paraffin-sections were dried at 60 °C, dewaxed, immersed in 3% freshly configured 3% hydrogen peroxide solution and incubated for 10 min at room temperature under conditions devoid of light. The antigen was restored in accordance with the provided instructions of primary antibodies. Following blockade with goat serum for 1 h at 37 °C, the sections were incubated with rabbit polyclonal antibodies anti-Collagen-I (Col-I; 1:500, ab270993; Abcam, Cambridge, UK), anti-Collagen-III (Col-III; 1:200, ab7778; Abcam), anti-Vimentin (1:250, ab92547; Abcam) and anti-α-smooth muscle actin (α-SMA; 1:200, STJ96417; St John’s Laboratory, London, UK) at 4 °C overnight. The sections were rewarmed at 37 °C for 45 min and incubated with secondary antibody HRP-labeled goat anti-rabbit IgG H&L (1:200, ab6721; Abcam) for 60 min at room temperature. After adding 50–100 µL prepared DAB working solution to the sections, Color development was observed under an optical microscope (30 s–1 min). Then, the sections were counterstained with hematoxylin for 30 s, differentiated with 1% ethanol hydrochloride for several seconds, and turned back to blue by washing with running water for 30 min. Next, the sections were rinsed with running water 3 times, observed under the microscope, dehydrated with gradient ethanol, cleared with xylene and sealed. Images of immunohistochemistry were collected under the optical microscope and positive expression was presented as brown-yellow granules in the visual fields. The positive expression rate of the target protein was analyzed using Image pro plus6.0 software. Twelve cardiac images were taken from each rat and semi-quantitative analysis was performed with the average value.

Hydroxyproline (HYP) detection

Myocardial tissues were isolated and HYP content in myocardial tissues was detected using the kit (MZ094789; S&S Bio & Tech, Shanghai, China) in conformity with the instructions.

Culture and grouping of rat CFs

Rat CFs (CM-R074, Yaji Biological, Shanghai, China) were identified as Vimentin-positive by immunofluorescence, with cell purity of more than 90%. CFs were cultivated in dulbecco’s modified eagle medium/F-12 medium (Gibco, Carlsbad, California, USA) containing 10% fetal bovine serum + 100 U/mL penicillin and streptomycinat 37 °C with 5% CO₂.

CFs were assigned to the following groups: (1) CFs group: cultured normally for 24 h; (2) CFs + ISO group: treated with 10 μM ISO for 24 h to establish an in vitro model of cardiac fibrosis [20]; (3) CFs + ISO + TP group: treated with 10 μM ISO and 10 μg/L TP for 24 h [12]. 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) and Western blot assays were performed on CFs after treatment.

MTT assay

The proliferation of CFs was assessed by the MTT Cell Growth Assay Kit (CT02, Sigma-Aldrich). MTT reagent (5 mg/mL) was added to each well. After cells were cultivated for 4 h, the supernatant was discarded, followed by the addition of 150 μL DMSO to each well of cells. Optical density at 490 nm was measured using a microplate reader (Bio-Rad, CA, USA). The cell proliferative activity was expressed as a percentage (%), with the CFs group set to 100%.

Immunofluorescence assay

CFs were subjected to fixation with 4% paraformaldehyde for 10 min. Next, cells were permeabilized with 0.1% Triton X-100 (9036-19-5, Sigma-Aldrich) for 5 min, followed by blockade with 1% bovine serum/10% normal goat serum/0.3M glycine in 0.1% PBS-Tween (Sigma-Aldrich) for 1 h. Thereafter, cells were incubated with primary antibody α-SMA (1:500, ab124964, Abcam) overnight at 4 °C, and fostered with secondary goat anti-rabbit IgG-coupled with secondary antibody Alexa Fluor^®488 (2 µg/mL, ab150077, Abcam) for 1 h at room temperature. The nuclei were stained with 4′,6-diamidino-2-phenylindole. α-SMA positive cell number was observed under a fluorescence microscope (NIKON 80i, NIKON, Tokyo, Japan).

RT-qPCR

The myocardial tissues were ground to powder using liquid nitrogen. The total RNA was extracted using TRIzol reagent (ZC-0021A; ZCIBIO Technology Co., Ltd., Shanghai, China) and transcribed into cDNA using the PrimeScript RT reagent kit (HRR037A-1; Takara, Tokyo, Japan). qPCR was performed using SYBR^® Premix Ex TaqTM II (HRR081C-1; Takara) on the CFX Connect Real-Time PCR Detect System (CFX Connec, Bio-Rad) under the reaction conditions of pre-denaturation at 94 °C for 10 min and 40 cycles of denaturation at 94 °C for 10 s, annealing at 60 °C for 20 s, and extension at 72 °C for 34 s. n = 6. The data were analyzed using the 2^−ΔΔCt method with GAPDH as an internal control. The amplified primers of genes and their sequences were shown in Table 1.

Table 1. Primer sequences.

Gene	Forward 5′–3′	Reverse 5′–3′
Col-I	GAGCGGAGAGTACTGGATCGA	CTGACCTGTCTCCATGTTGCA
Col-III	TGCCATTGCTGGAGTTGGA	GAAGACATGATCTCCTCAGTGTTGA
Vimentin	AAAGAATTCATGTCCACCAGGTCCGT	AAATCTAGACGTTGCACTGAGCCTGT
α-SMA	GATTATTGCTCCTCCAGAACG	CTTCGTCATACTCCTGTTTGCT
GAPDH	GCTGAGA ATGGGAAGCTGGT	GCCTTCTCCATGGTGGTGAA

Col-I: collagen-I; Col-III: collagen-III; α-SMA: α-smooth muscle actin; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

Western blot

The myocardial tissues were ground using liquid nitrogen or differently-treated CFs were acquired. Total protein was extracted with radio immunoprecipitation assay (RIPA) lysis buffer (SY4680; Beijing Yita Bio-tech Co. Ltd., Beijing, China). Protein concentration was detected using the bicinchoninic acid (BCA) Protein Assay kit (P0012S; Beyotime, Shanghai, China). Equal amount of protein samples were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto the polyvinylidene fluoride (PVDF) membranes. PVDF membranes were blocked with 5% skim milk-Tris-buffered saline–Tween-20 (TBST) and incubated for 1 h at room temperature. Subsequently, the membranes were incubated with primary antibodies rabbit polyclonal antibodies (all from Abcam): anti-Col-I (1:1000, ab270993), anti-Col-III (1:1000, ab7778, Abca), anti-Vimentin (1:5000, ab92547), anti-α-SMA (1:5000, ab124964), anti-β-catenin (1:8000, ab6302), anti-c-myc (1:1000, ab32072), anti-Cyclin D1 (1:10,000, ab134175) and anti-GAPDH (1:5000, ab201822) at 4 °C overnight. The membranes were incubated with secondary antibody HRP-labeled goat anti-rabbit IgG H&L (1:5000, ab6721; Abcam) for 1 h at room temperature. Enhanced chemiluminescence (ECL; Millipore, Bedford, MA, USA) was adopted for development and Image pro plus6.0 software was employed for gray value quantitative analysis.

Statistical analysis

The data were analyzed using SPSS 21.0 (IBM Corp., Armonk, NY, USA) statistical software. Results were expressed as mean ± standard deviation (SD). Pairwise comparisons were analyzed using an independent sample t test and comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparisons test. The p value was obtained using two-sided tests. The difference of p < .05 was considered statistically significant.

Results

TP alleviated ISO-induced cardiac dysfunction in rats

To explore whether TP improved the impairment of cardiac function induced by ISO, the MF rat model was established by subcutaneous injection of ISO and MF rats were simultaneously treated with different doses of TP (L-TP, M-TP, and H-TP). Echocardiography on the 14th day showed that compared with the NC group, the ISO group had increased levels of LVEDD and LVESD (Figure 1A–B, p < .05), and decreased levels of LVEF, LVFS and ratio of early to late diastolic filling velocity (E/A) (Figure 1C–E, all p < .05). In comparison to the ISO group, TP treatment groups with different doses (L/M/H-TP + ISO) showed decreased levels of LVEDD and LVESD and increased levels of LVEF, LVFS and E/A ratio in a dose-dependent manner (all p < .05). The aforementioned results illustrated that ISO induced left ventricular dilation, decreases in systolic and diastolic function and impairment of cardiac function in rats while TP partially alleviated cardiac dysfunction.

Figure 1. TP alleviated ISO-induced cardiac dysfunction in rats. Cardiac function of rats was analyzed by transthoracic echocardiography after 14 d of treatment with ISO or/and different doses of TP. (A) LVEDD; (B) LVESD; (C) LVEF; (D) LVFS; (E) E/A. Data were expressed as mean ± SD (n = 12). comparisons among multiple groups were analyzed using one-way ANOVA, followed by Tukey’s multiple comparisons test. *p < .05, **p < .01.

TP alleviated ISO-induced MF in rats

To investigate whether TP alleviated ISO-induced MF in rats, myocardial tissues of rats in different treatment groups were subjected to HE staining and Masson staining. Compared with the NC group, the ISO group showed a disordered arrangement of cardiomyocytes, increased cell volume with obvious vacuoles, irregular nuclear shape, reduced nucleoplasm, increased and irregularly arranged blue collagen fibers forming a network (Figure 2A–B) and elevated CVF (Figure 2C, p < .05). TP treatment groups with different doses showed improved cardiomyocyte morphology, decreased collagen fiber in myocardial tissues and decreased CVF in a dose-dependent manner (all p < .05). Additionally, immunohistochemistry and RT-qPCR analysis showed a significant enhancement of the number of Col-I and Col-III-positive cells (Figure 2D, all p < .05), and an elevation of Col-I and Col-III mRNA and protein levels in the ISO group compared with the NC group (Figure 2E–F, all p < .05). Compared with the ISO group, TP treatment groups with different doses showed decreased number of Col-I and Col-III-positive cells and abated Col-I and Col-III mRNA and protein levels in a dose-dependent manner (Figure 2D–F, all p < .05). At the same time, we detected HYP content in myocardial tissues and observed increased HYP contents in the ISO group relative to the NC group (Figure 2G, p < .05), and decreased HYP level after TP treatment with different doses in a dose-dependent manner (all p < .05). The above results indicated that ISO induced MF in rats and TP alleviated MF in rats.

Figure 2. TP alleviated ISO-induced MF in rats. Myocardial tissues were stained and MF-related indexes were detected after 14 days of treatment with ISO or different doses of TP. (A) HE staining; (B) Masson staining; (C) CFV; (D) positive expressions of Col-I and Col-III in myocardial tissues detected by immunohistochemistry; (E,F) mRNA and protein levels of Col-I and Col-III detected by RT-qPCR and Western blot; (G) HYP content in myocardial tissues. Data were expressed as mean ± SD (n = 6). comparisons among multiple groups were analyzed using one-way ANOVA, followed by Tukey’s multiple comparisons test. *p < .05, **p < .01, ***p < .001.

TP inhibited CF proliferation and differentiation into myofibroblasts

A key step in the development of MF is the abnormal activation of CFs and the transformation into myofibroblasts, during which the increased Vimentin is accompanied with CF proliferation and α-SMA is produced when CF phenotypes differentiate into myofibroblasts [21,22]. To find out whether TP inhibited CF proliferation and differentiation into myofibroblast phenotypes in myocardial tissues, the positive expression and mRNA and protein expressions of Vimentin, a marker of CF proliferation, and α-SMA, a marker of myofibroblast phenotype differentiation were detected. Compared with the NC group, the ISO group showed increased numbers of Vimentin and α-SMA positive cells (Figure 3A, p < .05), and elevated mRNA and protein expressions of Vimentin and α-SMA (Figure 3B-C, p < .05). On the other hand, TP treatment groups with different doses showed decreased numbers of Vimentin and α-SMA positive cells and mRNA and protein levels in a dose-dependent manner (all p < .05). These results suggested that TP inhibited CF proliferation and differentiation into myofibroblast phenotype in myocardial tissues.

Figure 3. TP inhibited CF proliferation and differentiation into myofibroblasts. Positive expressions and mRNA transcription levels of Vimentin and α-SMA in myocardial tissues were detected by immunohistochemistry and RT-qPCR after 14 d of treatment with ISO or different doses of TP. (A) positive expressions of Vimentin and α-SMA in myocardial tissues detected by immunohistochemistry; (B,C) mRNA and protein expressions of Vimentin and α-SMA in myocardial tissues detected by RT-qPCR and Western blot. Data were expressed as mean ± SD (n = 6). comparisons among multiple groups were analyzed using one-way ANOVA, followed by Tukey’s multiple comparisons test. *p < .05, **p < .01, ***p < .001.

TP suppressed activation of Wnt/β-catenin signaling pathway

Accumulating evidence has suggested that the Wnt/β-catenin signaling pathway is activated in most cases of MF and the suppression of the Wnt/β-catenin signaling pathway might be helpful to attenuate and treat MF [14,15,23]. To investigate the role of TP in the Wnt/β-catenin pathway, the protein levels of β-catenin and downstream c-myc and Cyclin D1 on the Wnt/β-catenin pathway were determined by Western blot, with results unveiling that ISO treatment led to increases in β-catenin, c-myc, and Cyclin D1 levels in rat myocardial tissues, while TP treatment down-regulated β-catenin, c-myc, and Cyclin D1 levels in a dose-dependent manner (Figure 4, all p < .05). The above-mentioned results demonstrated that TP suppressed the activation of Wnt/β-catenin signaling pathway.

Figure 4. TP suppressed activation of Wnt/β-catenin signaling pathway. After 14 d of treatment with ISO or different doses of TP, expression levels of β-catenin, c-myc and Cyclin D1 proteins were determined by Western blot. Data were expressed as mean ± SD (n = 6). comparisons among multiple groups were analyzed using one-way ANOVA, followed by Tukey’s multiple comparisons test. *p < .05 and ***p < .001.

Wnt agonist antagonized improving effect of TP on MF

To study whether TP improved MF by repressing the Wnt/β-catenin signaling pathway, Wnt agonist BML-284 and H-TP were used to jointly treat MF rats. Western blot results showed that BML-284 partially averted the suppressive effect of TP on the Wnt/β-catenin pathway, and up-regulated the protein levels of β-catenin, c-myc and Cyclin D1 again (Figure 5A, all p < .05). We subsequently analyzed the cell morphology and collagen fiber distribution using HE and Masson staining. The result showed that after BML-284 treatment, cell morphology was changed, collagen fiber increased, CVF elevated (Figure 5B–C, p < .01). The results of immunohistochemistry, RT-qPCR, and Western blot manifested that after BML-284 treatment, Col-I and Col-III positive cells, mRNA, and protein expressions of Col-I, Col-III, α-SMA and Vimentin (Figure 5D–F, all p < .05), and HYP content were increased (Figure 5G, p < .05). All of these results elicited that BML-284 antagonized the protective effect of TP against MF by activating the Wnt/β-catenin pathway.

Figure 5. Wnt agonist antagonized the improving effect of TP on MF. MF rats were co-treated with the Wnt agonist BML-284 and H-TP. (A) protein levels of β-catenin, c-myc and Cyclin D1 assessed by Western blot; (B,C) CVF analyzed by HE and Masson staining; (D) positive expression cells of Col-I, Col-III, Vimentin and α-SMA counted by immunohistochemistry; (E,F) mRNA and protein levels of Col-I, Col-III, Vimentin, and α-SMA in myocardial tissues determined by RT-PCR and Western blot; (G) HYP level. mRNA values of H-TP + ISO group in panels a and (E) were not normalized, which was consistent with the previous contents. Data were expressed as mean ± SD (n = 6). comparisons between groups were analyzed using one-way ANOVA, and post hoc tests were performed using Tukey’s multiple comparison test. *p < .05, **p < .01.

TP inhibited ISO-induced proliferation and differentiation of CFs by suppressing the Wnt/β-catenin pathway in vitro

The in vitro MF model was established by treating rat CFs with ISO (immunofluorescence Vimentin-positive, Figure 6A). Then, CFs were treated with TP. As reflected by MTT assay results, ISO induced the proliferation of CFs, which was inhibited by TP (Figure 6B, all p < .01). Immunofluorescence assay results revealed that ISO induced an increment in α-SMA-positive cell number, while TP repressed CF differentiation (Figure 6C). The Wnt/β-catenin pathway activation was detected by Western blot. It was found that ISO treatment boosted β-catenin, c-myc, and Cyclin D1 protein levels, while TP subdued the Wnt/β-catenin pathway activation (Figure 6D, all p < .001). The above results further confirmed that TP protected against MF in vitro by curbing ISO-induced proliferation and differentiation of CFs via suppressing the Wnt/β-catenin pathway.

Figure 6. TP repressed ISO-induced CF proliferation and differentiation by suppressing the Wnt/β-catenin pathway in vitro. CFs were treated with ISO for 24 h to establish an in vitro MF model. Rats were then treated with 10 μg/L TP. (A) Immunofluorescence for vementin-positive CF detection; (B) MTT assay for cell proliferation viability assessment of CFs; (C) Immunofluorescence for α-SMA level determination; and (D) Western blot for β-catenin, c-myc, and Cyclin D1 protein level measurement in CFs. The cell experiments were repeated 3 times for each group. Data were expressed as mean ± standard deviation. One-way ANOVA was adopted for intergroup comparisons, and Tukey’s multiple comparison test for post hoc tests. **p < .01 and ***p < .001.

Discussion

MF is initially a feature of cardiac remodeling which poses risks on patients over time and consequently leads to function impairment, morbidity and even mortality [24]. TP could exert potent pharmacological effects against fibrosis [25]. This study for the first time demonstrated that TP protects against MF by repressing the Wnt/β-catenin pathway and that TP suppresses the proliferation and differentiation of myocardial fibroblasts by curbing the Wnt/β-catenin pathway.

Cardiac function is impaired during MF [26]. TP has been demonstrated to improve left ventricular function in diabetic cardiomyopathy [27]. To investigate whether TP relieved ISO-induced impairment of cardiac function, MF rats were treated with different doses of TP. LVEF, LVEDD, LVESD, LVFS and E/A ratio are parameters of cardiac function [28,29]. Our study showed that levels of LVEDD and LVESD were increased while levels of LVEF, LVFS and E/A ratio were decreased in rats after ISO treatment. And TP treatment reduced levels of LVEDD and LVESD and elevated levels of LVEF, LVFS and E/A ratio in MF rats in a dose-dependent manner. TP improves cardiac function and ameliorates pathological alterations in diabetic cardiomyopathy [13]. In our study, TP partially ameliorated the impairment of cardiac function induced by ISO.

Fibrosis is usually described in terms of CVF [30]. In our study, an increased CVF level was observed in MF rats while TP treatment improved cardiomyocyte morphology, and decreased collagen fibers and CVF in MF rats in a dose-dependent manner. Col I and Col III are two major components of the extracellular matrix in the heart and are considered as fibrotic markers in fibroblasts [31]. TP treatment reduced the number of Col-I and Col-III-positive cells and mRNA transcription level in the myocardial tissues of MF rats in a dose-dependent manner. HYP also serves as a marker of fibrosis [32]. Our study showed that the increased HYP content in MF rats was reduced after TP treatment in a dose-dependent manner. TP treatment has been reported to exert an anti-fibrotic effect in pressure overloaded heart in a rat model [11]. Consistent with the previous study, we illustrated that TP alleviated MF induced by ISO in rats.

CFs are the sources of myofibroblasts in fibrotic hearts and may be induced to differentiate into myofibroblasts and contribute to MF under exposure to increased mechanical stress [33]. We herein studied the effect of TP in CF proliferation and the differentiation of CFs into myofibroblasts. Vimentin is often used to identify CFs and α-SMA distinguishes myofibroblasts from other cells [34]. Our study showed that the increased positive cells of Vimentin and α-SMA and mRNA levels of Vimentin and α-SMA in MF rats were reduced after TP treatment in a dose-dependent manner. According to the research of Pan et al. TP represses MF differentiation of CFs [12]. Similarly, our study showed that TP inhibited CF proliferation and differentiation into myofibroblasts.

It has been documented that Guanxin V exerts prominent anti-fibrosis and anti-apoptosis effects on ventricular remodeling via TGF-β1 and Caspase-3 [35]. Guanxin V attenuates fibrosis, apoptosis, and oxidative stress damage via modulation of the TGF-β1 pathway [6]. TP demonstrates a beneficial anti-fibrogenic effect in a blood pressure-independent manner [11]. TP manifests suppressive effects on NLRP3 inflammasome activation, and leads to an improvement in MF in rats through the inhibition of the NF-κB pathway [36]. TP disrupts NLRP3 inflammasome activation, thus mitigating cardiac fibrosis [12]. The Wnt/β-catenin pathway exerts an important effect on myocardial infarction injury in adults, and its suppression ameliorates cardiac remodeling after myocardial infarction [37]. The abnormal activation of the Wnt/β-catenin pathway is closely associated with MF progression [17]. Our result showed that TP treatment downregulated the expression of β-catenin, c-myc and Cyclin D1 in a dose-dependent manner. TP has been reported to inhibit the Wnt/β-catenin signaling pathway in rats with cerebral ischemia/reperfusion injury [38]. Consistently, TP inhibited the activation of the Wnt/β-catenin signaling pathway in MF rats. Furthermore, MF rats were treated with Wnt specific agonist BML-284 and H-TP. The result showed that BML-284 partially repressed the inhibitory effect of TP on the Wnt/β-catenin signaling pathway and upregulated the protein levels of β-catenin, c-myc and Cyclin D1. Meanwhile, MF rats exhibited cellular morphological changes and increases in collagen fibers, CVF, HYP and numbers of Col-I, Col-III, Vimentin and α-SMA positive cells and mRNA transcription levels. BML-284, an agonist of the Wnt/β-catenin signaling pathway, reverses the downregulation of the Wnt/β-catenin signaling pathway and significantly increases collagen deposition in airway epithelium [19]. Up to date, few studies have been conducted on the effects of Wnt agonists on myocardial infarction or MF. In the present study, we found that the Wnt agonist BML-284 antagonized the protective effect of TP against MF by activating the Wnt/β-catenin signaling pathway, which further confirmed that the Wnt/β-catenin pathway served as a therapeutic target for MF. The Wnt/β-catenin pathway has been documented to facilitate fibroblast proliferation and to promote the differentiation of CFs into myofibroblasts during cardiac fibrosis [14]. Our in vitro experiments further verified that TP inhibited ISO-induced cell proliferation and differentiation of CFs by repressing the Wnt/β-catenin signaling pathway.

To summarize, this study revealed that TP improved MF in rats via the Wnt/β-catenin signaling pathway, and thus provided a theoretical foundation to the pathogenesis and new drug development of MF.

Despite the innovation, the study has certain restrictions due to limited conditions. Firstly, the effect of TP on cardiomyocytes was not explored at the cellular level. Secondly, the effect of TP on the proliferation and apoptosis of myocardial fibrotic cells via the Wnt/β-catenin signaling pathway was not studied separately. Additionally, future studies should focus on verifying the therapeutic effect and functional mechanism of TP in MF from the cellular level to the individual level through multiple pathways and targets.

Ethics statement

The study was conducted in compliance with the recommendations of the Ethics Committee of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine (approval number: 2022094). Significant efforts were made to minimize animals used and their sufferings.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

All data generated or analysed during this study are included in this article. Further enquiries can be directed to the corresponding author.

Additional information

Funding

No funding was used in this study.