Ameliorative impacts of Rhodiola rosea against hepatic toxicity induced by monosodium glutamate: role of inflammation-, oxidative-stress-, and apoptosis-associated markers

Abstract

Current study examined the protective impact of Rhodiola rosea (R. rosea) extract on hepatic toxicity markers caused by MSG. MSG induced significant increases in hepatic stress biomarkers. There were significant declines in GSH, catalase and SOD levels, which were accompanied by substantial elevations in IL-1β, IL-6, and TNF-α. There was hepatic cellular damage, and upregulation of caspase-3 and a decrease in Bcl-2 expression. The hepatotoxic impacts of MSG were normalized by Rhodiola supplementation. R. rosea downregulated caspase-3 and upregulated HO-1 and Nrf2 mRNA expression. R. rosea regulated the immunoreactivity of COX-2, TGF-β1, and NFkB genes associated with hepatic toxicity. R. rosea extract normalized histopathological changes induced by MSG and restored hepatic architecture. R. rosea extract exhibited anti-apoptotic, antioxidant, and anti-inflammatory properties. In conclusion, R. rosea extract is a promising medication against hepatic toxicity induced by MSG, which works by regulating the different signaling pathways of inflammation-, oxidative-stress-, and apoptosis-associated markers.

KEYWORDS:

• Rhodiola rosea
• liver dysfunction
• monosodium glutamate
• apoptosis
• antioxidant
• Nrf2 and HO-1 expression

1. Introduction

The liver is a vital organ that performs numerous functions, such as supplying glucose, plasma proteins, and bile [1]. Several toxic compounds may affect the liver, and alternative therapies should be considered that recognize the pathophysiological processes that cause liver damage. Free radical damage and oxidative components in cells (lipids, proteins, and nucleic acids) cause an imbalance between reactive oxygen species (ROS) formation and antioxidant production [2]. Natural antioxidants boost the body's performance in stressful circumstances. Natural medicines have been utilized for centuries to treat various ailments [3]. Industrial toxins and food additives are harmful synthetic contaminants, and some food additives are used to preserve or enhance the flavour of food.

Monosodium glutamate (MSG) is considered the most prevalent flavouring ingredient and food additive [4]. MSG plays roles in various liver diseases when used in excess amounts [5]. Glutamate is an excitatory neurotransmitter in the brain that mediates rapid synaptic transmission [6]. The liver processes glutamate and the kidneys help to remove it [7]. In the intestine, glutamic acid is converted to alanine, while in the liver it is converted to lactate. It is absorbed from the intestine through active transport systems that are associated with amino acids [5]. MSG enhances the taste of food, which boosts the hunger centre and causes weight gain [6]. MSG increases appetite, enhances flavour, and is harmful to humans and other animals when used in high doses [2]. Gonadal dysfunction, brain damage, stomach cancer, and depletion of certain neurotransmitters in the hypothalamus have all been recorded in rats given MSG [3]. Toxic effects on the liver and kidneys have been linked to excessive MSG usage [4], which causes degenerative alterations in hepatic and renal cells, and oxidative stress [5]. Therefore, we must search for a natural supplement, such as R. rosea, to counteract MSG's oxidative and inflammatory processes in hepatic tissues.

Rhodiola rosea (R. rosea, or roseroot) is a plant from the Crassulaceae family and is widely used as a botanical adaptogen because of its anti-diabetic, anti-cancer, anti-aging, cardioprotective, and neuroprotective properties [8]. Rhodiola species have been shown to contain more than 140 chemicals, such as flavones, coumarins, anthraquinone, and organic acids [9]. The particular components of R. rosea L. are called rosavins (rosavin, rosin, and rosarin) [10]. Rosavine (cinnamic alcohol vicyanoside), rosine, rosarine, and hydroxyphenyl-ethanol-2-D-glucopyranoside (salidroside) are the primary components dictating the phytochemical and pharmacological features of R. rosea. Salidroside is present in all plants of the Rhodiola family [11]. It was shown that R. rosea has anti-inflammatory and anti-apoptotic properties that could protect against ischaemia-reperfusion injury [12]. R. rosea may exhibit anti-oxidative-stress and antioxidant properties, and it has the potential to treat Parkinson's and Alzheimer's diseases [13].

Therefore, in the present study, we aimed to investigate the biochemical, genetic, and histopathological alteration induced by MSG in the liver by searching the signalling pathways associated with inflammation-, oxidative-stress- and apoptosis-associated markers. The results of the current study confirm a novel protective pathway for Rhodiola rosea extract against hepatic toxicity at the biochemical, molecular, and cellular levels.

2. Materials and methods

2.1 Reagents, chemicals, and kits

Qiazol was imported from QIAGEN (USA). Catalase, reduced glutathione (GSH), superoxide dismutase (SOD), and malondialdehyde (MDA) kits were purchased from Biodiagnostic Co. (Dokki, Egypt). The kits for rat interleukin-1β (IL-1β, ab255730), rat-TNF-α (ab100785), and IL-6 (ab234570) were obtained from Abcam Co. (Japan). Monosodium glutamate was obtained from PubChem, Bethesda, USA. Isoflurane was obtained from Sigma Aldrich, Memphis, USA. Rhodiola rosea root was purchased from Sigma Aldrich.

2.2. Experimental animals and design

The current study was approved by the Deanship of Scientific Research of Taif University under ethical code 42-0081. Experimental 2-month-old male Wistar rats, weighing 175 grams, were purchased from King Fahd Institute, Saudi Arabia. Thirty-two experimental male rats were used for the current study. To adapt rats for treatment and to avoid stress, rats were manually handled for seven days. The experimental rats were divided into 4 groups: Group 1: control without treatment; Group 2: orally administered R. rosea (400 mg/kg bw) [14] for 10 days; Group 3: positive monosodium glutamate (MSG) group, administered MSG orally at 4 g/kg for 10 consecutive days [15]; Group 4: protective group, received both R. rosea and MSG for ten days as above in the R. rosea and MSG groups. The dose of MSG used was the optimum required to cause hepatic toxicity without animal death, as stated in other papers [14], while the dose of R. rosea was the optimum required to induce hepatic protection without cytotoxic effects [15]. The collective scheme is presented in Figure 1.

Figure 1. Schematic graph for the experimental protocol used in this study.

After completion of the experiment, rats were anesthetized. Blood was taken from retro-orbital venous plexuses. Rats were then decapitated for tissue sampling. Serum extraction was performed on clotted blood samples after isoflurane inhalation (2.5–3%) [16] and centrifugation at 5000 revolutions per minute (rpm) for 6 min. Samples were kept at −30°C until used for biochemical assessments. Each liver tissue was preserved either in Qiazol for RNA extraction for future gene expression or in 10% neutral formalin for histopathology and immunohistochemistry.

2.3. Hepatic biomarker, cytokine, and antioxidant measurement

Hepatic function biomarkers were assayed using kits imported from Bidiagnostic Company, Giza Egypt. Hepatic markers such as ALT (alanine transaminase), AST (aspartate transaminase), and GGT (gamma glutaryl transaminase) were measured spectrophotometrically as stated in the instruction manual supplied with each kit. Total proteins were assessed following the method described by Lowry et al. [17]. For antioxidant biomarker measurements, MDA (malondialdehyde) was estimated as previously stated [18]. Catalase, GSH (reduced glutathione), and SOD (superoxide dismutase) activities were estimated based on previously published reports [19–21]. IL1β, IL-6, and TNF-α were assessed as described in the manual of each supplied kit, as previously described [22].

2.4. Quantitative real-time PCR and gene analysis

RNA was extracted from liver samples. Extracted pellets of RNAs were dissolved in diethyl pyrocarbonate (DEPC) water. RNA concentration was measured at 260/280 OD. Complementary DNA (cDNA) was created using the Multi-Scribe RT-enzyme kit. Real-time PCR analysis reactions were performed using Power SYBR Green PCR Master Mix and a 7500 Real-Time PCR System. The primers and names of examined genes are shown in Table 1. Expression of β-actin mRNA was used as a reference to quantify the examined genes densitometrically. These genes were quantified using the ^2−ΔΔCT method. The standard internal gene β-actin was used to normalize examined genes. Changes in gene intensity were analysed using the comparative cycle threshold (CT) values.

Table 1. Primers used for quantitative real-time PCR (qRT-PCR) in rat liver.

Gene	Product size (bp)	Direction	Primer Sequence	Accession number
Nrf2	140 bp	Sense	CGCCTGGGTTCAGTGACTCG	NM_010902.4
		Antisense	AGCACTGTGCCCTTGAGCTG
HO-1	126 bp	Sense	CGCCTCCAGAGTTTCCGCAT	NM_010442.2
		Antisense	GACGCTCCATCACCGGACTG
Bcl-2	153bp	Sense	AGCCTGAGAGCAACCCAAT	NM_009741
		Antisense	AGCGACGAGAGAAGTCATCC
Caspase-3	147bp	Sense	ACATGGGAGCAAGTCAGTGG	NM_009810
		Antisense	CGTCCACATCCGTACCAGAG
β-actin	140 bp	Sense	CCAGCCTTCCTTCTTGGGTA	NM_007393.5
		Antisense	CAATGCCTGGGTACATGGTG

Gene abbreviations are Bcl-2: B-cell lymphoma-2; HO-1: hemeoxygenase-1; Nrf2: nuclear factor erythroid 2-related factor 2.

2.5. Histopathological examination

Each rat liver specimen was collected then fixed in formalin (10%) for 24 h. Thereafter, it was washed and soaked in alcohol, then cleared in xylene. Next, sections were embedded and cast in soft and hard paraffin, respectively, then sectioned. Thick tissue (5 microns) was prepared, stained with H&E stain [23], then examined using a light microscope.

The ratio of the total hepatocytes exhibiting vacuolar and hydropic degeneration and single-cell necrosis to the total number of hepatocytes/images was assessed subjectively. The hepatic areas occupied by central veins, portal blood vessels, and hepatic lipidosis concerning the entire image area were calculated using ImageJ (version 1.51v; Research Services Branch, (NIH), Bethesda, MD, USA). The other recorded lesions in the liver were recorded by calculating the lesion frequency/image.

2.6. Immunohistochemistry examination

Immunohistochemical staining was carried out as discussed previously [24], with slight modifications. Briefly, each tissue was sectioned at 4 µm. Antigen retrievals were performed by boiling for 20 min in citrate-based buffer (Dako solution, pH 6). Non-specific reactions were inhibited using bovine serum albumin (0.2%). The peroxidase activities were deactivated with 3% H2O2. Incubation took place for 60 min with rabbit monoclonal antibodies for TGF-β1 (Abcam; ab215715), NFkB (Abcam; ab32360), and COX2 (ab179800), which were obtained from Abcam, Waltham, MA, 02453, USA. Next, sections were rinsed well and secondary antibodies (Biotinylated Goat anti-Mouse, abcam; ab64257) were incubated for 30 min at room temperature. Next, they were rinsed in phosphate buffer saline (PBS; pH 7.6; 0.01 M). 3, 3-diaminobenzidine-tetrahydrochloride/ml Tris-HCl that contained H₂O₂ (0.01%) as a substrate was used as a chromogen (0.5 mg). Each slide was counter-stained with haematoxylin. Then, sections were rinsed in tap water, dehydrated using alcohol, and mounted in dibutylphthalate polystyrene xylene (DPX). Immunoreactivity was visualized using a light microscope.

The ratio of positively stained cells to the total number of analysed cells was used to calculate the relative proportions of immune reactive cells for COX2, TGF-β1, and NFkB expression. ANOVA tests were used to examine the significance of three slides from each group.

2.7. Statistical analysis

One-way ANOVA and Dunnett's post hoc test were used to analyse the data using SPSS software version 26 (Chicago II, USA). Data are shown as means ± SEM for eight different rats. Mean values with p < 0.05 were significantly different.

3. Results

3.1. Protective impacts of R. rosea against MSG-induced changes in hepatic biomarkers

The MSG-treated group showed significant increases (p < 0.05) in AST, ALT, and GGT and a decrease in total protein levels compared to other treated groups. Oral administration of R. rosea and MSG showed a significant decrease in AST, ALT, and GGT hepatic enzyme levels in addition to significant restoration of total protein compared to the MSG-treated group (Table 2).

Table 2. Protective impacts of R. rosea against MSG-induced changes in hepatic biomarkers.

	AST (U/I)	ALT (U/I)	GGT (U/I)	Total proteins (g/L)
Control	23.1 ± 1.7^a	18.6 ± 0.4 ^a	10.4 ± 0.3^a	5.5 ± 0.2 ^a
R. rosea	23.8 ± 1.8 ^a	16.3 ± 0.3 ^a	9.9 ± 0.4 ^a	4.8 ± 0.3 ^a
MSG	65.3 ± 3.5^b	41.8 ± 1.5^b	21.9 ± 1.1^b	1.9 ± 0.1^b
R. rosea + MSG	41.5 ± 1.3^c	27.3 ± 0.8^ac	16.7 ± 1.4^c	4.0 ± 0.11^ac

Note: Values are means ± SE for 8 different rats. Values with different letters are significant at *p < 0.05 compared to other groups.

3.2. Protective impacts of R. rosea against MSG-induced alterations in antioxidant levels

MSG-induced oxidative stress in rats is shown in Table 3. The data in Table 3 show that MSG-treated rats have higher significant levels (p < 0.05) in serum MDA with a marked decline (p < 0.05) in GSH, catalase, and SOD levels. When MSG was co-administered with R. rosea extract, there was a protective effect. The oral co-administration of R. rosea extract with MSG improved the antioxidant capacity of GSH, SOD, and catalase, with a substantial decrease in MDA levels.

Table 3. Protective impacts of R. rosea against MSG-induced changes on antioxidants levels.

	MDA (nmol/ml)	GSH (nmol/l)	Catalase (U/I)	SOD (U/ml)
Control	19.4 ± 0.7^a	5.1 ± 0.5^a	204.1 ± 13.5^a	3.9 ± 0.2^a
R. rosea	20.1 ± 0.5^a	4.7 ± 0.3^a	196.7 ± 15.3^a	3.8 ± .3 ^a
MSG	54.4 ± 3.1b	2.1 ± 0.1^b	93.4 ± 4.1^b	1.6 ± 0.09^b
R. rosea + MSG	29.1 ± 0.7^c	5.7 ± 4.3^a,c	157.5 ± 4.9^c	2.7 ± 0.06^c

Note: Values are means ± SE for 8 different rats. Values with different letters are significant at *p < 0.05 compared to other groups.

3.3. Impacts of R. rosea against MSG-induced changes in inflammatory cytokine levels

The MSG-treated group showed significant elevations (p < 0.05) in the serum levels of inflammatory cytokines (IL-1β, TNF-α, and IL-6), as shown in Table 4. The co-administration of R. rosea to the MSG group inhibited the increase in inflammation-associated cytokines and significantly decreased the levels of IL-1β, TNF-α, and IL-6 compared with MSG-treated rats (Table 4).

Table 4. Protective impacts of R. rosea against MSG induced alteration in inflammatory cytokines levels.

	IL1β (pg/ml)	IL6 (pg/ml)	TNFα (pg/ml)
Control	109.4 ± 4.9^a	77.1 ± 3.5^a	326.6 ± 14.5^a
R. rosea	102.3 ± 3.6^a	72.7 ± 2.7^a	303.9 ± 15.3^a
MSG	252.3 ± 13.3^b	164.3 ± 2.3 ^b	750.3 ± 35.3^b
R. rosea + MSG	170.5 ± 4.6^c	103.1 ± 3.1^c	439.9 ± 12.4^c

Note: Values are means ± SE for 8 different rats. Values with different letters are significant at *p < 0.05 compared to other groups.

3.4. Protective impacts of R. rosea against MSG-induced alteration in antioxidants and apoptotic genes using quantitative real-time PCR

Next, the expression of oxidative stress biomarkers was examined quantitatively. As shown in Figure 2(A and B), significant downregulation of Nrf2 and HO-1 expression (p < 0.05) was confirmed in MSG-treated rats compared with other groups. When R. rosea was co-administered with MSG, there was significant (p < 0.05) normalization of Nrf2 and HO-1 expression in rats receiving both R. rosea and MSG (Figure 2(A and B)).

Figure 2. Quantification of Nrf2 (A) and HO-1 (B) mRNA in rat hepatic tissues after normalization with beta actin. Values with different letters are significant at *p < 0.05 compared to other groups.

Regarding the expression of apoptotic and antiapoptotic markers, MSG-treated rats showed substantial increases (p < 0.05) in the mRNA expression of caspase-3, with marked downregulation (p < 0.05) of Bcl-2 mRNA expression, as shown in Figure 3(A and B), respectively. The co-administration of R. rosea to MSG-treated rats resulted in a significant decrease in caspase-3 expression and normalization in Bcl2 mRNA (Figure 3(A and B)).

Figure 3. Quantification of caspase-3 (A) and Bcl2 (B) mRNA expression in rat hepatic tissue after normalization with beta actin. Values with different letters are significant at *p < 0.05 compared to other groups.

3.5. Protective impacts of R. rosea against histopathological changes induced by MSG in liver

Figure 4 shows that the control and R. rosea groups showed normal and polyhedral-shaped hepatocytes. Hepatocytes were arranged in a cord-like pattern. The MSG-receiving group showed hepatic necrosis and vacuolar degeneration of hepatocytes at the periphery of hepatic lobules. This group also exhibited inflammatory infiltrate, vacuolar, and hydropic degeneration. When rhodiola was co-administered with MSG in the protective group, the group exhibited moderate central vein congestion, normal intact hepatocytes, and mildly dilated blood sinusoids. The collective hepatic lesion scoring is summarized in Table 5.

Figure 4. Liver histopathology after MSG and R. rosea administration in rats. Upper left photo is the central lobe of the liver of the control group, showing polyhedral-shaped hepatocytes that are arranged in a cord-like pattern and are separated by blood sinusoids (blue arrowheads) that radiate from the intact central vein (black arrows), and the presence of Kupffer cells (blue arrows). Upper right photo is the central lobular area of the liver of R. rosea-treated rats, showing an intact central vein (black arrows), intact cords for hepatocytes (black arrowheads), and distinct blood sinusoids (blue arrowheads). Down left photo is the liver of the MSG-treated group, showing intact hepatocytes in the centrilobular area (black arrowheads) and vacuolar degeneration of hepatocytes at the periphery of hepatic lobules (red arrowheads) in addition to mononuclear cell infiltration (red arrows). Down right photo is the liver of the R. rosea plus MSG-treated group, showing moderate congestion of the liver central vein (black arrow), intact hepatocytes (black arrowheads), and mildly dilated blood sinusoids (blue arrows). Scale bar = 50 µm for all fields.

Table 5. Lesion scoring in the liver of R. rosea against MSG induced hepatic dysfunction in rats.

Organ	Lesion		Control	R. rosea	MSG	R. rosea + MSG
Liver	Areas	Central veins	1.0 ± 0.02^a	1. 2 ± 0.03^a	2.9 ± 0.14^c	1.76 ± 0.1^b
		Sinusoidal spaces	6.1 ± 0.3^a	6.0 ± 0.25^a	11.4 ± 2.1^c	8.3 ± 1.3 ^b
		Portal blood vessels	1.8 ± 0.03^a	1.9 ± 0.06^a	4.4 ± 0.1^c
		Fatty change	0^c	0^c	1.6 ± 0.1^c	0.6 ± 0.08^b
	Frequencies	Inflammatory infiltrate	0^c	0^c	16 ± 4^a	7 ± 3^b
		Vacuolar and hydropic degeneration	0^c	0^c	26.2 ± 3.8^a	15.5 ± 4.6^b
		Single-cell Necrosis	0^c	0^c	14 ± 4.2^a	4 ± 1.2^b
		Cholestasis	0^c	0^c	6 ± 2.3^a	2 ± 0.3^b
		Biliary hyperplasia	0^c	0^c	6 ± 3^a	4 ± 2^b
		Von Kupffer cell hyperplasia	0 ^c	0^c	8 ± 2.4^a	3 ± 1.2^b

Note: Values are means ± SE for 4 slides/group. Means within the same row (in each parameter) carrying different superscripts are significantly different at p < 0.05.

3.6. Protective impacts of R. rosea against MSG-induced immunohistochemical changes in COX2, TGF-β1, and NFkB expression in liver

The immunohistochemical findings shown in image C of Figures 5–7 confirm that MSG induced a state of inflammation in liver cells. MSG induced significant upregulation in the immunoreactivity and expression of COX2, TGF-β1, and NFkB, confirming hepatic dysfunction. Normally, the expressions of examined genes are very faint in the control and R. rosea-administered rats, as shown in A and B of Figures 5–7. Co-administration of R. rosea and MSG, as shown in D of Figures 5–7, resulted in significant amelioration and restoring in the immunoreactivity and staining for COX2, TGF-β1, and NFkB genes, confirming the potential protective impact of rhodiola against inflammation.

Figure 5. Liver sections of the control (upper left) and R. rosea (upper right) groups show weak immunoreactivity for COX2 within hepatocytes in the centrilobular area of the liver (arrowhead). Down left photo is a liver section from the MSG-treated rats, showing a marked increase in COX2 expression (arrowheads) within hepatocytes. Down right photo is a liver section from the MSG plus R. rosea-treated group, showing a decrease in COX2 expression (arrowheads) within hepatocytes. The scale bar for all fields is 50 µm. The immunoreactivity percentage (%) of COX2 in 6 separate fields/sections is shown in down bar graph. All values are expressed as means + SE and the significance level is reported at p < 0.05. Values with different letters are significant at *p < 0.05 compared to other groups.

Figure 6. Liver sections of control group (Upper left photo) and R. rosea group (Upper right photo), with a very faint reaction for TGF-β1 within hepatocytes in the centrilobular area of the liver. Down left photo shows the liver of MSG-administered rats, exhibiting upregulation in TGF-β1 expression (arrowheads) inside hepatocytes. Down right photo is the liver section of MSG plus R. rosea-treated rats, with a decrease in TGF-β1 immunoreactivity (arrowheads) within most of the hepatocytes. Scale bar for all fields is 50 µm. The immunoreactivity percentage (%) of TGF-β1 is shown in E. All values are expressed as means + SE. Values with different letters are significant at *p < 0.05 compared to other groups.

Figure 7. Liver sections of control (Upper left photo) and R. rosea (Upper right photo) groups show very faint immunoreactivity for NFkB within hepatocytes (arrowheads). Down left photo is the liver section of the MSG group, showing high expression of NFkB within hepatocytes of the liver (in centrilobular area; arrowheads). Down right photo is the liver section of the MSG plus R. rosea-treated group, showing a decrease in NFkB immunoreaction (arrowheads) in almost all hepatocytes. Scale bar for all fields is 50 µm. The area percentage (%) of NFkB immunoreactivity in 6 separate fields/sections is shown in E. All values are expressed as means + SE and the significance level is reported at p < 0.05. Values with different letters are significant at *p < 0.05 compared to other groups.

4. Discussion

Food additives are frequently used. They are added to food to enhance its flavour, colour, appearance, and texture, and are named organoleptic enhancers [25]. When ingested regularly, food additives might have short-term or long-term effects. Changes in mental focus, energy levels, and the immune system's reaction may be immediate side effects [26].

Toxicants such as MSG and cadmium are transported to liver tissue via cellular membrane attachments and membrane transporters found in the membranes of liver sinusoidal endothelial cells [27]. These toxins suppress the action of liver antioxidant enzymes, causing local oxidative stress and ROS production [28,29]. ROS production increases lipid peroxidation; damages DNA, proteins, and lipids; and eventually leads to systemic oxidative stress [30]. This disrupts the action of numerous enzymes, causing metabolic homeostasis in the liver [31].

Due to the cytotoxic impact of MSG, it significantly increases AST, ALT, and GGT levels due to liver cell damage [32,33]. This induces hepatic stress and ROS production, which cause lipid peroxidation and hepatic cell degradation with a subsequent increase in hepatic enzymes [34]. Administration of R. rosea prevents liver damage due to MSG by preventing the release of intracellular enzymes. R. rosea also contains significant bioactive ingredients, with antioxidant, anti-cancer, analgesic, anti-allergic, anti-mutation, and anti-aging properties. This lends credence to our theory of R. rosea's defensive abilities.

In this study, antioxidant enzymes (catalase, SOD, and GSH) were considerably reduced in the MSG-exposed group, while MDA levels were elevated. Such effects have been reported with other toxicants carried in the liver and testis [29,35]. The oral administration of MSG results in an increase in tissue stress biomarkers [32,36–40]. The increase in MDA levels in response to MSG-induced ROS production causes SOD depletion, H2O2 production, changes in the cellular redox status [40,41], and damage to the cell membrane [42,43]. Rhodiola extract increased SOD levels compared with the control, and this suggests that SOD might act as one of the scavenger pathways used to eliminate free radicals. Moreover, R. rosea increased GST contents in the liver [44]. Rhodiola boosted the activities of GSH-Px and GRE. It has been shown that the increase in glutathione reductase activity suggests an increase in GSH production [45].

The anti-inflammatory and immune-modulating properties of R. rosea can be achieved via its control of the activation of different inflammatory mediators and/or biomarkers [46,47]. Because R. rosea regulates the balance of Th1/Th2, it has been shown to reduce asthma symptoms or cerebral-ischaemia-induced inflammation [48]. Our findings are consistent with other studies in which MSG caused liver injury and increased TNF-α and IL-6 [49–51]. In a parallel study, following an LPS assault, salidroside (the active component of R. rosea) dramatically reduced the generation of IL-1, -6 and TNF, suggesting that salidroside inhibits LPS-induced acute lung injury [52].

Antioxidant resistance is conferred via rhodiola activation by transcription factor Nrf2, which regulates various antioxidant enzymes such as HO-1 [53]. In addition, MSG decreases HO-1 and Nrf2 expression, which are restored by rhodiola administration. In the same context, other species of rhodiola (R. sacra) increase HO-1 expression and promote the nuclear translocation of Nrf2 [54].

Apoptosis is halted via caspase 3 activation and Bcl2 inhibition. Caspase 3 activation is efficiently prevented by salidroside, the main active component in rhodiola. The overexpression of apoptosis-associated markers and downregulation of Bcl-2 (anti-apoptotic marker) is considerably counteracted by salidroside [55], confirming the hepato-protective effect of R. rosea against MSG-induced hepatic toxicity.

In the current study, MSG supplementation increased the expression of NFkB, COX2, and TGF-β1, as well as the levels of TNF-α, IL-1, and IL-6. MSG caused oxidative stress, which activated NF-B. NFkB is a cytosolic protein that, when activated, causes the production of inflammatory mediators such as cytokines and chemokines, which cause liver damage [56]. COX2 is an inducible enzyme that also contributes to tissue inflammation [57]. TGF-β1 is a fibrotic cytokine linked to hepatic inflammation and fibrosis development [58]. NFkB regulates inflammatory mediator genes, including TNF-α, IL-6, TGF-β1, and COX2, which play a role in the pathogenesis of tissue injury [59]. Rhodiola administration significantly decreased the expression of NFkB, TGF-β1, and COX2, which may reflect the intracellular protective pathway of R. rosea.

5. Conclusions

Rhodiola rosea supplementation cured the hepatic toxicity induced by MSG through the modulation of liver enzymes and apoptosis, improved the hepatic antioxidant status, and decreased inflammatory cytokines. Moreover, Rhodiola rosea upregulated Nrf2 and HO-1 mRNA expression, and controlled apoptosis-associated markers. At immunohistochemical levels, R. rosea restored the transcriptional impact and immunoreactivity of COX2, TGF-β1, and NFkB expressed by MSG.

Acknowledgements

The authors would like to acknowledge the Deanship of Scientific Research, Taif University, for funding this work.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Ethical approval

The guidelines and precautions stated in the NIH guidelines were strictly followed for the care and use of experimental animals.

Data availability

The contents of this paper are available upon request.