Egg white composition, antioxidant capacity, serum and yolk lipids and oxidative damage of the oviduct magnum in laying hens fed diets contaminated with different concentrations of cadmium

Abstract

Total of 384 healthy 38-week-old hens were randomly divided into four treatments. Layers in four groups were fed a basal diet and a basal diet with Cd at the level of 15, 30 and 60 mg/kg for nine weeks. Results showed that Cd could dose-dependently deposited in magnum and a positive correlation occurred between the accumulation of Cd in magnum and Cd content in egg whites. When compared with control group, 60 mg/kg Cd decreased magnum ovomucin, ovalbumin, lysozyme and ovomucoid gene expressions, but increased avidin gene expression obviously. Hens receiving 60 mg/kg Cd exhibited a significant decrease in egg white ovalbumin content and its proportion in total protein and increase in total cholesterol and LDLC levels in serum and yolk. The level of GSH and activities of T-SOD and CAT in magnum and GSH-Px activity in egg white were decreased significantly, while MDA level in both magnum and egg white was increased obviously in 60 mg/kg Cd group. Besides, Cd induced oxidative stress, inflammation, endoplasmic reticulum stress (ERS) and mitophagy accompanied by a significant up-regulation of the expressions of Keap1, IL1β, TNFα, NF-κB, p65, p-p65, Grp78, CHOP, ATF4, ATF6, IRE1α, Grp94, PINK1, Parkin, Fundc1, GRP75, VDAC1, MCU, MFF, Bnip3 and LC3I/II and a significant down-regulation of the expressions of Nrf2, HO-1, SOD1, SOD2, SOD3, MFN1, MFN2 and PGC1α. These results indicated that Cd can increase serum and yolk cholesterol level and induce magnum oxidative stress, inflammation, ERS and mitophagy through Nrf2/NF-κB and IRE1α/IP3R/GRP75/VDAC1/MCU pathways, thus disrupting egg white composition.

Highlights

• Cd exposure disrupted the synthesis of egg white protein in oviduct magnum and destroyed antioxidant status and protein composition in egg white.

• Cd exposure significant enhanced serum and yolk total cholesterol and LDL cholesterol levels.

• Cd exposure induced magnum oxidative stress, inflammation, ERS and mitophagy through Nrf2/NF-κB and IRE1α/IP3R/GRP75/VDAC1/MCU pathways.

Keywords:

• Cadmium
• oviduct magnum
• egg white
• lipid
• laying hens

Introduction

Cadmium (Cd) has been recognised as a safety risk to human and animal health. Despite low doses of Cd, tissues and organs are susceptible to serious damage because of its long half-life (Zhu M et al. 2020; Zhu et al. 2021). With the development of industry and agriculture, Cd pollution in feed and its toxic effects on animals have attracted more and more attention. The main sources of Cd pollution in feed are soil, water, unreasonable processing and utilisation of mineral element additives. Cd can accumulate in various organs and tissues of animal body, such as liver (Zhu MK et al. 2020), ovary (da Costa et al. 2021; Zhu et al. 2021), uterus (Zhu M et al. 2020), kidney and bone (Zhu et al. 2019). In poultry, the oviduct is an important reproductive organ for the secretion of egg whites and eggshells. Our previous studies have shown that Cd accumulates in the oviduct of laying hens and causes oxidative damage to the eggshell gland, disordered expression of eggshell secretion-related genes and decreased eggshell quality (Zhu M et al. 2020).

Hen eggs are considered one of the healthiest foods because they contain high-quality proteins, lipids and vitamins (Fredriksson et al. 2006; Walker et al. 2012). Egg whites are not only an important source of human nutrition, but also provide essential nutrients for embryonic development (Saito 2013). During the spawning period, the gland cells of the magnum can periodically express a variety of specific proteins, including ovomucin (OV), ovalbumin (OVA), lysozyme (LYZ), ovomucoid (OVM), anti-biotin (AVD), etc (Sah et al. 2021). Studies have indicated that about 90% of OVA is synthesised and secreted in the magnum tissue (Hu et al. 2016; He et al. 2017). Previous studies have demonstrated that cadmium causes oxidative damage to the reproductive system of laying hens and significantly reduces production performance and egg quality (Zhu M et al. 2020; Zhu et al. 2021). However, the toxic effects of Cd on egg white composition, antioxidant capacity and yolk lipids are rarely reported.

Various types of damage can be induced by oxidative stress, a primary cause of cadmium toxicity (Wu et al. 2014). The transcription factor NF-E2-related factor 2 (Nrf2) is an important factor regulating cellular oxidative stress and is also a central regulator of maintaining intracellular redox homeostasis. It mainly controls the redox state by regulating cellular oxidative stress-inducing gene clusters, such as haem oxygenase-1 (HO-1), perredoxin MSP23, NAD(P)H quinone dehydrogenase 1 (NQO1) and glutathione S-transferase (GST) (Jin et al. 2016). Genetic of Nrf2 inhibition increased endoplasmic reticulum (ER) stress through the regulation of CCAAT-enhancer-binding protein homologous protein (CHOP) (Sun et al. 2018). Mitochondria are one of the key intracellular targets of different stressors and one of the main organelles for reactive oxygen species (ROS) generation (Kovac et al. 2015). Studies have demonstrated that the oxidative folding of ER proteins and mitochondrial oxidative phosphorylation display a special relationship based on bidirectional interaction (Fan and Simmen 2019). Ca²⁺ transfer via the ER‑mitochondria tethering complex (MAMs) in cells contribute to Cd‑induced autophagy (Wang et al. 2022). Cadmium induced mitochondrial dysfunction through MAMs leading to hepatorenal toxicity in chickens has been proved (Ge et al. 2019; Chen et al. 2021). However, the mechanism of Cd affecting egg white synthesis and secretion and oxidative damage in the oviduct magnum of hens has not been reported.

Based on these studies, the present study was conducted to evaluate the effects of various levels of Cd as a contaminated source in the diet of laying hens on egg white synthesis and secretion, antioxidant capacity, serum and yolk lipids and oxidative damage of the oviduct magnum.

Material and methods

Reagents

CdCl2 • 2.5H2O (purity ≥ 99%) was provided by Sinopharm Chemical Reagent Co., Ltd, Shanghai, China.

Experimental design, animals and diet

Three hundred and eighty-four healthy 38-week-old Hy-Line brown layers with similar body weight and laying rate were randomly divided into four treatments with six replicates (16 birds/replicate). Layers in four groups were fed a basal diet (control) and a basal diet with Cd (provided as CdCl2·2.5H2O) at the level of 15, 30 and 60 mg/kg for 10 weeks (a 1-week adaptation period and a 9-week experimental phase were included). Cd levels of 30 mg/kg and 60 mg/kg were selected as slightly toxic values, whereas lower levels were considered representative of the amount of Cd in feedstuffs caused by environmental factors (Czarnecki and Baker 1982; Li et al. 2010). Layers were fed and watered ad libitum throughout the experimental period. The composition of basal diet is presented in Table 1. Daily feed consumption and laying rate of each group were recorded. At the end of experiment, the average daily feed intake for the four groups were 103.28 (standard error (S.E.) 1.91), 104.47 (S.E. 1.55), 102.30 (S.E. 1.52) and 92.87 (S.E. 2.35) and the laying rates were 89.36 (S.E. 0.60), 91.21 (S.E. 0.42), 89.45 (S.E. 0.77) and 73.31 (S.E. 4.67), respectively (Zhu M et al. 2020). The albumen samples of the eggs (12 eggs per treatment) were collected and stored at −80 °C for Cd content determination. Twelve birds in each group were humanely euthanized using cervical dislocation after 12 h of fasting. Immediately removed the oviduct magnum tissue and stored it in liquid nitrogen for Cd residue determination and biochemical and molecular biological analysis. The actual concentrations of Cd in feed, albumen and oviduct magnum tissues were detected by graphite furnace atomic absorption spectrometry as described in the previous experiment (Zhu M et al. 2020). The actual Cd concentrations in diets were 0.47 (S.E. 0.01), 15.56 (S.E. 0.18), 30.55 (S.E. 0.11), 60.67 (S.E. 0.15) mg/kg, respectively.

Table 1. Ingredient compositions and nutrient levels of basal diet for hens.^a

Basal ingredients	Value	Nutrient level	Value
Corn, %	65	Metabolism energy, MJ/kg	2.65
Soybean meal (42.0% CP)	21	Crude protein (CP), %	15.73
Feather meal, %	1	Ether extract, %	6.32
Fish meal, %	1	Lysine, %	0.78
Calcium carbonate, %	7	Methionine, %	0.34
Premix^b, %	5	Cysteine, %	0.32
		Total phosphorus, %	0.61
Total, %	100	Calcium, %	3.45

^aEstimated from Chinese feed database provided with tables of feed composition and nutritive values in China (2015 26th edition).

^bThe premix provided following per kilogram of diet: vitamin A, 7000 IU; vitamin D₃, 2500 IU; vitamin E, 49.5 mg; vitamin K₃, 1 mg; vitamin B₁, 1.5 mg; vitamin B₂, 4 mg; vitamin B₆, 2 mg; vitamin B₁₂, 0.02 mg; niacin, 30 mg; folic acid, 0.55 mg; pantothenic acid, 10 mg; biotin, 0.16 mg; chloride becholine, 400 mg; Cu, 20 mg; Fe, 70 mg; Mn, 100 mg; Zn, 70 mg; I, 0.4 mg; Se, 0.5 mg.

Oxidative stress indices

About 0.1 g of the oviduct magnum tissue was cut and weighted and nine times ice-cold phosphate buffer solution (PBS) at a ratio of weight (g): volume (ml) = 1:9 was added to make a 10% homogenate. Then, the supernatant was collected for subsequent analysis after centrifugation (1000 g, 5 min). The activities of total superoxide dismutase (T-SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and the levels of glutathione (GSH) and malondialdehyde (MDA) in egg whites and oviduct magnum tissue were detected using the commercially available assay kits procured from Nanjing Jiancheng Bioengineering Institute, China.

Egg white composition analyses

The contents of OVA and OVM were determined by using appropriate ELISA kits (Enzyme-linked Biotechnology ELISA kits, Shanghai, China; Cat No. ml060787, ml036957). The egg whites from the yolks were separated using an egg divider and every four egg whites were mixed as a repeat. Egg whites were mixed thoroughly at low temperature and low speed. Approximately 0.2 ml egg white was taken for the total protein determination using BCA protein determination kit obtained from Beyotime (Shanghai, China). Then, equal volumes of SDS-PAGE loading buffer were added to protein samples and heated at 100 °C for 5 min to denature the protein for the subsequent 4–20% SDS-PAGE analysis. Then the gels were stained by Coomassie blue R-250.

Serum and yolk lipids analyses

A 1.00 g of yolk sample was homogenised with 19 mL of chloroform-methanol (2:1 v/v), sonicated and filtered as detailed elsewhere (Sarlak et al. 2021). This solution, as well as serum, was analysed to determine triglycerides, high-density lipoprotein cholesterol (HDLC), low-density lipoprotein cholesterol (LDLC) and total cholesterol (T-CHO) using the commercially available assay kits as per the instructions provided by Nanjing Jiancheng Bioengineering Institute, China.

Gene expression analyses

Total RNA from the oviduct magnum tissue (50–100 mg) was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). PrimeScriptTM RT reagent kit with gDNA eraser (RR047A, Takara) was used to convert total RNA into complementary DNA (cDNA). Quantitative real-time PCR (qRTPCR) was performed with NovoStart SYBR qPCR Supermix Plus (E096-01A, Novoprotein Scientific Inc. China) using the Bio-Rad CFX96 Real-Time PCR System. As shown in Table 2, the primer sequences designed for qRT-PCR were synthesised by Generay Biotech (Shanghai). As Livak and Schmittgen (Livak and Schmittgen 2001) described, the 2^−ΔΔCT method was used to calculate the relative mRNA level of each gene. The target gene expression levels were normalised to the means of housekeeping gene β-actin.

Table 2. Primer used for quantitative real-time PCR.

Target gene	Primer	Primer Sequence (5'-3')	Accession no.
β-actin	Forward	TCCCTGGAGAAGAGCTATGAA	NM_205518.1
	Reverse	CAGGACTCCATACCCAAGAAAG
OV	Forward	GCTGTGTGCTTTACCTCTTTG	XM_040673607.1
	Reverse	GAACTGGGTCCTTCTGTCATC
OVA	Forward	GAGAGCAGATCACGGCATATT	MH360742.1
	Reverse	GCTCATCAATTCCTGGGTAGAA
LYZ	Forward	TACGACACTGGCAACATGAG	KU933268.1
	Reverse	CGGCTGTTGATCTGTAGGATT
OVM	Forward	TGCCTGCACGATGGAATACA	XM_035559733.1
	Reverse	TCAGCATTCTCCAAAATGGCTTA
AVD	Forward	CCTACATCACAGCCGTAACA	AM779412.1
	Reverse	GCTTTCCAGTCATCACCAATG
Nrf2	Forward	CTGCCCAAAACTGCCGTA	NM_205117.1
	Reverse	TCAAATCTTGCTCCAGTTCCA
NQO1	Forward	CTCCGAGTGCTTTGTCTACG	XM_015874307.1
	Reverse	AATGGCTGGCATCTCAAACC
HO-1	Forward	GCTGAAGAAAATCGCCCAA	NM_205344.1
	Reverse	ATCTCAAGGGCATTCATTCGG
SOD1	Forward	TGTGCATGAATTTGGAGACAAC	NM_205064.1
	Reverse	TTGCAGTCACATTGCCGAG
SOD2	Forward	TGCACTGAAATTCAATGGT	NM_204211.1
	Reverse	GTTTCTCCTTGAAGTTTGCG
SOD3	Forward	TTTTCTCCTAAAGATGGCAAG	XM_420760.3
	Reverse	CTTCCTGCTCATGGATCACAA
GST	Forward	GGAAGCCATTTTAATGACAGA	XM_046913335.1
	Reverse	TCCTTTAAAAGCCTGTAGCAGA
GCLC	Forward	TCTGTAGATGATCGAACGC	XM_419910.4
	Reverse	TCCTTTATTAGGTGCTCGTAG
GCLM	Forward	GCTGCTAACTCACAATGACC	NM_001007953.1
	Reverse	TGCATGATATAGCCTTTGGAC
IL1β	Forward	GCCTCTGCTCCCATTTAGTT	XM_015297469.1
	Reverse	CTCACAGTCCTTCGACATCTTC
IL-6	Forward	CGGTACATACGAGATGGAAACC	XM_015281283.2
	Reverse	GATCCGGCAGATGGTGATAAA
TNFα	Forward	GAGGATTGTGCCCGAACTAAA	AY765397.1
	Reverse	GACAGCCTATGCCAACAAGTA
NF-κB	Forward	TCCACATCTTTCAGAGCATCAA	XM_015856764.1
	Reverse	CTCCTCAACCTCACTTCCTTAC
MFN1	Forward	GTTGTTGGCGGAGTGATTTG	XM_046923917.1
	Reverse	CTTGGAGTGGCTCTGTATGTT
MFN2	Forward	GACAGGTTGCCTTGTGAGATAG	XM_040689233.2
	Reverse	CCCATTCTTACCCTGGCATTAG
PINK1	Forward	AGCAGCGATTCCTTCATCTC	NM_001389481.2
	Reverse	CTTCAGGTCTCTGTGTGCTATC
Parkin	Forward	GTCCAGCAAAGCATCGTTCA	XM_046914604.1
	Reverse	CAACGATGGAAGGATGCTGG
Fundc1	Forward	GTTGTGCTGGGTTCTCATTTAC	NM_001276363.2
	Reverse	TGTTCCTCGGCGTTTCTT
GRP75	Forward	AAGAGGCAGGCAGTAACTAATC	NM_001006147.2
	Reverse	CTTCAGACTTGTCCAGACCATAG
VDAC1	Forward	GCCTGAAGCTGACTTTTGACTCC	XM_046927011.1
	Reverse	GATGTGCTCCCTTTTGTATCCTGT
MCU	Forward	TTGGCAGAGTGTGAGAGTGG	XM_046920626.1
	Reverse	AATTCCTCGGTCCTCTGCTT
LC3I	Forward	TTACACCCATATCAGATTCTTG	XM_040688401.2
	Reverse	ATTCCAACCTGTCCCTCA
LC3II	Forward	AGTGAAGTGTAGCAGGATGA	NM_001031461.2
	Reverse	AAGCCTTGTGAACGAGAT
MFF	Forward	ACTCAAAGTGGCTCCTCA	XM_040679333.2
	Reverse	CCTGCATAGTTACACTGG
PGC1α	Forward	TACAGCAATGAGCCTGCCAA	XM_046916274.1
	Reverse	AGGCAATCCATCCTCATCCAC
Chop	Forward	GCACAGCCCATTTCTGTTTC	XM_015273173.2
	Reverse	TGCCATCCCATTCTGCTAAG
GRP78	Forward	GTTACTGTGCCAGCCTACTT	NM_205491.1
	Reverse	CCGCTTCGCTTTCTCTACTT
ATF4	Forward	TCACCCAATGACAACCCG	NM_204880.3
	Reverse	TCACCTTTGCTGACGCTACC
ATF6	Forward	CGTCGTCTGAACCACTTACTGA	XM_040677276.2
	Reverse	CCTTCTTTCCTAACAGCCACAC
IRE1α	Forward	CTACAGGTCGCTCCTCACATC	XM_046927561.1
	Reverse	ATCAGTCCTTCTGCTCCCATCT
GRP94	Forward	CAAAGACATGCTGAGGCGAGT	NM_204289.2
	Reverse	TCCACCTTTGCATCCAGGTCA

Western blot analysis

Approximately 0.5 mg oviduct magnum tissue was taken and homogenised in the lysis buffer for the total protein extraction. BCA protein determination kit obtained from Beyotime (Shanghai, China) was used to measure the concentrations of total protein. Then, equal volumes of SDS-PAGE loading buffer were added to protein samples and heated at 100 °C for 5 min to denature the protein for the subsequent WB analysis. Western blot analysis was performed according to the previous description (Zhu et al. 2021). Simply put, proteins were separated using gradient SDS-PAGE (4–20%, GenScript, catalogue no. M00657) and then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore). After 12–16 h of incubation with Nrf2 (dilution 1:1000, catalogue no. AF7904, Affinity), Kelch-like ECH-associated protein 1 (Keap1) (dilution 1:1000, catalogue no. AF7335, Affinity), nuclear factor kappa-B (NF-κB) p65 (dilution 1:1000, catalogue no. bs-0465R, Bioss), phosphor-NF-κB p65 (ser536) (dilution 1:1000, catalogue no. bs-0982R, Bioss), LC3I/II (dilution 1:3000, catalogue no. 14600-1-AP, Proteintech), parkin RBR E3 ubiquitin-protein ligase (Parkin) (dilution 1:1000, catalogue no. A11172, Abclonal), PTEN-induced kinase 1 (PINK1) (dilution 1:1000, catalogue no. A7173, Abclonal), the voltage-dependent anion channel 1 (VDAC1) (dilution 1:3000, catalogue no. 55259-1-AP, Proteintech), mitofusin-2 (MFN2) (dilution 1:5000, catalogue no. 12186-1-AP, Proteintech), CHOP (dilution 1:1000, catalogue no. A0221, Abclonal), glucose regulated protein 78 (Grp78) (dilution 1:3000, catalogue no. 11587-1-AP, Proteintech), activating transcription factor 6 (ATF6) (dilution 1:1000, catalogue no. A0202, Abclonal), inositol requiring enzyme 1 alpha (IRE1α) (dilution 1:2000, catalogue no. 27528-1-AP, Proteintech) and GAPDH (dilution 1:5000, as a loading control) antibodies, the membranes were rinsed three times using TBS buffer (1×) containing 0.1% Tween-20. Then, the blots were incubated with the secondary antibody (HRP-labelled goat anti-rabbit IgG, dilution 1:5000, catalogue no. bs-0295G-HRP, Bioss) for 2 h at room temperature. ECL reagent kit (Beyotime) was used for the visual detection of proteins. Digital images were captured using ChemiScope 3400 (Clinx Science Instruments, China).

Statistical analysis

The IBM SPSS Statistics 20.0 software (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. The test data were presented in the form of mean ± standard error (S.E.). Pearson correlation analyses was used to evaluate bivariate correlations. One-way ANOVA followed by Tukey test for post-hoc analyses was used to compare significant difference between groups (p < .05). Linear regression analysis was used to assess the dose-response relationship of Cd exposure with Cd content in serum and magnum tissue.

Results

Cadmium contents in egg white and oviduct magnum tissues

Cd contents in albumen and magnum are showed in Figure 1. The contents of Cd in albumen and magnum were increased linearly with the increase of dietary Cd exposure. The results of linear regression analysis showed that Cd contents in albumen and magnum are significantly correlated with the Cd contents in diet (R² = 0.9766, linear p = .0118 and R² = 0.9204, linear p = .0406, respectively). There was a significant positive correlation between the Cd content in albumen and the Cd content in the magnum tissue (R² = 0.8387, linear p < .01).

Figure 1. Effects of dietary Cd contamination on Cd levels in egg white and magnum of laying hens. Data are presented as mean ± standard error of means (SEM). Different letters (a, b, c, d) indicate significant differences between groups (p < .05). Linear regression analysis was used to assess the dose-response relationship between Cd exposure and Cd contents in albumen and magnum.

Effect of Cd on protein levels in egg white and gene expressions in magnum

We evaluated the OVA and OVM levels in egg white and the expressions of the genes related to egg white protein synthesis, the results were shown in Figure 2. When compared with the control group, the mRNA level of OV gene was up-regulated obviously in the group treatment with 15 mg/kg Cd (p < .05). However, when hens were treated with 30 or 60 mg/kg Cd, the expressions of OV, OVA, LYZ and OVM genes were downregulated significantly (p < .05). In contrast, the expression of AVD gene was upregulated obviously in the group treated with 60 mg/kg Cd (p < .05). In addition, hens receiving the 60 mg/kg Cd diet exhibited much more decreases in the OVA content and its proportion in total protein (p < .05).

Figure 2. Effects of Cd on gene expressions in magnum (A) and protein levels in egg white (B, C) of laying hens. Data are presented as mean ± standard error of means (SEM) (n = 6). Different letters (a, b, c) above the histogram indicate significant differences between groups (p < .05). OV: ovomucin; OVA: ovalbumin; LYZ: lysozyme; OVM: ovomucoid; AVD: avidin.

Effect of Cd on antioxidant parameters in egg whites and magnum of hens

Dietary Cd exposure disrupted the antioxidant status in egg whites and the oviduct magnum tissues of layers and the results were shown in Figure 3. When layers treatment with 60 mg/kg Cd, the activity of GSH-Px was decreased significantly in egg whites, and the GSH content and T-SOD and CAT activities were significantly decreased in oviduct magnum (p < .05). In contrast, the MDA level was increased significantly both in egg whites and magnum tissues compared with the control group (p < .05).

Figure 3. Effect of Cd on the antioxidant ability of the oviduct magnum (A) and egg white (B) of laying hens. Data are presented as mean ± standard error of means (SEM) (n = 6). Different letters (a, b, c) above the histogram indicate significant differences between groups (p < .05). GSH: glutathione; GSH-Px: glutathione peroxidase; T-SOD: total superoxide dismutase; CAT: catalase; MDA: malondialdehyde.

Effect of Cd on serum and yolk lipid contents of hens

The serum and egg yolk lipid contents are listed in Table 3. Hens receiving the 60 mg/kg Cd diet exhibited much more increases in the levels of total cholesterol, HDLC or LDLC in serum and egg yolk compared with the control group (p < .05).

Table 3. Effect of Cd on the serum and yolk lipids in laying hens.

Items	Dietary Cd dosage, mg/kg				SEM	p Value
	0	15	30	60
SERUM, mmol/L
T-CHO	3.25^b	4.16^ab	3.81^ab	5.01^a	0.442	.013
TG	17.12	19.26	15.28	10.24	3.491	.116
HDLC	0.51^b	1.31^ab	2.02^ab	4.55^a	0.806	.005
LDLC	0.99^b	1.16^b	1.40^b	2.71^a	0.393	.005
EGG YOLK, mg/g
T-CHO	19.11^b	20.62^ab	24.01^a	24.68^a	1.472	.005
TG	53.43	49.82	61.14	60.73	6.073	.223
HDLC	2.61	3.10	3.45	3.00	0.596	.580
LDLC	10.36^b	13.23^ab	13.23^ab	17.01^a	2.097	.055

Notes: SEM: standard error of the means; T-CHO: total cholesterol; TG: triglyceride; HDLC: high density lipid-cholesterol; LDLC: low density lipid-cholesterol. Values are presented as the mean and SEM (n = 12).

^a–bMeans within a row with different superscripts are significantly different (p < .05).

Effect of Cd on the Nrf2 signalling pathway in the oviduct magnum of hens

The results of dietary Cd exposure affecting the Nrf2 signalling pathway are presented in Figure 4. When compared with the control group, the expressions of NQO1 and HO-1 genes were up-regulated obviously in layers treated with 15 mg/kg Cd and then down-regulated in layers treated with 30 or 60 mg/kg Cd. In layers treated with 30 and 60 mg/kg Cd, the mRNA level of Nrf2 was down-regulated obviously (p < .05). Besides, the mRNA levels of Nrf2-dependent genes SOD1, glutamate-cysteine ligase catalytic subunit (GCLC) and glutamate-cysteine ligase modified subunit (GCLM) were significantly upregulated in layers treated with 15 or 30 mg/kg Cd (p < .05), while the expressions of SOD1, SOD2 and SOD3 were downregulated in layers treated with 60 mg/kg Cd obviously (p < .05). The mRNA level of GST was upregulated significantly in 60 mg/kg Cd group (p < .05). Results from western blot revealed that, when compared with the control group, the expressions of Nrf2 proteins were downregulated in layers treated with 30 and 60 mg/kg Cd obviously (p < .05). However, 30 and 60 mg/kg Cd exposure induced a significant upregulation of Keap1 protein, the key repressor of Nrf2 (p < .05).

Figure 4. Effects of Cd on the Nrf2 signalling pathway in the oviduct magnum of laying hens. (A) Nrf2 pathway related gene expression; (B) Nrf2 and Keap1 protein expression levels. Data are presented as mean ± standard error of means (SEM) (n = 6). Different letters (a, b, c) above the histogram indicate significant differences between groups (p < .05). **p < .01 indicates a significant difference compared to the control group. Nrf2: nuclear factor-erythroid 2 p45-related factor 2; Keap1: kelch-like ECH-associated protein 1; NQO1: NAD(P)H quinone dehydrogenase 1; HO-1: haem oxygenase 1; GCLC: glutamate-cysteine ligase catalytic subunit; GCLM: glutamate-cysteine ligase modified subunit.

Effect of Cd on the inflammatory response in oviduct magnum

As presented in Figure 5, the mRNA levels of pro-inflammatory factors (interleukin 6 (IL-6), interleukin 1β (IL-1β) and tumour necrosis factor α (TNFα)) and NF-κB were performed by qRT-PCR. The 60 mg/kg Cd exposure obviously up-regulated the expressions of IL-1β, TNFα and NF-κB genes (p < .05). In contrast, the expression of IL-6 gene was downregulated obviously in layers treated with 30 and 60 mg/kg Cd compared with the control group (p < .05). The results of WB showed that the protein levels of NF-κB p65 and p-p65 were increased significantly in 60 mg/kg Cd group compared with the control (p < .05).

Figure 5. Effects of Cd on the expression of inflammatory factors in the oviduct magnum of laying hens. Data are presented as mean ± standard error of means (SEM) (n = 6). Different letters (a, b, c) above the histogram indicate significant differences between groups (p < .05). **p < .01 indicates a significant difference compared to the control group. IL: interleukin; TNFα: tumour necrosis factor α; NF-κB: nuclear factor kappa-B.

Effect of Cd on endoplasmic reticulum stress

The genes and proteins related to ER stress (ERS) were detected and the result was presented in Figure 6. The expressions of the activating transcription factor 4 (ATF4), ATF6, IRE1α, ER chaperones genes Chop, Grp78 and glucose regulated protein 94 (Grp94) were up-regulated significantly in the group treatment with 60 mg/kg Cd compared with the control group (p < .05).

Figure 6. Effects of Cd on endoplasmic reticulum-stress in the oviduct magnum of laying hens. Data are presented as mean ± standard error of means (SEM) (n = 6). Different letters (a, b, c) above the histogram indicate significant differences between groups (p < .05). *p < .05 and **p < .01 indicates a significant difference compared to the control group.

Effect of Cd on mitochondrial function and dynamics

We evaluated the effect of Cd on mitochondrial function and dynamics and the results were shown in Figure 7. When compared with the control group, the mRNA levels of mfn1, mfn2 and peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC1α) were down-regulated significantly in the 60 mg/kg Cd group (p < .05). The mRNA levels of the PINK1, Parkin, FUN14 domain containing 1 (FUNDC1), glucose regulated protein 75 (GRP75), VDAC1, mitochondrial calcium uniporter (MCU), mitochondrial fission factor (MFF) and autophagy-related proteins Bnip3 and LC3 were upregulated significantly in 30 or 60 mg/kg Cd groups compared with the control group (p < .05). Then, we further verified the expressions of some proteins by WB and the results showed that the levels of VDAC1, PARKIN, PINK1 and LC3II proteins were up-regulated significantly in 30 and 60 mg/kg Cd groups, and the level of MFN2 protein was decreased significantly in 60 mg/kg Cd group compared with the control group (p < .05).

Figure 7. Effects of Cd on mitochondrial function and dynamics in the oviduct magnum of laying hens. Data are presented as mean ± standard error of means (SEM) (n = 6). Different letters (a, b, c) above the histogram indicate significant differences between groups (p < .05).

Discussion

Cadmium is a bioaccumulative toxic heavy metal element that can accumulate in reproductive organs and cause reproductive system disorders (Zhang et al. 2020; Zhu M et al. 2020). In the present study, we observed that Cd could dose-dependently deposited in the magnum tissue and a positive correlation occurred between the Cd accumulation in the magnum and Cd content in egg whites. Previous researches have indicated that environmental Cd exposure was usually associated with chickens’ fallopian tube damage and poor egg quality, including poor eggshell and egg white quality (Leach et al. 1979). In the daily cycle, the oviduct magnum epithelial cells of egg-laying hens synthesise and secrete a large amount of egg white proteins, including OV, OVA, LYZ, OVM and AVD. OV plays a key role in the gel properties of egg whites and determines their albumen height and haugh unit, while OVA content is likely a key factor in determining egg size (Jung, Lim, et al. 2011; Jung, Park, et al. 2011; Wang et al. 2019). We assessed the impacts of dietary Cd on the expression of major genes involved in egg white protein synthesis in oviduct magnum of laying hens. Results indicated that the expression of OV, OVA, LYZ and OVM genes were obviously down-regulated when layers treated with 60 mg/kg Cd. Correspondingly, we continued to evaluate the levels of OVA and OVM in egg whites and found that the OVA content, that is, its proportion of total protein, was significantly reduced when layers treated with 60 mg/kg Cd. Ovalbumin is the most abundant protein in egg white, accounting for more than 50% of the total egg protein (Kanaka et al. 2021). The OVA expression in the oviduct magnum of layers has been demonstrated to be related to laying rate (Zhao et al. 2016). This is consistent with our findings (Zhu M et al. 2020). Additionally, we found that 60 mg/kg Cd exposure obviously increased the expression of AVD gene, which is also a critical egg white antimicrobial protein with a strong ability to bind biotin (Krkavcova et al. 2018). However, the increased concentration of AVD in egg white may adversely affect the innate immunity of newborn chicks (Bonisoli-Alquati et al. 2007). Accordingly, Cd can accumulate in oviduct magnum and egg white, damaging oviduct magnum protein synthesis and secretion as well as egg white protein composition.

Cadmium has been known as a reproductive toxicant, and the induction of oxidative stress is widely considered as one of the major mechanisms by which Cd exerts reproductive toxicity (de Angelis et al. 2017). Cd is implicated in the increase of ROS and the induction of oxidative stress through indirect mechanisms, that is, by affecting the activity of ROS scavengers or depleting GSH (Stohs and Bagchi 1995; Valko et al. 2005). Cd exposure can lead to oxidative damage and apoptosis of hens’ shell-gland, kidney, ovary and hepatocytes (Zhu M et al. 2020; Zhu MK et al. 2020; da Costa et al. 2021; Zhu et al. 2021). In the present study, the concentration of Cd exposure decreased the activities of CAT and T-SOD and the level of GSH and increased the content of MDA in the magnum tissue. These specific biomarkers are considered to be closely related to oxidative stress responded to Cd exposure. Base on this, we speculate that Cd exposure may further destroy the antioxidant status of egg whites. Therefore, we evaluated the activities of antioxidant enzymes and lipid peroxidation levels in egg whites and found that egg-laying hens that received Cd showed reduced the activity of GSH-Px and increased lipid peroxidation in eggs. This possibly impair the shelf life of the eggs.

The serum and yolk lipid composition depends on the lipid synthesis in liver. Our previous study has demonstrated that Cd can regulate the accumulation of lipids in hens’ liver by regulating the expression of key enzymes in the fatty acid synthesis and β-oxidation process (Zhu MK et al. 2020). In the present study, we evaluated the effects of Cd on serum and yolk lipid changes, and the results showed that hens received Cd exhibited much more increases in the levels of T-CHO, HDLC or LDLC in serum and yolk. Changes in lipid levels in the blood caused by Cd contamination have also been reported in other species of animals (Samarghandian et al. 2015). However, the effect of Cd on cholesterol content in egg yolk of laying hens has not been studied. Nevertheless, the increased T-CHO and LDLC in egg yolk caused by cadmium treatment may not be conducive to human health.

A major function of Nrf2 that has been extensively studied is its role in resistance to oxidative stress (Ma 2013). Nrf2 is considered to be the “master regulator” of the antioxidant reaction, which protects cells from the toxicity of free radical by modulating the expression of genes encoding antioxidants through interacting with the antioxidant response elements (ARE) (Hybertson et al. 2011; Montes et al. 2015). Many studies have shown that Nrf2 signalling pathway can attenuate the toxicity of multiple organs induced by Cd, including in the kidney, testicular, liver, etc. (Wu et al. 2012, 2014; Shi and Fu 2019). In this study, the transcription or protein expression level of Nrf2 were obviously downregulated in 30 and 60 mg/kg Cd treatment groups. Meanwhile, the expressions of Nrf2 target genes NQO1, HO-1, GCLC and GCLM also showed similar trends. Keap1, as a key endogenous repressor of Nrf2, can control the stability and accumulation of Nrf2 (Huang et al. 2015; Taguchi and Yamamoto 2017). In this study, the rapid up-regulation of Keap1 protein expression level in the 60 mg/kg Cd group further confirmed the inhibitory effect of Cd on the Nrf2 signalling pathway. Besides, the expressions of Nrf2-activited genes SOD1, SOD2 and SOD3 genes were down-regulated significantly in the 60 mg/kg Cd treatment group. It was consistent with the change trend of T-SOD activity in the magnum tissue. Inflammation is a protective response of organism to injury. Many studies have indicated that Cd exposure impaired innate immune parameters, triggered ROS generation and inflammation (Zhu M et al. 2020; Zhu MK et al. 2020). Consistently, the current study found that Cd exposure upregulated the expressions of TNFα, IL-1β, NF-κB genes and NF-κB p65 and p-p65 proteins obviously in the magnum. IL-1 and TNFα represent the typically pro-inflammatory cytokines that are released rapidly in response to tissue damage or infection (Labow et al. 1997; Udalova et al. 2016), which have also been identified as the downstream targets of NF-κB (Jha and Das 2017). Studies demonstrated that Nrf2 not only participates in the regulation of oxidative/xenobiotic stress response but also suppresses the inflammatory response. The decrease in Nrf2 with subsequent increase in oxidative stress markers led to the activation of TGF-β and NF-kB (Bhowmick et al. 2019). These results suggested that Cd exposure triggered an inflammatory response in the magnum tissue, and this effect may be mediated by activating NF-κB via inhibiting the Nrf2 signalling pathway.

In previous studies, ERS was found to induce mitophagy. Autophagy may be thought of as a cyto-protective response to an overload of unfolded or misfolded proteins during ERS (Lv et al. 2015). Blocking the activation of the ERS response has been proved to prevent the mitophagy process (Gao et al. 2020). In the present study, we found that oviduct magnum expression of ATF4, ATF6, IRE1α, CHOP, GRP78 and GRP94 genes and/or proteins was significantly increased after 60 mg/kg Cd contamination. Excessive ROS accumulation is a critical activator of ERS, leading to mitochondrial Ca²⁺ accumulation via IP₃R–GRP75–VDAC1 complex and consequently programmed necrosis (Lin et al. 2021). IRE1α at the membrane contact sites (mitochondria-associated endoplasmic reticulum membrane, MAMs) has an important influence on Ca²⁺ movement within the cellular reticular network. IRE1α reportedly forms a stable complex with IP3R which is necessary for the localisation of IP3R at the MAMs (Agellon and Michalak 2019). Furthermore, we detected the expression of MAMs and mitochondrial function-related proteins, and the results showed that Cd exposure obviously upregulated the gene and/or protein levels of GRP75, VDAC1 and MCU. These results suggested that Cd may induce mitochondrial Ca²⁺ overload by IRE1α/IP3R/GRP75/VDAC1/MCU signal axis, which will further lead to mitochondrial dysfunction and mitophagy occurs. This conclusion was supported by decreased expression of MFN1, MFN2 and PGC1α genes and/or proteins while increased expression of PINK1, Parkin, Fundc1, Bnip3, LC3I and LC3II genes and/or proteins.

Conclusion

This study results collectively show that Cd can dose-dependently accumulate in the oviduct magnum, which is closely related to the Cd content in egg white. Cd exposure can destroy the egg white composition by affecting the synthesis and secretion of egg white protein in oviduct magnum. Cd destroys the antioxidant status of egg white and increases cholesterol level of yolk. Cd-induced chicken’s magnum toxicity is closely associated with reduced antioxidant defense, activation of inflammatory responses, ERS and mitophagy, in which Nrf2/NF-κB and IRE1α/IP3R/GRP75/VDAC1/MCU signal axis play a crucial role.

Ethical approval

The study was conducted in accordance with the Jiangsu university of science and technology (G2022SJ12, Zhenjiang, China) and approved by the Ethics Committee.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data that support the findings of this study are available from the corresponding author, upon reasonable request.

Additional information

Funding

This study was supported by the earmarked fund for Jiangsu Provincial Double-Innovation Doctor Program (JSSCBS20211011), the Natural Science Foundation for Universities of Jiangsu Province (22KJB230004) and the Modern Agro-industry Technology Research System of China (CARS-40-K10).