Boric acid is associated with the suppression of apoptosis and endoplasmic reticulum stress in rat model of paracetamol -induced hepatotoxicity

Abstract

Paracetamol (also known as acetaminophen or APAP) is an analgesic and antipyretic drug that is widely used all over the world. Boron is an element proven by many studies that it has indispensable effects on human health. In light of the information expressed about boron, we investigated whether there are any effects of boron on paracetamol-induced liver damage. We analyzed the 8-hydroxyguanosine (8-OHG), ALT, AST, glutathione (GSH), malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), and nitric oxide (NO) levels in serum or erythrocyte and liver tissue. At the same time, TNF-α, IL-1β, IL-18 levels were examined in liver tissues to determine the effect of boron on inflammation caused by paracetamol in serum and liver tissue. In this study to determine the effect of ER stress-mediated apoptosis, signal transducers that lead the cell to ER stress-mediated apoptosis, IRE1, ATF6 and PERK, caspase 1, 3, 8, 9 and 12, which play a role in the apoptotic process, antiapoptotic factors bcl2, bcl-xL mRNA gene expressions were determined and the effect level of boron on ER stress-mediated apoptosis was determined by immunohistochemical methods. This study demonstrate that boric acid protects against paracetamol-induced liver damage in association with the augmentation of biomarkers of oxidative and nitrosative stress, inflammation and the ER stress / apoptosis axis in rats.

KEYWORDS:

• Paracetamol
• boron
• rat
• oxidative stress
• apoptosis
• inflammation

1. Introduction

Paracetamol (Acetaminophen, N-acetyl-p-aminophenol, N- (4-hydroxyphenyl) acetamide, APAP) is an analgesic and antipyretic drug. Paracetamol is also a preferable alternative to aspirin with the same effect. Because paracetamol does not contain many of the side effects of aspirin [1].

The fact that it is cheap and easily accessible and can be purchased without a prescription has increased the use of paracetamol and brought the risk of toxicity [1,2]. Although, paracetamol is safe to use in therapeutic doses, exceeding the doses of 200 mg/kg at one time or 10 grams within 24 h in children over 6 years of age and adults, and more than 200 mg/kg in a single dose in children under 6 years, cause major hepatic and renal damage [3,4].

The majority of paracetamol is metabolized in the liver and its metabolites are sulfate and glucuronic acid. An overdose of paracetamol consumes hepatic glutathione which causes mitochondrial dysfunction and DNA damage [5]. Developing after a high dose of toxic NAPQI causes lipid peroxidation and reactive oxygen products. As a result, GSH deficiency occurs and causes deterioration of protein synthesis and intracellular calcium balance in hepatocytes. These may lead to damage and/or death of hepatocytes [6,7]. Biochemical and physiological activities of boron have been tried to be explained with two main hypotheses. The first of these is that it plays an active role in the hormonal system as a result of forming a complex with the glycoprotein and glycolipids in the cell membrane structure and taking a role in the protection and functions of the membrane stability, and the other hypothesis is that it regulates metabolic events by taking part in the structure of enzymes and affecting the regulation of minerals such as calcium and magnesium [8,9]. Studies have reported that boron contains antioxidant properties and has positive effects against free radicals in the antioxidant defense system [10,11]. In addition, it was stated that the activities of antioxidant enzymes (SOD, CAT, GSH-Px, etc.) in erythrocytes increased with boron supplementation [9]. It has been observed that boron limits oxidative stress by strengthening the body's glutathione stores and inhibiting reactive oxygen species [10]

In this study, It was aimed to investigate the possible protective and therapeutic effects of boron, which was determined to support the antioxidant system and basic metabolic parameters positively by the researches in the literature [10,12] on liver damage caused by paracetamol. For this purpose, the effects of boron on liver tissue damage caused by paracetamol, as well as possible mechanisms of these effects, were tried to be determined using biochemical, histopathological, and molecular methods. Therefore, the levels of inflammatory, oxidative stress, ER stress, and apoptotic parameters in liver tissue were analyzed and evaluated.

2. Materials and methods

2.1. Animals

This study was carried out at Uşak University Scientific Analysis and Technological Application and Research Center and Afyon Kocatepe University (AKU) Experimental Animals Research and Application Center. All interventions to animals during the study were conducted following the rules reported by Afyon Experimental Animals Local Ethics Committee and with the approval of the ethics committee of AKUHADYEK 476-15 obtained from Afyon Livestock Application and Research Center. The animals were cared for in the AKU Experimental Animals Application and Research Center.

2.2. Preparation of chemicals

2.2.1. Paracetamol administration

In this study, 2 g/kg dose of paracetamol was prepared by suspending in 1% Carboxy Methyl Cellulose (CMC) solution of Phosphate buffer saline (PBS). The prepared suspension was administered orally by gavage. The doses of paracetamol administered in the study were determined according to the related literature [13,14]. 4 h after paracetamol administration, all rats were given enough water and feed until the end of the experiment.

2.2.2. N-acetyl cysteine (NAC) application

In the study, N-acetyl cysteine (NAC) application: 600 mg single tablet NAC prepared in the study was dissolved in 0.9% NaCl solution and then administered orally by gavage [15].

Boron application: Boric acid (H3BO3) as a boron source was obtained from Tocris company (cat no: 3177). Boric acid dissolved in saline was administered to experimental animals by gavage at doses of 50, 100, and 200 mg/kg [16].

3. Method

3.1. Experiment plan

In the study, a total of 7 groups, 6 experimental and 1 control groups, were formed. A total of 70 rats (Wistar Albino male) were used in each group. All groups were made to fast for 24 h before the experiment. The experimental plan is given in Table 2. Fasted animals were included in the following experimental protocols:

• Group I (Control group): 2 ml of PBS (containing 1% CMC) was given orally by gavage.

• Group II (PARA): 2 ml paracetamol solution at a dose of 2 g/kg was given orally by gavage.

• Group III (PARA + 50 mg Boric Acid): 50 mg/kg boric acid was administered after 2 g/kg oral paracetamol administration.

• Group IV (PARA + 100 mg Boric Acid): 100 mg/kg boric acid was administered after 2 g/kg oral paracetamol administration.

• Group V (PARA + 200 mg Boric Acid): 200 mg/kg boric acid was administered after 2 g/kg oral paracetamol administration.

• Group VI (NAC + PARA): NAC 140 mg/kg + Paracetamol 2 g/kg was administered. After oral administration of 140 mg/kg NAC (N-Acetyl Cysteine), 2 ml paracetamol at a dose of 2 g/kg was administered 1-hour later. After 12 h, NAC was applied again.

• Group VII (200 mg Boric Acid): 200 mg/kg boric acid alone was applied.

3.2. Termination of the study

1 h after paracetamol administration, rats were allowed to eat and after 24 h, the animals were sacrificed. Blood samples were taken from the hearts under anaesthesia ketamine (65 mg /kg, i.p) – xylazine (7 mg/kg, i.p). At the same time, livers of all groups were rapidly removed and stored at −80°C for biochemical analysis.

3.3. Serum and liver tissue nitric oxide, 8-hydroxy guanine, MDA, GPx, GSH, SOD, CAT analysis

Liver and serum NO, MDA, SOD, CAT, GPx levels using ELISA kits from SunRed Biotechnology Company were determined using ELISA kits and 8-hydroxy Guanine levels (8-ohG) were determined using ELISA kits of Sun Red Biotechnology Company lot no: 201802. GSH levels were determined according to the method by Beutler et al. [17].

3.4. Serum AST and ALT analysis

AST and ALT analysis: The samples were prepared in 8 ml gel tubes (Lot No: 7163845) in the biochemical laboratory of Uşak Medical Park Hospital. The levels of AST and ALT were then measured in the integrated autoanalyzer biochemistry instrument of the Abbott C4100.

3.5. Serum and liver Tnf -α, IL-1β, IL-18 analysis

The obtained liver samples were homogenized and inflammation markers TNF-α (Lot no: AK0017DEC06040), IL-1β (Lot No: AK0017DEC06074), IL-18 (Lot No: AK0017DEC06075) levels were determined by ELISA kits (Elabscience).

3.6. Histapotological analysis

Tissue samples taken from the liver for histopathological examinations were detected in a 10% buffered formalin solution. Tissue samples with formalin determination were reduced to 2–3 mm thickness and appropriate sizes and taken into tissue monitoring cassettes. After washing in tap water one night, 50, 70, 80, 96, and absolute alcohol with xylol, xylol paraffin, and melted paraffin at 56–58°C for 2 h each was kept and then blocked in paraffin. Samples were cut from each paraffin block with a microtome (Leica, RM 2245) to a thickness of 5 microns, and slides were taken by a water bath (Leica, HI 1210). It was dried for ten minutes in an oven (Thermo, OGH 60) and made ready for use in histopathological methods. All sections were stained with hematoxylin–eosin (HE) method by passing through xylol series with absolute alcohol, 96, 80, 70, and 50 alcohol series [18]. The stained preparations were examined under a binocular light microscope (Nikon Eclipse Ci, Tokyo, Japan). Microscopic pictures were taken from the necessary preparations. (Nikon DS Fi 3, microscopic digital camera systems, Tokyo, Japan).

3.7. RNA isolation

Total RNA to be used in the gene expression analysis to be performed by the Real-Time PCR method was isolated by taking 10 mg from liver tissues by using a ready commercial kit. All materials to be used during RNA isolation were pre-cleaned with suitable solutions (RNA away) to create an RNA-free medium. The amount and purity of the obtained RNAs were determined by optical densities (OD260/280) in nano drops (Thermo 1000). Tissues to be isolated RNA were stored in liquid nitrogen and tissue homogenization before isolation was carried out again in liquid nitrogen. All steps of RNA isolation were performed on ice. The primary concentration was 0,5 MM. When making cDNA, total RNA amounts were equalized to 1 g and synthesized. BioRAD PureZOL ™ RNA Isolation Reagent Instruction Manual (Catalog # 732-6890) and Bio-RAD iScript cDNA synthesis kit were used as RNA isolation kit.

The primer concentration was used as 0.5 µM. Apart from that, while making cDNA, the total RNA amounts were equalized to 1 ug and synthesis was performed. The primer sequence used for the genes is given below.

Table

sCasp1-80F	TTTTATTGCTTTCTGCTCTTCAAC
sCasp1-80R	TGATGAGTGACTCAATGAAGAGAGAT
sCasp9-80F	TTGTGTCCTACTCCACCTTCC
sCasp9-80R	GATGTACCAGGAACCGCTCT
sCasp3-80F	CCGACTTCCTGTATGCTTACTCTA
sCasp3-80R	CATGACCCGTCCCTTGAA
sATF6-80F	GACAAATAGCCAGCAGAAAACC
sATF6-80R	TGAGAATTCGAGCCCTGTTC
sRELA-26F	GCCATGGACGATCTGTTTC
sRELA-26R	GCTGCTCAATGATCTCCACA
sCasp8-26F	ATATCAGTCGGCGGGATCT
sCasp8-26R	TTCTGAGAGCTTAAAGAGCATAACC
sNFKB-26F	GCCATGGACGATCTGTTTC
sNFKB-26R	GCTGCTCAATGATCTCCACA
ERN1-18F	CCAAACATCGAGAAAACGTG
ERN1-18R	TCTGAAGTCTGGCCAACTAGG
sINOS-18-F	AGGTTGGAGGCCTTGTGTC
sINOS-18-R	GCTTCAGAATGGGGAGCTG
sBCL2-2F	GTACCTGAACCGGCATCTG
sBCL2-2R	CTGAGCAGCGTCTTCAGAGA
sBCL2-XL-2F	TGACCACCTAGAGCCTTGGA
sBCL2-XL-2R	TTCCCGTAGAGATCCACAAAA
sPERK-6F	CGAAGGCCTTGGAGTCTGTA
sPERK-6R	AAGGGCTTCCATTTGATCGT
sCasp12-94F	TGTGTTGAGCCATAGATGGAA
sCasp12-94R	TTGCCTACCTTCCAAGAAATG

4. Statistical analysis

Statistical analysis of the data was performed using SPSS Statistics 20,0 programme. Results were expressed as mean ± standard deviation. The significance of the difference between the groups was determined using the Duncan technique from Post Hoc Multiple comparative tests in the One-Way ANOVA test. P values less than 0.05 were considered statistically significant (p < 0.05).

5. Results

5.1. Serum AST and ALT levels

Serum AST and ALT levels of the study are given in Table 1. According to our results, the paracetamol group was significantly higher than the control group (p < 0.05). A significant increase in AST and ALT levels in paracetamol groups (p < 0.05) is considered as an indicator of liver damage. At the same time, it was found that boron groups were significantly lower than the paracetamol group (p < 0.05). Boron-treated groups decreased elevated AST and ALT levels.

Table 1. The effects of the boric acid and paracetamol on Aspartate transaminase (AST) and Alanine Aminotransferase (ALT) levels in serum of rats.

	AST (u/l)	ALT (u/l)
Control	99.3 ± 6.46^a	24.2 ± 2.65^a
Paracetamol	160.7 ± 17.12^b	68.5 ± 3.83^b
Paracetamol + 50 boron	138.4 ± 19.42^c,d	36.5 ± 6.22^c,d
Paracetamol + 100 boron	104.6 ± 13.64^d	31.2 ± 3.39^a,c,d
Paracetamol + 200 boron	107.5 ± 16.63^d	35.2 ± 7.3^c,d
Paracetamol + NAC	100.3 ± 9.14^a	23 ± 2.01^a
200 boron	103.7 ± 9.95^a,d	27.6 ± 2.75^a,d

Different letters in the same column are statistically significant from each other. P < 0.05.

Serum AST, ALT levels different letters in the same column are statistically significant from each other.

5.2. Serum and liver tissue TNF-α, IL-1β, IL-18 levels

Liver tissue was homogenized and inflammatory markers were measured from serum samples Tables 2 and 3. (According to our results, Tnf –α and IL-18 levels were significantly higher (p < 0.05) compared to the control group). ThAPAPere was no significant difference in IL-1β levels. When boron-treated groups were compared with paracetamol-treated groups, Tnf –α and IL-18 levels were significantly lower (p < 0.05). There was no significant difference in IL-1β levels.

Table 2. The effects of the boric acid and paracetamol on Tumour Necrosis Factor (TNF –α), interleukin 1β (IL-1β), interleukin 18 (IL-18) levels in liver of rats.

	TNF –α (ng/l)	IL-1β (ng/l)	IL-18 (pg/l)
Control	355.10 ± 16.27^a	2.86 ± 0.52^a	34.09 ± 1.6^a
Paracetamol	671.92 ± 18.11^d	2.96 ± 0.01^a	82.93 ± 3.21^f
Paracetamol + 50 boric acid	453.24 ± 24.16^b,c	2.70 ± 0.32^a,b	66.47 ± 4.62^e
Paracetamol + 100 boric acid	445.98 ± 24.58^b,c	2.81 ± 0.33^a,b	54.27 ± 11.34^d
Paracetamol + 200 boric acid	494.80 ± 27.58^c	2.46 ± 0.19^b,c	50.98 ± 6.45^c,d
Paracetamol + NAC	417.27 ± 29.18^a,b	2.29 ± 0.23^c	44.75 ± 8.66^b,c
200 boric acid	375.85 ± 16.36^a	2.68 ± 0.34^a,b	40.99 ± 3.31^a,b

Different letters in the same column were statistically significant. P < 0.05.

Liver tissue cytokine levels. Different letters in the same column were statistically significant. P < 0,05 was considered significant.

Table 3. The effects of the boric acid and paracetamol on Tumour Necrosis Factor (tnf –α), interleukin 1β (ıl-1β), interleukin 18 (ıl-18) levels in serum of rats.

	TNF –α (ng/l)	IL-1β (ng/l)	IL-18 (pg/l)
Control	115.9 ± 6.1^a	0.78 ± 0.12^a	15.7 ± 2.1^a
Paracetamol	370.9 ± 8.22^d	0.86 ± 0.11^a	7.1 ± 4.2^b
Paracetamol + 50 boric acid	210.8 ± 7.26^b,c	0.76 ± 0.12^a,b	10.47 ± 3.9^c
Paracetamol + 100 boric acid	220.9 ± 9.24^b,c	0.71 ± 0.13^a,b	11.27 ± 2.8^c
Paracetamol + 200 boric acid	294.8 ± 7.9^c	0.66 ± 0.17^b,c	12.98 ± 4.5^c
Paracetamol + NAC	247.27 ± 9.8^a,b	0.69 ± 0.18^c	14.15 ± 5.1^a,c
200 boric acid	129.9 ± 6.7^a	0.81 ± 0.14^a,b	13.19 ± 3.11^a,c

Different letters in the same column were statistically significant. P < 0.05.

Serum cytokine levels. Different letters in the same column were statistically significant. P < 0,05 was considered significant.

5.3. Serum and liver tissue MDA, GSH, GPx, NO, SOD, CAT, and 8-OHG levels

According to the data of the analyzes performed, serum and tissue MDA, NO, 8- OHdG levels were significantly (p < 0.05) higher in the paracetamol given group than in the control group, and it was found to be significantly (p < 0.05) lower in the boron given groups compared to the paracetamol group. Serum and tissue SOD, CAT, GSH, GpX levels were found to be significantly (p < 0.05) lower in the paracetamol group compared to the control group, while a significan (p < 0.05) t increase was observed in the boron-administered groups compared to the paracetamol-administered group (Tables 4 and 5).

Table 4. The effects of the boric acid and paracetamol on Liver Tissue Malondialdehyde (MDA), Glutathione (GSH), Glutathione peroxidase (GPX), Nitric Oxide (NO), superoxide dismutase (SOD), catalase (CAT) and 8-Hydroxy-2'-deoxyguanosine (8-OHdG) levels in rats.

	MDA nmol/g	NO µmol/l	SOD ng/ml	CAT ng/ml	8-OHdG ng/ml	GSH nmol/ml	GP xng/ml
Control	424.61 ± 9.24^a	2.97 ± 0.91^a	360.20 ± 19.1^a	4.67 ± 0.29a	24.20 ± 2.65a	11.35 ± 0.92^a	360.20 ± 20.81^a
Paracetamol	721.27 ± 16.31^d	5.68 ± 0.82^b	101.60 ± 4.69b	2.41 ± 0.24c	68.50 ± 3.83b	4.88 ± 0.51^d	101.60 ± 4.69^b
Paracetamol + 50 boric acid	530.25 ± 14.96^b,c	3.67 ± 0.67^b	293.90 ± 6.79^c	3.70 ± 0.17b	36.50 ± 6.22^c,d	9.87 ± 0.79^a	193.90 ± 6.79^c
Paracetamol + 100 boric acid	535.98 ± 14.98^b,c	3.46 ± 0.45^c	255.80 ± 8.66^c	4.44 ± 0.30a	31.20 ± 3.39^a,c,d	11.20 ± 1.11^a,b,c	255.80 ± 18.66^d
Paracetamol + 200 boric acid	524.20 ± 17.48^c	3.64 ± 0.20^b	246.00 ± 5.25^c	4.41 ± 0.21a	35.20 ± 7.30^c,d	10.77 ± 0.91^a,b,c	346.00 ± 25.25^a
Paracetamol + NAC	527.17 ± 19.18^a,b	2.54 ± 0.14^b	210.90 ± 8.99^c	4.52 ± 0.16a	23.00 ± 2.01^a	11.45 ± 0.79^c	210.90 ± 8.99^c
200 boric acid	475.35 ± 17.26^a	2.59 ± 0.53^a	236.40 ± 8.32^,c	4.62 ± 0.48a	24.60 ± 2.75^a	11.86 ± 1.23^b	336.40 ± 28.32^a

Different letters in the same column are statisticall significant. p < 0.05.

Liver tissue MDA, GSH, GPx, NO, SOD, CAT and 8-OHG different letters in the same column were statistically significant from each other. P < 0,05 was considered significant.

Table 5. The effects of the boric acid and paracetamol on serum Malondialdehyde (MDA), Glutathione (GSH), Glutathione peroxidase (GPX), Nitric Oxide (NO), superoxide dismutase (SOD), catalase (CAT) and 8-Hydroxy-2'-deoxyguanosine (8-OHdG) levels in rats.

–	MDA nmol/g	NO µmol/l	SOD ng/ml	CAT ng/ml	8- OHdG ng/ml	GSH nmol/mı	GP xng/ml
Control	0.21 ± 0.85^a	3.15 ± 0.73^a	79.21 ± 0.62^a	3.15 ± 0.73^a	33.98 ± 8.049^a	2.19 ± 3.35^a	328.95 ± 31.16^a
Paracetamol	0.53 ± 0.13^b	10.49 ± 0.37^b	58.43 ± 0.54^c	10.89 ± 0.67^b	71.77 ± 3.65^c	0.03 ± 0.3^b	440.63 ± 14.17^b
Paracetamol + 50 boric acid	0.41 ± 0.65^c	5.72 ± 0.16^c	78.16 ± 0.42^a	5.71 ± 0.16^c	30.55 ± 3.87^a,b	1.32 ± 2.02^c	413.46 ± 23.28^b
Paracetamol + 100 boric acid	0.42 ± 0.65^c	6.45 ± 0.80^d	67.56 ± 1.36^b	5.45 ± 0.80^d	30.47 ± 3.97^a,b	1.01 ± 1.36^c	345.75 ± 21.34^a,c
Paracetamol + 200 boric acid	0.56 ± 0.17^b	3.14 ± 0.08^a	78.08 ± 0.87^a	3.20 ± 0.88^a	28.62 ± 1.83^b	2.30 ± 2.69^a	319.21 ± 25.41^c
Paracetamol + NAC	0.24 ± 0.72^b	2.74 ± 0.56^a	78.71 ± 1.07^a	2.94 ± 0.96^a	27.21 ± 7.75^b	2.11 ± 1.52^a	279.78 ± 32.89^a
200 boric acid	0.22 ± 0.82^a	2.99 ± 0.48^a	77.41 ± 2.01^a	2.98 ± 0.48^a	29.91 ± 6.55^a,b	2.14 ± 1.41^a	319.21 ± 15.31^a,c

Different letters in the same column are statisticall significant. p < 0.05.

Serum MDA, GSH, NO, 8-OHG and erythrocyte, SOD, CAT and GPx levels. Different letters in the same column are statistically significant. P < 0,05 is considered significant.

5.4. Molecular analysis of liver tissue

The control group was accepted as 1 and statistical analysis was performed. The most significant findings in the data obtained were the increase in gene expression levels in the paracetamol group. This increase was significantly decreased (P < 0.05) in the groups given boron. The interesting finding in our study is that the increases observed in apoptotic and antiapoptotic gene expression levels as a result of paracetamol toxication decreased with boron supplementation (Tables 6 and 7).

Table 6. The effects of the boric acid and paracetamol on mRNA expression of activating transcription factor 6 (ATF-6), B-cell lymphoma 2 (BCL2), B-cell lymphoma-extra (Bcl-x), Caspase 1 (CASP1), Caspase 12(CASP12), Caspase 3 (CASP3), Nuclear Factor kappa B (NF-HB), cyclooxygenase-2 (COX-2).

	ATF-6	BCL2	BCLX	CASP1	CASP12	CASP3	ASP8	NF-KB	COX-2
Paracetamol	5.01 ± 0.62^a	0.94 ± 0.08^f	0.59 ± 0.17^f	4.48 ± 0.63^a	6.77 ± 0.63^a	4.42 ± 0.62^a	3.68 ± 0.41^a	6.78 ± 0.22^a	3.28 ± 0.13^a
Paracetamol + 50 boric acid	4.24 ± 0.54^b	1.24 ± 0.12^e	1.02 ± 0.20^e	2.85 ± 0.73^b	5.11 ± 0.51^b	2.88 ± 0.38^b	1.82 ± 0.26^b	4.32 ± 0.31^b	1.45 ± 0.43^b
Paracetamol + 100 boric acid	2.91 ± 0.49^c	1.80 ± 0.16^d	1.51 ± 0.11^d	1.51 ± 0.24^c	2.50 ± 0.47^c	2.12 ± 0.18^c	1.26 ± 0.15^c	4.31 ± 0.25^c	1.31 ± 0,44^c
Paracetamol + 200 boric acid	1.83 ± 0.26^d	2.40 ± 0.24^c	2.09 ± 0.15^c	0.94 ± 0.16^d	1.21 ± 0.24^d	1.53 ± 0.19^d	1.03 ± 0.06^d	4.02 ± 0.10^d	0.89 ± 0.12^d
Paracetamol + NAC	1.27 ± 0.12^e	3.44 ± 0.36^b	3.46 ± 0.21^b	0.54 ± 0.13^de	0.71 ± 0.17^e	1.15 ± 0.11^e	0.77 ± 0.09^e	1.49 ± 0.08^e	0.69 ± 0.15^de
200 boric acid	0.66 ± 0.18^f	4.12 ± 0.51^a	4.91 ± 0.49^a	0.22 ± 0.03^d	0.27 ± 0.07^f	0.60 ± 0.27^f	0.39 ± 0.08^f	0.69 ± 0.09^f	0.34 ± 0.02^d

Different letters in the same column are statistically significant from each other P < 0.05.

Results of liver tissue molecular analysis, different letters in the same column are statistically significant from each other. P < 0,05 was considered significant.

Table 7. The effects of the boric acid and paracetamol on mRNA expression of Caspase 9 (CASP9), endoplasmic reticulum to nucleus signalling 1 (ERN1), Inducible nitric oxide synthase (iNOS), endoplasmic reticulum kinase (PERK).

	CASP9	ERN1	INOS	PERK	RELA-1
Paracetamol	4.10 ± 0.50^a	5.64 ± 0.53^a	5.53 ± 0.69^a	4.30 ± 0.70^a	3.82 ± 0.37^a
Paracetamol + 50 boric acid	2.22 ± 0.14^b	4.02 ± 0.61^b	4.00 ± 0.77^b	3.51 ± 0.64^b	2.65 ± 0.44^b
Paracetamol + 100 boric acid	1.65 ± 0.23^c	2.41 ± 0.39^c	2.31 ± 0.86^c	1.89 ± 0.44^c	1.79 ± 0.11^c
Paracetamol + 200 boric acid	1.20 ± 0.08^d	1.63 ± 0.18^d	0.97 ± 0.34^d	1.14 ± 0.10^d	1.41 ± 0.15^d
Paracetamol + NAC	0.99 ± 0.06^d	1.11 ± 0.14^e	0.38 ± 0.08^e	0.72 ± 0.23^d	1.00 ± 0.13^e
200 boric acid	0.66 ± 0.16^e	0.65 ± 0.19^f	0.16 ± 0.03^e	0.25 ± 0.03^e	0.61 ± 0.11^f

Different letters in the same column are statistically significant from each other P < 0.05.

Results of molecular analysis of liver tissue, different letters in the same column were statistically significant from each other. P < 0,05 was considered significant.

5.5. Histopathological examination of liver tissue

Histopathological changes in the organs of animals in experimental groups were defined in detail which is shown in Figure 1. Paracetamol group showed severe necrosis, sinusoidal dilatation, and hyperemia in the pericentral region of the liver tissue (Figure 1(B)). Para + Boron 50 group showed mild necrosis in the pericentral regions and sinusoidal dilatation and hyperemia (Figure 1(C)). In the Para + Bor 100 group, mononuclear cell infiltrations in the pericentral region were observed (Figure 1(D)). Para + Boron 200 (Figure 1(E)) and Para + NAC (Figure 1(F)) groups showed a small number of histopathological changes in liver tissues whereas in the control group (Figure 1(A)), histopathological changes in the liver tissue were normal. Also, statistical evaluation of the histopathological alterations showed in Figure 1(H).

Figure 1. The effects of the boric acid and paracetamol on histopathological alterations in rat liver tissue. Arrow: necrosis and mononuclear cell infiltrations in the pericentral region of the liver, arrowhead: sinusoidal dilatation and hyperemia, A: Control; B: Paracetamol; C: Paracetamol + 50 boric acid; D: Paracetamol + 100 boric acid; E: Paracetamol + 200 boric acid; F: Paracetamol + NAC; G: 200 boric acid. All figures are stained with H&E. 20x, and 100 µm were used as the original magnifications. H: Damage score of histopathological alterations. 0-no damage, 1-slight, 2-moderate, 3-severe, or 4-most damaged. MNI: mononuclear cell infiltrations. ^a,b,c,d:Different letters in the same column were statistically significant, p < 0.05.

6. Discussion

Paracetamol (Acetaminophen) is one of the most consumed analgesic–antipyretic agents in the world, it is safe when used in therapeutic doses, and it is indicated in studies conducted in experimental animals and humans that it causes liver necrosis, kidney toxicity, and even death when used in overdose [19]. At the same time, there is no real treatment for paracetamol toxicity. Therefore, when we look at the literature, many experimental or clinical alternative treatment methods have been tried. The standard treatment for paracetamol poisoning is NAC. NAC is an acetylated precursor of both amino acid L-cysteine and GSH and has been used as an antidote to prevent toxicity due to paracetamol overdose for many years. Today, animal and human studies have shown that NAC is a potent antioxidant and is used as a potential therapeutic agent in the treatment of various diseases characterized by free radicals and oxidant damage [20]. In our study, by using the NAC group, we also had the opportunity to compare the protective effects of boron we applied by comparing the given boron doses with this group.

Oxidative stress is considered to play an important role in paracetamol toxicity, increasing the oxidation of paracetamol reactive intermediate N-acetyl-β-benzoquinone (NAPQI), superoxide radical (O2 · -), and hydrogen peroxide (H2O2) formation increases. For NPAQI to cause liver damage, paracetamol taken should be in high doses. This reactive product is known to cause liver damage as it consumes GSH stores completely [21].

The shift of the balance between the body's antioxidant defense system and free radicals in favour of oxidants is called oxidative stress. Oxidative stress leads to oxidative destruction of lipids and other macromolecules, resulting in the exchange of cell membranes and other cell components [22], leading to tissue damage and chronic diseases resulting in cell necrosis and death [23,24]. At the same time, free radicals are formed as a result of the accumulation of drugs used in many different diseases in the body. Paracetamol (Acetaminophen), which we applied to rats in our study, is one of the most consumed analgesic antipyretic agents in the world. Safe in therapeutic doses, paracetamol causes hepatoxicity and nephrotoxicity when taken in overdoses. The formation of free radicals increases paracetamol toxicity, leading to the breakdown of unsaturated fatty acids and causing cell damage [25,26]. In studies, it was reported that the levels of reactive oxygen products were found to be high compared to the control group and low levels of antioxidant enzymes as a result of paracetamol-induced liver injury [27].

In studies of paracetamol-induced hepatoxicity in rats, the MDA level was increased in comparison with the control group [28,29]. Plasma MDA levels increased in rats induced by paracetamol toxic hepatitis compared to the control group, while liver MDA levels increased significantly [29].

In other studies, CAT and SOD levels were examined as a result of liver damage caused by paracetamol toxicity. The results of this study were similar to those of most of the studies and it was found that the increase in liver and plasma SOD levels [30]. These findings suggested that antioxidant enzyme levels increased due to the increase in the antioxidant defense system happens because of the free radical increase caused by toxicity. In our study, SOD levels were found to be significantly lower in the paracetamol group compared to the control group.

In another study with paracetamol, CAT activity was found to be decreased in hepatotoxicity groups compared to the control group [29]. The findings were consistent with the findings of our study. In a study by Hu and Kitts [31], nitrite nitrate levels were determined as a result of paracetamol toxicity and nitrate and nitrite levels were higher in the paracetamol group compared to the control group.

In particular, the toxic effect of paracetamol is mainly the depletion of glutathione stores in the liver and the absence of glutathione to convert NAPQI to mercapturic acid. The fact that glutathione levels in liver tissue were significantly lower in the paracetamol group supports this theory. As can be seen from our findings, boron is thought to play a protective role against oxidative stress caused by the paracetamol-induced liver injury.

There are studies in the literature that boron has a scavenging effect on reactive oxygen radicals in the membrane. Increased reactive oxygen species due to boron insufficiency and consequent changes in erythrocyte superoxide dismutase concentrations are observed [32].

As a result of previous studies, levels of inflammatory cytokines such as TNF-α and IL-6 were found to be high in paracetamol-induced liver injury [33].

Based on this information, with the idea that the possible protective effect of boron as a result of liver damage induced by paracetamol and that this effect may suppress the expression of cytokines, in our study, TNF-α, IL-1β, and IL-18 cytokine and iNOS, NF-kB levels were determined by analyzing mRNA expressions in liver tissue to determine the effect of boron on inflammation levels.

In a study, boron was effective in regulating the inflammatory response [34]. In a double-blind study conducted in 1990, 15 people with joint inflammation were given 6 mg of boron [sodium tetraborate decahydrate] daily for 8 weeks and reported decreased pain and inflammation in the joints. According to the findings of our study, it was observed that the levels of cytokine and mRNA expression levels of pro-inflammatory factors increased with paracetamol application. This suggests that boron may be due to its anti-inflammatory [35] and antioxidant effect, as well as its regulatory effect on metabolism in physiological events [36].

In our findings, we observed a significant increase in IRE1, ATF6, and PERK levels in the paracetamol group. In other words, the increase in the expression levels of these genes in paracetamol-induced liver damage proves our hypothesis. At the same time, a significant decrease in apoptotic gene expression levels compared to paracetamol groups showed us that boron can have protective properties in these pathways.

According to our findings, to determine the effects of boron on oxidative stress induced by paracetamol, in liver and serum oxidative stress parameters; 8-OHdG, NO, MDA, GSH, GPx, CAT, SOD were evaluated and as a result of the obtained data, it was thought that the liver damage caused by paracetamol might be caused by oxidative stress and an evaluation was made that boron may have a protective effect against hepatotoxicity through oxidative stress.

With this study, we have been made aware that boron may have a protective effect against inflammation caused by paracetamol toxicity. TNF-α, IL-1β, and IL-18 cytokine levels were analyzed in liver tissue to determine the effect of boron on paracetamol hepatoxicity and NFkB levels were determined by analyzing mRNA expressions in liver tissue. It has been demonstrated by molecular analyzes whether there is a protective effect of boron on inflammation-mediated apoptosis levels triggered by paracetamol.

The role of possible ER stress that may occur in paracetamol hepatoxicity and the effects of boron on ER stress were tried to be determined. For this purpose, the basic parameters used in determining ER stress (PERK, IRE1, ATF-6) have been determined in liver tissue mRNA expression levels, thus the possible protective effect of boron against ER stress caused by paracetamol toxicity and its possible protective effect against ER stress-mediated apoptosis (with caspase 12 mRNA expressions by comparison) tried to be given. The levels of apoptosis in paracetamol toxicity, which occur traditionally, due to increased expression of the p53 gene, were determined by analyzing the mRNA expression levels of bcl2 and BCL-xL genes, which are known to be suppressed by the stimulation of the apoptotic p53 gene. In our study, the decrease observed in apoptotic and antiapoptotic gene expression levels as a result of paracetamol toxicity with boron supplement is another interesting finding and is a first in the literature.

We evaluated histopathologically the damage caused by the effect of paracetamol and the possible protective effect of boron on this damage. Our histopathological findings were also observed to support our other biochemical and molecular data. Considering the data obtained, it is thought that boron can be an alternative in terms of preventing or reducing the damage in hepatocytes when it is thought that it can suppress ER stress and ER stress-mediated apoptosis, at the same time, it shows antioxidant properties and reduces oxidative stress.

In line with the data obtained in our study, we think that boron can be a new therapeutic agent in the prevention of liver toxicity resulting from drug or chemical substance poisoning, which threatens public health both in adults and childhood, and complications and even death. It is of great importance to show the possible protective roles of boron in the defense mechanism of the liver has a very important added value even alone. We think that the publication of the possible protective effect of boron on the liver in internationally indexed journals will attract attention in the world scientific community.

Acknowledgements

The study was supported by TUBITAK with the project number of 216S671.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

The study was supported by TUBITAK with the project number of 216S671.