Effects of winter barn feeding and grazing on growth performance, meat quality and rumen fungal community of Tibetan sheep

Abstract

The grazing grassland ecosystem on the Qinghai-Tibetan Plateau is highly impacted by seasonal temperature variations. During the long cold season, the biomass and nutrient contents of forage grass do not meet the nutritional needs of grazing livestock and seriously affect growth performance and livestock products. This study investigated different feeding strategies on growth performance, meat quality and rumen fungal community of Tibetan sheep in the winter. Twelve one-year-old healthy castrated Tibetan sheep with similar initial body weights were randomly grouped into traditional grazing (TG) and barn feeding (BF) groups. The TG sheep were labelled and grazed on the local cool-season pasture without feed supplementing, while BF sheep were fed a mixed diet in feeding shed. Compared with the TG group, significantly increased body weight and average daily weight gain (ADG) were observed in the BF group (p < 0.001), which resulted in a significant increase in the hot carcase weight, net meat weight, carcase rate and net meat rate (p < 0.01). Moreover, the longissimus dorsi muscle of the BF group showed significantly increased muscle fibre diameter, perimeter, and area and increased crude protein and ether extract contents (p < 0.01), while the meat tenderness and amino acid content were reduced. ITS high-throughput sequencing showed that Ascomycota was the predominant fungal phylum in the rumen of Tibetan sheep. At the genus level, the rumen of TG sheep presented higher proportions of Preussia, Anaeromyces and Pilidium, while the most abundant genera in the BF sheep were Penicillium, Acaulium and Vishniacozyma. In summary, BF strategy enhanced the relative abundance of several dominant fungal genera related to the nutrient absorption and metabolism capacity, and effectively improves the growth and slaughter performance and affects meat quality of Tibetan sheep in the winter.

Highlights

• Growth and slaughter performance effectively improved under the barn feeding (BF) strategy.

• The mutton of BF group had higher crude protein and ether extract contents, and lower amino acid content.

• Barn feeding strategy enhanced the rumen nutrient absorption and metabolism capacity by altering the relative abundance of several dominant fungal genera.

Keywords:

• Tibetan sheep
• feeding strategies
• growth performance
• meat
• rumen fungi

Introduction

Tibetan sheep (Ovis aries), which are the major indigenous livestock on the Qinghai-Tibetan Plateau in China, with over 50 million heads, provide an important economic resource for local pastoralists, such as meat and pelage (Xin et al. 2011; Wang et al. 2021). The grassland ecosystem of the plateau is fragile and sensitive to seasonal fluctuations. In summer, the forage grass has the advantages of fast growth, high yield and good nutritional quality and can provide adequate nutrition for grazing sheep. As the season progresses, the production and nutritional value of forage grass gradually decrease until the following spring (Zhao and Zhou 1999). However, the reduction in forage yield and nutritional value in winter fail to deliver an adequate supply of nutrients to the sheep for their full growth potential (Gui et al. 2021; Hou et al. 2021). Therefore, to avoid serious economic losses to the Tibetan sheep industry during the long cold season, it is necessary to conduct more research on nutrition and feeding strategies.

More recently, numerous studies have revealed that supplementary feeding in winter can be efficacious in modulating the adverse effects of the cold season on animal health and growth performance. A previous study demonstrated that feeding the total mixed ration diet, oats silage and oats hay could significantly increase the live weight, feed efficiency and economic gain of Tibetan sheep and yaks during the cold season (Xu et al. 2017). Furthermore, a study indicated that supplementing concentrate feed and multi-nutrient blocks in the cold season could significantly improve the average daily gain, volatile fatty acid production and rumen absorptive capability of Tibetan sheep (Jing et al. 2018). Moreover, many studies have demonstrated that meat composition are also influenced by the feeding strategies in animal husbandry production, and that barn feeding (BF) has more advantages than traditional grazing (TG; López-Bote et al. 2008; Martins et al. 2015). The above-mentioned studies showed that both the growth performance and livestock products are related to the animal nutrient intake, absorption and metabolism.

The rumen, the first chamber of the ruminant stomach, is a unique digestive organ of ruminants, which contains various and abundant microorganisms (Ma et al. 2019; Zou et al. 2019). Bacteria, archaea, fungi and protozoa constitute the rumen microbial community, which participates in the complex food digestion process (Wang et al. 2017; Li et al. 2019). A considerable number of studies have indicated that breed (Greenwood et al. 2022), sex (Han et al. 2020), age (Jami et al. 2013), health status (Hook et al. 2011) and dietary nutrition level (Zhang et al. 2017) can affect the diversity and composition of the rumen bacterial flora in ruminants. In the rumen ecosystem, fungi account for up to 8% of the total microorganisms, reaching 103–105/mL zoospores (Rezaeian et al. 2004). Members of fungi, although at a very low relative abundance in rumen, are usually critical for the digestion of forage. Related studies have shown that anaerobic fungi in the rumen are the main producers of cellulases, ligninases and other hydrolytic enzymes, which can attach to highly lignified tissue and render the plant cell wall tissue hydrophobic through extensive mycelial penetration and expansion (Rabee et al. 2019; Elghandour et al. 2020). Ultimately, fungi facilitate the entry of other microorganisms in the rumen into more difficult lignocellulosic feeds and increase the utilisation of roughage by up to 37–50%. However, the characteristics of ruminal fungi and their corresponding influencing factors in Tibetan sheep remain unclear.

In this study, the assessment of different feeding strategies on growth and slaughter performance, and meat quality of Tibetan sheep were investigated. Internal transcribed spacer (ITS) high-throughput sequencing technology was used to study the diversity and community structure of fungi in the rumen of Tibetan sheep. To a large extent, our study can provide a theoretical basis for nutrient regulation in Tibetan sheep and other high-altitude livestock in the winter on the Qinghai-Tibetan Plateau.

Materials and methods

Ethics statement

The animal procedures in this study were approved by the Experimental Animal Use Ethics Committee of the Northwest Institute of Plateau Biology, Chinese Academy of Sciences (Permit No. NWIPB20160302).

Experimental design

The experiment was conducted in the Haibei Demonstration Zone of Plateau Modern Ecological Husbandry Science and Technology (36°55′N, 100°57′E, altitude at 3,150 m) in Qinghai Province, China. A total of twelve one-year-old healthy castrated Tibetan sheep with similar initial body weights (BW: 31.75 ± 0.63 kg) were randomly assigned to two treatment groups with six sheep per group. The TG sheep were labelled and grazed with livestock crowd on the local cool-season pasture without feed supplementing, grazing activities usually lasted from 08:30 to 17:30 (about 9 h per day), then entered shelter for overnight (Xu et al. 2017). The plant community of natural pasture is dominated by Kobresia humilis, Leymus secalinus, Elymus nutans, Stipa purpurea, Carex aridula and Potentilla acaulis. The BF sheep were fed a mixed diet of 50% oat hay and 50% commercial concentrate at 08:00 and 17:00. The experiment lasted for 105 d, and all sheep were provided with water ad libitum. The natural pasture was sampled using sample squares (0.5 m × 0.5 m) randomly thrown in the centre of the grazing pasture, with 6 samples collected at a time in which the pasture was cut to approximately 2 cm above the ground. All collected diets were oven dried at 60 °C for 48 h and individually ground with a grinder to pass a 1 mm sieve for nutritional quality determination. The details of the nutrient composition of the diets were measured according to AOAC procedures (AOAC 2007) and are listed in Table 1. At the end of the experiment, the Tibetan sheep were weighed and transported to a commercial abattoir for slaughter experiments. Prior to slaughter, Tibetan sheep were fasted for 24 h. The carcase weight and net meat weight were recorded and used to calculate slaughter performance.

Table 1. Nutrient composition of the experimental diets (on a dry matter basis).

Item	Group
	TG	BF
Ingredients, %
Oat hay	–	50.00
Corn	–	12.00
Wheat	–	10.50
Wheat bran	–	8.00
Soybean meal	–	7.50
Rapeseed meal	–	9.50
NaCl	–	0.50
CaHPO4·2H2O	–	0.30
Bentonite	–	0.50
CaCo3	–	0.45
NaHCo3	–	0.25
Premix	–	0.50
Nutrients levels
Crude protein, CP	4.31	14.10
Ether extract, EE	1.05	2.98
Neutral detergent fibre, NDF	54.87	32.65
Acid detergent fibre, ADF	33.53	19.98

TG: traditional grazing group; BF: barn feeding group

Premix provided per kg of feed: Vitamin A, 50,000 IU; Vitamin D3, 12,500 IU; Vitamin E, 1000 IU; Cu, 250 mg; Fe, 12,000 mg; Zn, 1000 mg; Mn, 1000 mg and Se, 7.5 mg.

Determination of muscle fibre characteristics and meat quality

After slaughter, longissimus doris muscle tissue (1 cm³) was collected and fixed in 4% paraformaldehyde overnight. After dehydration in a series of gradient ethanol solution and clearing using xylene, all samples were embedded in paraffin and sliced into 5 μm thick sections. Sections were stained with haematoxylin and eosin (H&E) to examine the histological characteristics of muscle fibres, which were determined using the electron microscope (Axio IMAGE Z2, Leica Microsystems Ltd., Wetzlar, Germany). Besides, 200 g longissimus doris muscle sample was used to determine the common nutrient contents according to the AOAC procedures (AOAC 2007). The amino acid profiles were determined using an automatic amino acid analyser (S433D, Sykam Ltd., Eresing, Germany).

Microbial DNA extraction, ITS gene amplification, sequencing and bioinformatic analysis

Total genomic DNA was extracted from rumen fluid samples using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany). Fungal ITS1 primers (F: CTTGGTCATTTAGAGGAAGTAA and R: GCTGCGTTCTTCATCGATGC) were used to amplify the ITS1 region (Hristov et al. 2013). The PCR products were sequenced on an Illumina NovaSeq 6000 platform. After sequencing, the raw sequences were analysed using the QIIME2 software (Bolyen et al. 2019). High-quality sequences were binned into operational taxonomic units (OTUs) based on 97% sequence similarity and the most abundant sequence within each OTU was identified as the representative sequence. Rarefaction curves of the samples were drawn using R version 3.5.3 (R Development Core Team, Vienna, Austria). Alpha diversity indices were calculated using QIIME2. For beta diversity, the variation in the microbial composition between the two groups was investigated using the weighted and unweighted UniFrac distance methods (Lozupone et al. 2011), and these distances were presented using principal coordinate analysis (PCoA) and unweighted pair group method with arithmetic mean (UPGMA) cluster analysis. In addition, linear discriminant analysis effect size (LEfSe) was used to identify the enriched fungal taxonomy from each fraction (LDA score > 4) (Segata et al. 2011), these results were analysed by the online platform BMKCloud (https://www.biocloud.net).

Statistical analysis

In this study, all data were tested and were all presented as normal distribution. All the data are presented as the means with the standard error. The comparative analysis of growth and slaughter performance, meat quality and fungal community was performed using Student’s t test with SPSS version 22.0 (SPSS Inc., Chicago, IL), and differences were considered statistically significant at p < 0.05.

Results

Growth and slaughter performance

The growth and slaughter performance are listed in Table 2. There was no significant difference in the initial BW between the two groups. At the end of the experiment, the final BW and average daily weight gain (ADG) were significantly higher in the BF group compared with those in the TG group (p < 0.001). Similarly, the slaughter performance (based on hot carcase weight, net meat weight, carcase rate and net meat rate) in the BF group was significantly higher than that in the TG group (p < 0.01).

Table 2. Assessment of feeding strategies on growth and slaughter performance.

Item	Group		p Value
	TG	BF
Growth performance
Initial body weight (BW), kg	31.87 ± 0.16	31.33 ± 0.75	0.121
Final BW, kg	32.65 ± 0.52	52.83 ± 2.79	0.000
Average Daily Gain (ADG), g/d	7.45 ± 4.36	204.80 ± 27.60	0.000
Slaughter performance
Hot carcass weight, kg	14.07 ± 0.30	26.19 ± 1.55	0.000
Net meat weight, kg	10.45 ± 0.49	19.95 ± 1.19	0.000
Carcass rate, %	43.11 ± 0.76	48.97 ± 2.93	0.008
Net meat rate, %	32.04 ± 1.19	37.31 ± 2.32	0.007

TG: traditional grazing group; BF: barn feeding group

Histological characteristics of muscle fibres

As shown in Figure 1, the diameter, perimeter and area of the muscle fibres in the TG group were significantly smaller than those in the BF group (p < 0.001). However, the muscle fibre density showed the opposite trend; that is the TG group had a higher muscle fibre density compared with that in the BF group (p < 0.001).

Figure 1. Assessment of feeding strategies on the histological characteristics of longissimus dorsi muscle fibre. TG: traditional grazing group; BF: barn feeding group; ***p < 0.001.

Meat quality

The nutrient contents of the longissimus dorsi muscle of Tibetan sheep are shown in Table 3. The dry matter, crude protein and ether extract contents were significantly higher in the BF group compared with those in the TG group. As shown in Figure 2, eight essential amino acids (EAA) and nine non-essential amino acids (NEAA) of longissimus dorsi muscle were detected using an automatic amino acid analyser. The glycine (Gly), alanine (Ala), valine (Val), isoleucine (Ile), methionine (Met) and glutamic acid (Glu) contents were significantly higher in the TG group compared with those in the BF group (p < 0.05). In addition, the total amino acid (TAA), EAA and NEAA contents were significantly higher in the TG group compared with those in the BF group (p < 0.05).

Figure 2. Assessment of feeding strategies on the amino acid profile of longissimus dorsi muscle. TG: traditional graz ing group; BF: barn feeding group; thr: Threonine; leu: Leucine; phe: Phenylalanine; Met: Methionine; his: Histidine; asp: Aspartic acid; lys: Lysine; ser: Serine; Glu: Glutamic acid; Gly: Glycine; Ala: Alanine; cys: Cystine; tyr: Tyrosine; Ile: Isoleucine; arg: Arginine; pro: Proline; Val: Valine; EAA: essential amino acid; NEAA: non-essential amino acid; TAA: total amino acid; *p < 0.05, **p < 0.01.

Table 3. Assessment of feeding strategies on the nutrient contents of the longissimus dorsi muscle.

Item	Group		p Value
	TG	BF
Dry matter, %	21.04 ± 0.32	24.86 ± 1.51	0.003
Crude protein, %	17.26 ± 0.40	19.27 ± 0.98	0.009
Ether extract, %	1.07 ± 0.09	3.43 ± 0.37	0.000
Crude ash, %	0.96 ± 0.03	1.09 ± 0.09	0.612

TG: traditional grazing group; BF: barn feeding group

Sequencing and fungal diversity in the rumen

Illumina sequencing of ITS1 gene amplicons produced 1,089,950 raw sequence reads from 12 samples, with 90,829 reads from each sample on average. After quality control and chimaera filtration, 1,004,605 high-quality sequencing reads were retained, with an average of 83,717 reads, ranging from 64,717 to 94,372 per sample. Sequences were clustered into OTUs with 97% identity, resulting in 3006 OTUs. Among them, 1966 OTUs were obtained for group BF, and 2304 OTUs were obtained for group TG, among which 1264 OTUs were shared by these two groups (Figure 3(B)). The rarefaction curves (Figure 3(A)) of all samples obtained under the condition of 97% similarity reached a plateau, which indicated that the sequencing depth covered most of the microbiota in the samples. As shown in Figure 3(C–F), alpha diversity was calculated based on the ACE, Chao 1, Shannon and Simpson indices. Although all these indices were higher in the TG group compared with those in the BF group, none of these differences were significant (p > 0.05).

Figure 3. (A) Rarefaction curve; (B) OTU-Venn diagram analysis; (C–F) Alpha diversity index. TG: traditional grazin g group; BF: barn feeding group.

Fungal community composition in the rumen

Overall, 13 phyla, 46 classes, 113 orders, 239 families and 446 genera were identified in the rumen of Tibetan sheep. At the phylum level, the most dominant phylum was Ascomycota, with relative abundances of 51.74% and 69.10% in the TG and BF groups, respectively. Members of other phyla, such as Basidiomycota (4.75% in TG group, 4.74% in BF group), Neocallimastigomycota (5.72% in TG group, 0.29% in BF group), Mucoromycota (3.94% in TG group, 0.10% in BF group), Mortierellomycota (0.39% in TG group, 2.52% in BF group) and Glomeromycota (0.27% in TG group, 0.05% in BF group), were detected at relatively lower abundances (Figure 4(A)). The relative abundance of Mucoromycota and Neocallimastigomycota in TG group was significantly higher than those in BF group (p < 0.05) based on the t test.

Figure 4. Histogram of the top 10 phylum (A) and genus (B) and comparison of significantly different genera between two groups (C). TG: traditional grazing group; BF: barn feeding group; *p < 0.05, **p < 0.01.

At the genus level, the most abundant fungi in the rumen of Tibetan sheep in the TG group were members of Preussia (26.35%), Thelebolus (9.20%) and Rhizomucor (3.73%) (Figure 4(B)). The most abundant genera in the BF group were Penicillium (37.88%), Acaulium (5.98%) and Vishniacozyma (2.09%). Furthermore, Student’s t test was used to assess significant differences in relative abundance between two groups at genus level, and these data were tested and presented as normal distribution (Figure 4(C)). The relative abundances of Preussia, Anaeromyces, Pilidium and Dipodascus in the TG group were significantly higher compared with those in the BF group (p < 0.05), whereas the abundances of Penicillium, Vishniacozyma, Cladosporium, Paraphaeosphaeria, Coniothyrium and Phaeosphaeria were significantly lower (p < 0.05).

Comparison of fungal communities in the rumen under different feeding strategies

To compare the fungal communities in the rumen of Tibetan sheep under different feeding strategies, PCoA was employed. The results showed that the fungal communities in the TG group were clearly distinct from those in the BF group based on weighted UniFrac distances (Adonis: R² = 0.62; p = 0.003) (Figure 5(A)) and unweighted UniFrac distances (Adonis: R² = 0.18; p = 0.003) (Figure 5(C)). Similarly, the UPGMA cluster analysis results showed that the TG and BF groups clustered in accordance with their treatment (Figure 5(B,D)). As shown in Figure 6, LEfSe analysis revealed the difference in rumen fungi between two groups at various taxonomic levels with LDA scores. 18 fungal taxa (e.g. Sporormiaceae, Preussia, Preussia_africana, Pleosporales, Dothideomycetes and Thelebolales) were enriched in the TG group, while nine fungal taxa (e.g. Tremellomycetes, Acaulium, Microascaceae, Microascales, Sordariomycetes and Penicillium) were enriched in the BF group.

Figure 5. PcoA (principal coordinate analysis) and UPGMA (unweighted pair group method with arithmetic mean) cluster analysis of fungal communities in the rumen based on weighted UniFrac distance (A,B) and unweighted UniFrac distance (C,D). TG: traditional grazing group; BF: barn feeding group.

Figure 6. LEfSe (linear discriminant analysis effect size) analysis Integrated with LDA scores revealed differential biomarker between the different group (LDA score > 4). TG: traditional g razing group; BF: barn feeding group.

Discussion

Growth and slaughter performance

Growth and slaughter performance are important indices that reflect the livestock production levels (Latorre et al. 2004; El Otmani et al. 2021). Body weight, hot carcase weight, carcase rate and net meat rate can accurately evaluate livestock meat production (Matulis et al. 1987). The higher the live body weight, the higher the carcase weight and the greater the carcase rate for meat production. Previous studies have shown that with an increase in the dietary nutrition level, the growth and slaughter performance of livestock are significantly improved (Majdoub-Mathlouthi et al. 2013; Chikwanha et al. 2019). It has been reported that as the dietary concentrate-to-forage ratio increased, a significant linear increase in the live and carcase weight was observed in fat-tailed lambs (Papi et al. 2011). Wang et al. demonstrated that increasing the dietary energy levels could significantly improve growth performance and affect the carcase traits of Hu lambs (Wang et al. 2020). It can be seen that the nutritional level of the diet is very important for the improvement in growth performance and economic benefits of livestock. In this study, the nutritional composition (e.g. crude protein and ether extract) of the mixed diet was significantly better than that of natural grass, and the nutritional intake of Tibetan sheep in the BF group was significantly greater than that in the TG group. This also indicated that only when the nutrition intake by the livestock is high enough can they perform better in terms of growth and slaughter performance based on basal metabolism for life maintenance.

Muscle fibre characteristics and meat quality

The histological characteristics of muscle fibres are effectively quantitative indices for evaluating meat quality and tenderness at the cellular level (Calkins et al. 1981; Ryu et al. 2004). The muscle fibre diameter, area and density are all closely related to meat quality. Previous studies demonstrated that the smaller the muscle fibre diameter, the smaller the muscle fibre area and the greater the muscle fibre density, which means better muscle tenderness and quality (Karlsson et al. 1993; Fahey et al. 2005). According to the findings of this study, the mutton of TG group exhibited the lower diameter, perimeter and area of the muscle fibres. These results suggest that the mutton in TG group is comparatively more tender in texture. However, it could also indicate a lower content of intermuscular fat. In addition, the muscle fibre characteristics are significantly influenced by the dietary nutrition level. A higher nutritional level diet can effectively promote the proliferation and extension of myoblasts in the muscle (Picard et al. 2002; Li et al. 2016). In this study, the high nutritional value of the BF diet could significantly stimulate the growth potential of muscle fibres and effectively promote muscle fibre development.

The meat quality of livestock can be objectively evaluated by measuring the common nutrient contents, including the moisture, crude protein and ether extract contents (Williams 2007). The meat moisture content showed an obvious negative relationship with the fat content and jointly affected the juiciness and tenderness of mutton (Huff-Lonergan and Lonergan 2005). In addition, the crude protein content in longissimus dorsi muscle is also a key factor affecting the meat quality and flavour of livestock products, and the feeding process is an important factor affecting the protein content in livestock meat. It has been reported that high-energy and high-protein diets can increase the protein synthesis efficiency and protein deposition ability in animals and improve the crude protein content in meat (López-Soto et al. 2014). In this study, the longissimus dorsi muscle in the TG group had a higher moisture content and lower protein and ether extract contents compared with those of the BF group, mainly due to the lower nutritional intake and higher energy consumption of the feeding behaviour in the natural grassland.

Amino acids, the basic protein constituents required for animal nutrition, can be synthesised into proteins and transformed into carbohydrates and fats for life activities through oxidation (Wu 2010). In this study, the longissimus dorsi muscle of Tibetan sheep was rich in various amino acids (including eight EAA and nine NEAA) and could provide sufficient nutrition for the human body. Meanwhile, the content of umami amino acids, including aspartic acid, Glu, Gly, Ala, arginine, Met and cysteine, can reflect the meat flavour (Komiya et al. 2020). Our results showed that the contents of several umami amino acids (e.g. Gly, Ala and Glu) and TAAs in TG sheep meat were significantly higher than those in BF sheep. We speculated that this may be due to the higher diversity of dietary components in natural grass.

Rumen fungal diversity and community composition

Ruminal anaerobic fungi are a major fraction of rumen microbes with ligno-carbohydrate complex degrading abilities and hence, they play a vital role in the digestion and nutrition of ruminants (Hartinger and Zebeli 2021; Bhagat et al. 2023). Anaerobic rumen fungi work in synergy with other microorganisms in the rumen, and produce several enzymes, such as cellulases and hemicellulases, that degrade complex carbohydrates into smaller sugars that can then be further fermented by rumen microbiota (Andlar et al. 2018). In this study, the rumen fungal community of TG and BF Tibetan sheep was investigated using ITS gene sequencing.

The fungal richness and diversity in the rumen of Tibetan sheep were not significantly altered by the different feeding strategies. It has been reported that an increasing ratio of dietary concentrate does not significantly influence the alpha diversity of fungal communities based on Shannon and Chao 1 indices in Holstein heifers (Zhang et al. 2017). In addition, a recent study showed that high dietary grain feeding decreased the density of fungi but did not significantly affect the richness and diversity of rumen fungi in goats (Mao et al. 2016). In contrast, the diversity and richness of rumen fungi are likely to be significantly influenced by the species or breed of livestock (Wang et al. 2019; Guo et al. 2020).

At the phylum level, Ascomycota was the most predominant fungal phylum in the rumen of Tibetan sheep, which corresponds to previous results in cashmere goats (Han et al. 2019) and dairy cows (Kumar et al. 2015). As the largest group of microorganisms in the kingdom fungi, Ascomycota efficiently produces β-glucanase and is mainly involved in the degradation of organic substances, such as lignin and keratin, in animals (Mintz-Cole et al. 2013; Beimforde et al. 2014). The functional fungus Phylum Neomeriaceae is extensively distributed within the rumen of herbivores, including Holstein heifers (Zhang et al. 2017), yaks (Wang et al. 2019) and Tibetan goats (Langda et al. 2020), where it performs a critical function in the degradation of lignin cellulose (Gruninger et al. 2014). Our study found that natural pasture grass had a higher content of ADF and NDF compared to BF diet. Consequently, the sheep grazed on the natural pasture had a greater abundance of Neomeriaceae that could efficiently digest the high-fibre lignin content of their ingested diet.

Notably, it was found that the effects of different feeding strategies on the community composition of rumen fungi in Tibetan sheep were mainly reflected in changes at the genus level. The most abundant fungi in the Tibetan sheep rumen of the TG group were members of Preussia and Thelebolus, while the most abundant genera in the BF group were Penicillium and Acaulium. Moreover, comparative analysis and LEfSe analysis revealed that the differential genera mainly included Preussia (TG > BF), Anaeromyces (TG > BF), Penicillium (BF > TG) and Vishniacozyma (BF > TG). Previous studies showed that Preussia was the genus with the highest abundance in the rumen and faeces of cattle and yaks living on the plateau without supplementary feeding in winter (Wu et al. 2021; Li et al. 2022). It is reported that Preussia has good antibacterial and antioxidant capacity (Mapperson et al. 2014; Paudel et al. 2018). We found that Preussia abundance has shown an increasing trend in the TG group, which may indicate that sheep disease resistance, immune system development and environmental adapt ability are enhanced with the harsh environment and shortage of food. The genus Thelebolus was found to be significantly more abundant in fescue-infected cows, suggesting a negative effect on ruminal health and performance (Koester et al. 2020). In addition, recent studies have shown that Thelebolus can produce a cytotoxic exopolysaccharide named thelebolan (Mukhopadhyay et al. 2014). Our results suggest that the genus Thelebolus can limit the digestion of nutrients and reduce the absorption ability of naturally grazing Tibetan sheep. Furthermore, our results are in agreement with those of a previous study on goats, which showed that the relative abundance of Penicillium significantly increased as the ratio of dietary concentrate to forage increased (Han et al. 2019). In summary, the differences and changes in the rumen fungal community were mainly induced by alterations in environmental conditions and diet composition. Further in-depth research into the underlying microbial mechanism is required.

Conclusions

In conclusion, this investigation confirmed that BF effectively improved the growth and slaughter performance of Tibetan sheep and increased the crude protein and ether extract contents of the longissimus dorsi muscle in the winter. Furthermore, ITS high-throughput sequencing showed that the different feeding strategies did not significantly influence the rumen fungal diversity but altered the relative abundance of several dominant genera related to the nutrient absorption and metabolism capacity of Tibetan sheep. This study provides a better understanding of rumen fungi and can lead to improvements in ruminal feed management and nutritional regulation in the Qinghai-Tibetan Plateau.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

All raw sequences obtained in this study were submitted to the NCBI Sequence Read Archive (SRA) database and can be found in online repositories under accession number PRJNA831560.

Additional information

Funding

This work was funded by the Natural Science Foundation of Qinghai Province (2023-ZJ-981Q), the Joint Research Project of Sanjiangyuan National Park (LHZX-2022-02), the Second Comprehensive Scientific Expedition to the Qinghai-Tibet Plateau (2019QZKK040104) and the CAS ‘Light of West China’ for Interdisciplinary Innovation Team (CASLWC-2021).