Glimpse into phytopathogenic fungal species in Al Baha Province, Saudi Arabia; identification from molecular and morphological characteristics

Abstract

Fungal agents form the principal disease-inducing pathogens affecting plants, being accountable for the majority of damage to crops occurring either in fields or in storage. Five genera and 8 species were recognized amongst 20 fungal isolates collected during this study. These were identified through molecular markers; 80% of the recognized species were Aspergillus; the remainder included B. prieskaensis, F. oxysporum, G. candidum and Actinomucor elegans. The majority of these genera are well-recognized for their ability to produce mycotoxins. The biological activity and virulence of fungi is notably impacted by environmental conditions, especially temperature and water. For the isolates investigated in the current research, 75% showed a growth preference for a temperature of 30°C; the remainder favoured 25°C. These data not only facilitate the recognition of species with phytopathogenic and mycotoxigenic properties, but also contribute to the design of regulatory strategies that will mitigate against the adverse effects of fungal infection.

KEYWORDS:

• Al-Baha province
• fungal plant pathogen
• mycotoxigenic species
• optimal growth temperature
• ITS rDNA molecular identification
• pre and post-harvest infestation

1. Introduction

The varied geological topography within the Kingdom of Saudi Arabia (KSA), together with its mostly desert climate, leads to an opulent and diverse flora [1]. It has been gauged that there are approximately 2300 plant species comprising members of 142 families [2,3].

Situated in the south-west part of KSA, the Albaha province includes six principal municipalities, i.e. the capital, Albaha, and Alaqiq, Almandaq, Almikhwah, Baljurashi and Qilwah [4]. The province has a diverse ecological topology, which is characterized by different types of forest, mountains, valleys and regions containing wildlife. Approximately 230 plant species, i.e. members of 228 genera and 75 families, are believed to exist in the Albaha province; these include a broad spectrum of fruits, vegetables, grains and plants utilized for medicinal purposes [5]. A number of farming techniques have long been native to the Albaha area which are directed towards both naturally arising and cultivated vegetation [3].

Humans are becoming increasingly concerned regarding the effects of global warming. The latter are impacting animals, as well as annual crop productivity; this is arising as a consequence of the increased virulence of invasive disease-inducing microbes. In the region of 40% of failed crops are considered to be the result of pathogens worldwide; the latter are therefore a notable element of consternation in the agricultural sector and in relation to the safety of foods [6,7].

The marked destructive consequences of plant infection by fungi means that these organisms are considered to be the second leading cause of disease in vegetation, with approximately half of the loss of yearly maize yields being attributed to their effects [8]. In addition to diminishing crop productivity, toxins synthesized by fungi, known as mycotoxins, taint the plants. These can be detrimental to both humans and animals, potentially, as proposed by the International Agency for Research, having the ability to induce malignancy [9]. The Food and Agriculture Organization has indicated that approximately half of global annual crops are affected by mycotoxins [8].

A number of nations are planning to stop using pesticides and fungicides owing to their negative effects on humans and animals, and on insects that are advantageous to crops, a move which has made the requisite to identify approaches in order to regulate and to combat pests and fungi more pressing [6,10]. Sweden, Canada and Indonesia are amongst countries that have used environmentally friendly strategies as alternatives, using extracts from plants together with biological and environmental regulants in order to circumvent infection by phytopathogenic organisms [11,12].

The biological effects of invasive fungi can be promoted by the characteristics of the environment. It is therefore of value to recognize settings which are hostile to the disease-inducing agents, and to extrapolate that information to the control of pathogens in field and greenhouse crops, and for those being stored [13,14]. The elements with the most effect are temperature and water availability; these notably influence fungal biological traits, e.g. growth, sporulation and mycotoxins formation, and also, the immune system of plants. A range of temperatures are favourable depending on the fungal species; the most apposite temperature favours sporulation, the growth of mycelia, and the infection and colonization of their targeted host [15,16]. Different temperatures may not only be most optimal for diverse species, but also for varied strains from the identical species. For instance, Hope et al. [17] demonstrated a variance of 10°C in the most apposite growth temperature for two Fusarium culmorum species extracted from maize cultivated in various geographical areas. Recognizing the most favourable temperature for the biological activity of fungi facilitates the establishment of the best method to regulate infection [13,14,18].

The use of molecular mechanisms for the recognition of de novo species of fungi has been shown to have improved precision compared to the use of their morphological traits. Such molecular identification methods depend on the diversity of bands seen on gel electrophoresis or in novel sequence engineering relevant to BLAST analysis in order to establish any likeness between sequences from species that are accessible via gene banks, e.g. UNITE and the National Centre for Biotechnology Information (NCBI) [19].

The internal transcribed spacer (ITS) marker for the recognition of specific species of fungi is considered to be the most valuable and widely used [20]. The focus on this particular indicator has arisen because it contains a conserved locus which is present in the genetic material of practically all fungi; the PCR fragment size dimension lies within the spectrum 400–600 bp [21,22]. Although during 2012, in excess of 175,000 lengths of ITS sequences were documented in the gene banks, reflecting more than 15,000 species of fungi [23], the accessible data stored by 2017 were only representative of under 1% of the 5.1 million known fungi [19].

In order to recognize and to define a de novo species of fungus from an ITS marker-developed sequence, there is a consensus amongst academics that there should be above 96% for sequence homology present [24]. Current studies have given considerable attention to using the ITS indicator in order to describe regional types of fungus, together with the association of the phylogenetic origin with the isolates from the reference sequences. Furthermore, identifying the best growth temperature for each isolate has been emphasized in order to provide information to support regulatory approaches.

2. Materials and methods

2.1. Sampling procedure

For the current study, 20 agricultural spots in the environs of the cities of Al Baha and Al Aqiq were selected for sampling after having obtained the owner’s permission. On each stage, up to 10 samples of infested crops were collected, in order to confirm that the major fungal pathogen that affect crops production and distribution. Thus the collection procedure had focused to avoid mistakenly collecting transient isolates (e.g. attached to the crop surface or the soil or brought on the wind). The capital city of Albaha Province, Albaha, is situated at 41/42E and 16/21N longitude and latitude, respectively, and lies 2400 m above sea level [4]. The coordinates of Al Aqiq located at northwest of Al baha Province (41° 38′ 35′′ East and 20° 17′ 41′′ North) and 600 m above sea level (Figure 1) [25].

Figure 1. Represents the map of Al Baha province, includes six principal municipalities. The 20 phytopathogenic fungi used in this work, were collected form two cities Albaha and Alaqiq. Eleven samples collected from Albaha city and nine samples from Alaqiq city.

2.2. Isolation of fungi and pure culture preparation

Isolation of the fungi from the plants’ surfaces was conducted in a sterile manner. A potato dextrose agar (PDA) medium was used for the culture and subculture of the specimens in order to identify the major fungal pathogen in each sample based on the overall common shape of conidia and colony characteristics across samples [26]. From all of the samples collected, one was selected as the causal agent for each collection spot to be used for the experiments in this study. Subsequently a stock culture of the 20 de novo isolates, were synthesized and placed in storage at the Al Baha University bank of stock cultures (Table 1).

Table 1. The background information for the new sample’s sequences along with culture collection code of Al BahaUniversity and their NCBI accession.

N	Fungal species	Origin	Host	Code	Accession number
1	Aspergillus niger	Albaha	Cuminum cyminum	BHU019	ON845450
2	Aspergillus quadrilineatus	Albaha	Punica granatum	BHU026	ON845536
3	Aspergillus tubingensis	Albaha	Ficus carica	BHU032	ON843626
4	Geotrichum candidum	Albaha	Punica granatum	BHU074A	ON868706
5	Actinomucor elegans	Albaha	Citrus limon	BHU030	ON834321
6	Fusarium oxysporum	Albaha	Prunus persica	BHU007	ON845734
7	Bipolaris prieskaensis	Albaha	Malus domestica	BHU001	ON845652
8	Aspergillus niger	Albaha	Rumex nervosus	BHU022	ON866738
9	Aspergillus tubingensis	Albaha	Punica granatum	BHU021	ON847317
10	Aspergillus niger	Albaha	Prunus armeniaca	BHU018	ON866737
11	Aspergillus niger	Albaha	Citrullus colocynthis	BHU014	ON834317
12	Aspergillus niger	Alaqiq	Ocimum basilicum	BHU024	ON840101
13	Aspergillus niger	Alaqiq	Ficus malacocarpa	BHU028	ON890787
14	Aspergillus quadrilineatus	Alaqiq	Citrus limon	BHU010	ON845447
15	Aspergillus tubingensis	Alaqiq	Malus domestica	BHU015	ON845449
16	Aspergillus sydowii	Alaqiq	Orchidaceae	BHU004	ON845730
17	Aspergillus niger	Alaqiq	Jasminum officinale	BHU003	ON845728
18	Aspergillus niger	Alaqiq	Olea europaea	BHU008	ON867006
19	Aspergillus niger	Alaqiq	Punica granatum	BHU020	ON845735
20	Aspergillus niger	Alaqiq	Phoenix dactylifera	BHU023	ON845808

2.3. DNA extraction

In order to attain a greater DNA harvest, the colonial mycelium was first subcultured in a potato dextrose broth (PDB) medium. The tissue was ground into a powder utilizing liquid nitrogen, and a pestle and mortar. For the extraction of the DNA, 150–200 mg of the powder was added to a 2 ml Eppendorf tube and then the protocol accompanying the Thermo scientific GeneJET Plant Genomic DNA Purification Kit was followed. The DNA was placed in storage at a temperature of −20°C until required.

2.4. Molecular identification and phylogenetic tree

The 20 and 50 µl PCR reactions were established utilizing forward and reverse primers, i.e. ITS1: TCCGTAGGTGAACCTGCGG and ITS4: TCCTCCGCTTATTGATATGC, respectively [20]. The PCR conditions employed were: 35× cycles, a temperature of 95 °C for 3 min for the initial denaturation, followed by further denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1 min, and the final extension at 72°C for 5 min. The DNA was ultimately stored at a temperature of 16°C for an undefined period.

The constituents for the 50 µl PCR reaction comprised 2.5 µl DNA, 2.5 µl 20 µM forward primer, 2.5 µl 20 µM reverse primer, 5 µl 10× reaction buffer, 1 µl dNTPs, 3 µl MgCl₂ and 0.25 µl Taq DNA polymerase; these were made up to 50 µl with free DNAase and RNAase water. The quantities of these components were modified for use in the 20 µl reaction. Similar PCR constituents and quantities were employed to make up the negative control sample, but free DNAase and RNAase water were used as a substitute for the genetic material.

Once the PCR cycles were finished, and before the specimens were loaded onto the gel, 5 aliquots of loading dye were admixed with the PCR products. 1 mg of agarose power was made up to a solution in 100 ml of 1× TAE buffer and placed for 2 min in a microwave oven. Following the addition of 5 µl 10 mg/ml ethidium bromide solution, the admixture was decanted onto a gel tray in order to cool and to become solid. The tray was inserted into a gel electrophoresis tank containing 1× TAE buffer; this was connected to 90 V power for a period of 1 h [27,28].

The kite protocol was employed in order to purify the amplicons products, using the Qiagen QIAquick PCR Purification Kit; these were then transported to an external service facility (Macrogen Inc.) who performed sequencing; the presented sequencing output was provided in the form of trace data. On receipt, the sequence dimensions and standards were confirmed and bases that appeared ambiguous were eliminated. The trace data were transformed into the FAST format with the use of Bioedted software for subsequent interpretation by BLAST analysis on NCBI or UNITE in order to identify the species [19].

Any sequences that demonstrated a similarity in excess of 96% in the gene banks underwent downloading and were subsequently utilized as reference sequences for the phylogenetic research (Table 2) [24]. Many sequence alignments were obtained from both the initial and benchmark sequences and used to construct a phylogenetic tree; this was achieved using the Geneious Prime software, version 2022.2 (Biomatters) (Figure 2). The MUSCLE alignment instrument from this package was utilized in order to align the numerous sequences, and the tree builder algorithm was employed to generate a phylogenetic tree, using techniques founded on distance tree and neighbour joining. The genetic distance of the tree was acquired by exploiting the Tamura-Nei model; in order to achieve a consensus phylogenetic tree, a bootstrap supporting value (BSV) was generated within the range 70–100%. In order to attain the best fit for the consensus phylogenetic tree, a general time reversible evolutionary model including 500 bootstrap replications was established [29,30].

Figure 2. Neighbour-joining consensus tree constructed in accordance with the ITS genetic markers. The legends follow the accession number represent an abbreviation of species name.

Table 2. Represent the reference sequence isolates from NCBI.

N	Fungal species	Origin	Host	Code	accession number
1	Fusarium oxysporum	Turkey Antakya	Allium cepa	OLAM3	MT967273
2	Aspergillus niger	Pakistan Rawalpindi	Prunus persica	ASN1	ON241768
3	Bipolaris prieskaensis	Iran Karaj	Quercus	32R2	KY950237
4	Aspergillus tubingensis	China lanzhou	Stipa purpurea	ZMXR36	MT446141
5	Aspergillus niger	Turkey Kocaeli	Lens culinaris	MRC200804	MF078659
6	Actinomucor elegans	China Gansu	Avena sativa	AS14	MT503300
7	Geotrichum candidum	China Beijing	Prunus persica	BD01	MW493646
8	Aspergillus tubingensis	South Korea Gyeongsang	Vitis vinifera	AS181	LC467944
9	Aspergillus niger	China Changchun	Sorghum bicolor	J7	KF059971
10	Aspergillus quadrilineatus	Thailand Bangkok	Salvia hispanica	KU20018.62	MT487836
11	Aspergillus niger	Singapore Temasek	Jatropha curcas	SG1	MH091026
12	Aspergillus niger	Qatar Doha	Cuminum cyminum	Cumin 1	KF221069
13	Aspergillus tubingensis	China lanzhou	Stipa purpurea	ZMQR21	MT446102
14	Aspergillus sydowii	China Hainan	cymbidium insigne rolfe	W4-2	HQ889716
15	Aspergillus niger	China Hainan	Cephalotaxus hainanensis	G94	KJ612087
16	Aspergillus niger	China Anhui	Camellia sinensis	SPZS49	KY607770

The 20 sequences engineered for this study were introduced to the NCBI gene bank, and unique accession identifiers were released for the individual isolates (Table 1). The uploading procedure for the individual sequences in NCBI was commenced once the standard of the sequence and amount had been confirmed, finally the appropriate data relating to each sequence file deposited was filed.

2.5. Growth evaluation at three temperatures points

The 20 isolates were each cultured at three temperatures, i.e. 20°C, 25°C and 30°C in order to confirm the temperature most apposite for the growth of each sample. The study utilized 9 cm petri dishes for both cultures and subcultures and 5 mm discs containing inoculum from the edge of the original dishes were added to the centre of fresh petri dishes. At each of the three individual temperatures, each isolate comprised 5 replicates, which were maintained in an incubator for a period of 6 days. Beyond this period the majority of fast growth isolates would fill the 9 cm petri dishes meaning the growth rate could not be measured and compared. After which growth measurements for the individual replicates were obtained in the radial direction (Figure 3). These are presented in the form of a bar chart; the variation between replicates is indicated by error bars [15,16,18].

Figure 3. The maximum growth rates observed at temperatures of 20°C, 25°C and 30°C for each isolate obtained from the regions of Albaha and Alaqiq. This chart indicates the optimum temperature for 15 out of 20 isolates at 30°C, while the remaining five isolates (BHU014, BHU032, BHU019, BHU003 and BHU020) at 25°C. In other hand none of isolates scored 20°C as their optimum temperature for growth.

3. Results and discussion

3.1. Molecular identification and phylogenetic analysis using ITS region

For all 36 isolates, i.e. 20 original and 16 reference isolates, the ITS end-trimmed sequence length was in the region of 450 bp; these data reflected the presence of 5 genera and 8 species. The isolates were categorized by the neighbour joining tree into four principal nodes, i.e. 1, 2, 3 and 4, with 100% BSV (Figure 2). A polyphyletic group containing two taxa which were members of the F. oxysporum species were indicated by node 1; node 2 was representative of the monophyletic group of two taxa of the species, B. prieskaensis. Node 3 comprised two clades, i.e. A and B. Clade A was subdivided into a further 3 groups, A1, A2 and A3, for which the BSV lay within the range, 97.4–100%. The isolate, A. quadrilineatus was reflected by A1 as an outgroup; A2 and A3 each contained two taxa, which were members of A. sydowii and A. quadrilineatus species, respectively. Clade B contained two cohorts, i.e. B1 and B2, which had BSV within the spectrum 71.8–100%. Two taxa relating to the species A. niger comprised B1. B2 contained the most species, including 23 taxa distributed over a single cluster, B2.1, which included 11 taxa from A. niger, A. tubingensis and Actinomucor elegans, and two further subgroups, B2.2 and B2.3. The former included taxa from A. tubingensis; the three taxa in B2.3 were members of A. niger species (Figure 2).

During this research, the molecular identification process has described the species of the de novo isolates with a precision rate within the range 97–99.99% in keeping with NCBI and UNITE Blast analysis. The evolutionary associations between the 36 isolates are indicated by the phylogenetic tree topology (Figure 2); these are related to 8 species and 5 genera, and reflect a spectrum of hosts and geographical regions.

Although the ITS markers have enabled the interspecies differentiation of isolates, the process has a lower degree of efficacy for intraspecies discrimination, e.g. specific cohorts containing isolates from the species, F. oxysporum, B. prieskaensis, A. quadrilineatus, A. sydowii and G. candidum, were created, implying that these had a smaller level of genetic heterogeneity. Comparatively, for isolates from the identical species, e.g. A. niger (subgroup B2.3) and A. tubingensis (cluster B2/subgroup B2.2), a degree of intraspecies diversity was noted.

The above observations highlight what has been discussed previously by several authors, i.e. that ITS markers have a greater efficacy for distinction between species than within a species. This restriction of ITS markers for intraspecies differentiation has been noted in the majority of papers, e.g. for species including Fusarium and Penicillium [31–34]. The ITS markers have only been shown to be accurate for both inter- and intraspecies distinction in a small selection of fungi, e.g. several spp. of Alternia and Aspergillus [35–38].

3.2. Optimal growth temperature

The findings relating to the growth of the 20 isolates collected from Albaha and Alaqiq demonstrate a diverse rate of growth over 8 species.

For 10 isolates, which were members of the A. niger species, i.e. BHU023, BHU020, BHU008, BHU003, BHU024, BHU028, BHU022, BHU018, BHU014 and BHU019, the measured growth rates were 8.5–12.1 mm, 9.5–14.1 mm and 10.1–14 mm at 20°C, 25°C and 30° C, respectively.

For single isolates from G. candidum, i.e. BHU074A, the documented rates of growth were 9.3–11.6 mm, 10.1–11.5 mm and 11.6–13.1 mm at 20°C, 25°C and 30°C, respectively. The respective equivalent growth rates for these temperatures for a further single isolate, BHU004 which was a member of the species, A. sydowwi, were 7–8.6 mm, 8.5–10.8 mm and 9.6–10.1 mm at 20°C, 25°C and 30°C respectivley.

In order at 20°C, 25°C and 30°C, the rates of growth of two isolates from the A. quadrilineatus species, i.e. BHU010 and BHU026, were observed to be 9.4 -10.4 mm, 10.9–13 mm and 12.6–13.8 mm, respectively. At the same range of temperatures, a single isolate from B. prieskaensis, i.e. BHU001, demonstrated respective growth rates of 9.5–10.3 mm, 10.6–11.5 mm and 11.6–13.1 mm. For a lone isolate, BHU007, belonging to F. oxysporum, the equivalent growth rates for the three different temperatures were 9.9–10.6 mm, 9.3–11.5 mm and 12–13.5 mm. The A. tubingensis isolates, BHU015 and BHU021, had documented rates of growth of 8.5–9 mm at 20°C, 10.7–11.7 mm at 25°C and 12.1–13.4 at 30°C. The equivalent growth rate data for the three temperatures for a further isolate, BHU030, from the species Actinomucor elegans, were 6.8–8.3 mm at 20°C, 8.5–10.1 mm at 25°C and 10.1–11.3 mm at 30°C (Figure 3)

The data relating to the rates of growth for the different isolates have demonstrated that 75% (15/20) favoured a growing temperature of 30°C whilst the growth rate of the other 25% was enhanced at 25°C. The lower temperature of 20°C did not lead to optimal growth of any of the investigated isolates. A higher degree of interspecies rather than intraspecies heterogeneity in relation to the growth rates was observed.

Thus, in terms of growth, the majority of the studied isolates preferred medium to high temperatures; this is in keeping with the main temperatures recorded in the geographical regions included in the study. Conversely, fungal isolates derived from cooler European areas have been noted to demonstrate preferential growth in cold to moderate temperatures. For instance, isolates from the species, Fusarium, which were obtained from a range of European loci, exhibited a favoured temperature for growth of between 15°C and 25°C [17,39]. The fungal species, P. camemberti, P. roqueforti and A. alternata prefer a temperature of 25°C [40,41]. Warmer temperatures in the range 30°C to 35°C are favoured by a number of Aspergillus species, including A. flavus and A. niger [35,37]. Under certain levels of fungal growth, on their favourable host and at favourable environmental conditions (e.g. temperature and water activity), mycotoxigenic species can vary in their mycotoxin production [42]. Mycotoxin formation on agricultural crops can occur at various stages of the food chain, i.e. pre- or post-harvest as well as due to improper storage conditions [43]. For example, in warm and wet conditions toxigenic Aspergillus species such as A. flavus and A. niger have been found to grow and secrete aflatoxin on various edible commodities such as coffee, nuts, grapes, rice, maize and dried fruits [44].

4. Conclusion and future perspectives

The current research has drawn attention to the fact that the principal fungal species affecting fruit and vegetable crops is Aspergillus, which comprised 80% of the 20 isolates obtained from the various fields stages in the environs of Albaha and Alaqiq metropolises. The other 20% of isolates included the species, B. prieskaensis, F. oxysporum, G. candidum and Actinomucor elegans. When the isolates were analysed with respect to their site of origin, species of Aspergillus were found in 63.6% and 100% of specimens gathered from Albaha (11 isolates) and Alaqiq (9 isolates), respectively; of these, 57.1% from the former location and 66.6% from the latter were identified as A. niger.

Therefore, Aspergillus species widely recognized as one of the most abundant mycotoxigenic agents [45]. The recognition that the majority prefer a moderate to a high temperature for growth, i.e. between 25°C and 30°C, will facilitate the development of an approach to alleviate their adverse effects prior to and following crop harvesting [29].

Future study would focus on assessing the mycotoxin production of the potential mycotoxigenic species identified in this work under their favoured growth temperature and at 99 aw water activity by using the appropriate mycotoxin-inducing medium.

Acknowledgements

I would like to thank my family, colleagues and Al Baha University for using their facilities and their partially funding my project. Award Number (29/1442).

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This work was supported by Al Baha University [grant number 29/1442].