Polymorphism and promoter methylation-regulated mRNA expression of IFI6 gene affect meat quality in pigs

Abstract

This study examined the association, promoter methylation of Interferon alpha-inducible protein 6 (IFI6) gene, and their effects on mRNA expression and meat quality traits in pig. Muscle samples (n=300) were randomly collected from the Longissimus thoracis et lumborum (LTL) to determine meat quality traits including drip loss, thawing loss, cooking loss, meat pH [at 45 minutes (pH45min) and at 24 hours (pH24h) post-mortem], shear force (for tenderness), and lightness (L*) in pigs. Genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Muscle samples (5 per group) with divergent meat pH (low vs high) were selected for promoter methylation study using bisulfate and pyrosequencing. Muscle samples from animals (5 per group) with divergent phenotypes (low vs high meat pH and low vs high drip loss) were used for mRNA expression study by quantitative real-time polymerase chain reaction (qRT-PCR). Results showed that a polymorphism in IFI6 gene (g.370A>G) was significantly (P < 0.01) associated with meat pH24h. Furthermore, four CpG regions were identified in IFI6 promoter, of which DNA methylation in a CG site was higher in low meat pH24h group compared to high meat pH24h group (P < 0.05). The mRNA expression of IFI6 gene was significantly (P < 0.01) downregulated in low meat pH24h group than high meat pH24h group. This result postulated that high DNA methylation at CG site in the promoter region might downregulate the IFI6 gene expression, hence lower the muscle pH that might lead to higher drip loss and lower tenderness. Therefore, porcine IFI6 gene might be a potential candidate gene for meat quality trait in pig. Nevertheless, further research is needed to confirm the role of IFI6 gene in controlling meat quality traits in other commercial populations.

HIGHLIGHTS

• This study analysed association of a SNP in IFI6 gene with meat quality traits, and promotor methylation and transcriptome expression of IFI6 gene in relation to meat pH.

• The result suggested that polymorphism affects meat pH.

• The high DNA methylation at a specific CG site in the IFI6 promoter is involved in IFI6 gene downregulation in low meat pH.

Keywords:

• IFI6
• SNP
• methylation
• expression
• meat pH

Introduction

Meat quality has a great economic impact in livestock industries including pig industry because it affects consumers’ purchase decision. Additionally, genetics has still a limited effects on meat quality traits. Most of the meat quality traits are low to moderate heritable and advanced molecular technology have made it possible to identify genes and markers affecting meat quality (Gao et al. 2007). Hence genetic improvement of meat quality through selection breeding is becoming a very powerful and useful tool in livestock industries. Due to advancement of sequencing and genotyping technologies, many high quality annotated livestock genomic sequences, sequence polymorphisms, and quantitative trait loci (QTL) controlling complex meat quality traits are available (Davoli and Braglia 2007). Single-nucleotide polymorphisms (SNPs) are considered as the most useful genetic marker to be incorporated in breeding policies in pork industry (Abd El-Hack et al. 2018). There are several association studies devoted to identifying SNPs in candidate genes that are associated with meat quality in pigs (Reardon et al. 2010; Gandolfi et al. 2011; Kayan et al. 2011; Wang et al. 2012; Zhang et al. 2014). Genetic variations are largely responsible for phenotypic variability. Most of the genetic variations or polymorphisms (single nucleotide polymorphism, SNPs) exert their effects through interactions with epigenetic mechanisms, such as DNA methylation, histone modification, transcription factors (TFs), and microRNAs (Vohra et al. 2020). Furthermore, recent studies suggested that DNA methylation control the post-transcriptional gene expression, thus control the protein synthesis and phenotypic traits in human and animal including pigs (Yang et al. 2016; Ponsuksili et al. 2019; Wang and Kadarmideen 2019; Villicaña and Bell 2021). The interactions of SNPs with epigenetic factors are found to be involved in various types of cancers, autoimmune diseases, cardiovascular diseases, diabetes, and asthma in humans (Bell et al. 2010; Ling 2020; Vohra et a. 2020), and in animal disease, fat deposition, meat quality and carcase quality, oocyte masturbation, male fertility and immune traits in livestock (Laenoi et al. 2012; Liu et al. 2015; Yang et al. 2016; Abdalla et al. 2018; Khezri et al. 2019; Corbett et al. 2022; Li et al. 2022). Besides, recent advantages in animal genomics have made significant strides in elucidating the complex relationships between DNA methylation and gene expression affecting the meat quality (Siegfried and Simon 2010). DNA methylation is one of the most important epigenetic phenomena influencing gene expression. Methylation-regulated changes at a specific cytosine-guanine (CpG) site, rather than the entire promoter region, may be sufficient to change gene expression (Zhang 2018). Several studies have identified methylation in candidate genes affecting meat quality and muscle characteristics in pig (Gandolfi et al. 2011; Kayan et al. 2013; Hao et al. 2016; Wang et al. 2021; Zhang et al. 2022). Among the meat quality traits, post-mortem decrease in meat pH that occurs during the conversion of muscle into meat is crucial. A rapid pH decrease may lead to PSE-like abnormal quality meat development (Jankowiak et al. 2021). However, very limited studies are devoted to examining candidate genes using both association and methylation approaches in pigs. Although many putative candidate genes and markers affecting meat quality traits in pigs have been reported, interferon alpha-inducible protein 6 (IFI6), a gene with anti-apoptotic function and maintaining cellular integrity is required to study further in relation to meat quality (Tahara et al. 2005; Qi et al. 2015). IFI6 regulates mitochondria and Ca²⁺ channels in the endoplasmic reticulum, which is critical in regulating apoptosis and cellular integrity in myocytes (Tahara et al. 2005). Ca²⁺ is essential for muscle contraction in skeletal muscle, acts as an activator of proteolytic enzymes, and impacts on apoptotic activation in post-mortem muscle that contribute to post-mortem proteolysis, meat pH and tenderisation (Poleti et al. 2018). The increased intracellular Ca²⁺ concentration caused a faster pH decrease (acidification) that affects other meat quality traits including drip loss and tenderness (Honikel et al. 1986; Küchenmeister et al. 2000). Furthermore, IFI6 gene is mapped on SSC6 in a region which incorporated several QTLs for meat pH and water holding capacity (Duthie et al. 2011; Fabbri et al. 2020). We previously identified that IFI6 gene was associated with drip loss, meat colour, and meat pH in Duroc × Pietrain population (Kayan et al. 2011), however, further association study in commercial population and methylation examination are warranted. The present study wanted to investigate the potential regulatory roles of DNA methylation affecting the differences in meat pH through regulating the expression of related genes. Therefore we hypothesised that DNA methylation might play a role in the difference in gene expression in pig meat quality. The aim of this research was to study the association of the IFI6 gene with meat quality traits and to unravel the effect of DNA methylation regulated IFI6 gene expression on meat quality traits in pigs.

Materials and methods

Animals, muscle sampling and phenotypes

A total of 300 muscle samples were randomly collected from crossbred pigs [Duroc × (Large White × Landrace)] from a local meat supplier in Thailand. The pigs were slaughtered approximately at 90–110 kg slaughter weight at a commercial abattoir following the standard slaughtering procedures of DLD (Department of Livestock Development, Thailand). Pigs were transported to the slaughterhouse in about an hour. After 2 h of rest, the pigs were slaughtered. The slaughter process used an electrical stunning method. Following electrical stunning, the pigs were exsanguinated and then placed in a dehairer at 65 °C for 5 min in a dehairer. All muscle samples were immediately collected from the left side of Longissimus thoracis et lumborum (LTL) to evaluate meat quality traits. Meat quality traits analysed in this study included drip loss, thawing loss, cooking loss, pH at 45 min post-mortem (pH45min), pH at 24 h post-mortem (pH24h), shear force (for tenderness) and lightness (L*). Meat pH-value was measured by using a spear-type electrode (pH Spear, Eutech Instruments, Singapore) in the Longissimus lumborum between the 13^th/14^th rib (Kayan et al. 2011). The pH metre was calibrated by using buffers 4.20 and 7.10, using the temperature of the chops. Drip loss was scored based on a bag-method with a size-standardized sample from Longissimus lumborum collected at 24 h post-mortem (pm) that was weighed and suspended in a plastic bag. The samples were stored in the refrigerator at 4 °C for 48 h, and thereafter re-weighed (Zhang et al. 2014). To determine cooking loss, a loin cube was taken from the Longissimus lumborum, weighed, placed in a polyethylene bag, and incubated in water at 75 °C for 50 min. The bag was then immersed in flowing water at room temperature for 30 min and the solid portion was re-weighed (Srikanchai et al. 2010). The thawing loss was determined similarly after at least 24 h freezing at −20 °C. The samples were frozen in a blast freezer and kept at −20 °C. Thawing methods were carried out at 4 ± 1 °C refrigeration for overnight. Drip loss, cooking loss, and thawing loss were calculated as a percentage of weight loss based on the start weight of a sample. The colour of the meat was measured by a Minolta chromameter (Minolta Camera Co., Osaka, Japan) calibrated against a white tile (L* = 92.30, a* = 0.32 and b* = 0.33). The samples were cut into a 2.5 cm thick slice of muscle, placed on trays and measured after exposing the surface to the air for 30 min at 4 °C. The average of triplicate measurements was recorded, and the results were expressed as L*(lightness). Tenderness is measured mechanically by ‘shear force’ using a Warner–Bratzler shear device (WBS), where a higher shear force value indicates low tenderness of meat. Briefly, shear variables were determined with a WBS attached using a Texture Analyser TA-XT2 (Texture Technologies Corp., Scarsdale, NY, USA) on 12.5-mm-diameter cores drilled from the boiled samples (5 replicates per sample) previously cooled to room temperature (Jaturasitha et al. 2009). The maximum force measured to cut the core was expressed as Newtons (N). The numbers of records, mean values and standard deviation of meat qualities are reported in Table 1.

Table 1. Physicochemical traits of the Longissimus thoracis et lumborum of pig fatteners.

Traits	Mean ± SE (n = 300)
Drip loss (%)	2.84 ± 0.08
Thawing loss (%)	4.16 ± 0.13
Cooking loss (%)	30.16 ± 0.24
pH45min	6.64 ± 0.02
pH24h	5.86 ± 0.01
Shear force (N)	60.21 ± 0.36
Lightness (L*)	43.81 ± 0.62

^apH45min, pH24h value in the Longissimus thoracis et lumborum (LTL) 45 min and 24 h post-mortem, respectively.

DNA extraction, PCR reaction and analysis of mutation

DNA was isolated from LTL muscle samples by using the AxyPep Multisource Genomic DNA Minipep Kit (Axygen Scientific, Inc., CA, USA) following the manufacturer’s instructions. The single nucleotide polymorphism (SNP) in the porcine IFI6 gene was genotyped in the 300 crossbred pigs. Primers used for genotyping are mentioned in Table 2. Polymerase chain reactions (PCR) were performed in a 20 μL reaction volume containing 2 μL of genomic DNA, 1 × PCR buffer (with 1.5 mM MgCl₂), 0.25 mM of dNTP, 5 pM of each primer and 0.1 U of Taq DNA polymerase (Thermo Fisher Scientific Inc., MA, USA). The PCR were performed under the following condition: initial denaturing at 95 °C for 5 min followed by 35 cycles of 30 s at 95 °C, 30 s at the annealing temperature of primer pairs and 1 min at 72 °C, and a final elongation of 10 min at 72 °C (Kayan et al. 2011). A SNP (g.370A > G) in the IFI6 gene (GenBank accession: BN000213) was selected (Kayan et al. 2011) for a detailed association study. Genotyping was performed by PCR-RFLP. The PCR-RFLP patterns of IFI6 alleles were represented as: genotype AA resulted in three fragments including in 378, 184 and 77 bp, for genotypes GG resulted in two fragments including in 562 and 77 bp. The PCR product was checked on 1.5% agarose gel before digestion by using a restriction enzyme (Table 2). After digestion, PCR-RFLP products were checked on 3% agarose gel. The fragments were visualised under ultraviolet light on a UV trans-illuminator (Omega LumG, Aplegen life sciences, USA).

Table 2. List of primers for genotyping, methylation and qRT-PCR.

Gene	Primer sequence	Tm (°C)m	Product	Polymorphism	Enzyme	Method	References
IFI6	Fw: 5′-AAGGCGGTATCGCTCTTCTT-3′	58.7	562 bp	g370A > G	HphI	genotyping	Kayan et al. (2011)
	Rw: 5′-AGGCAGCCACAGAGTTGG-3′
IFI6	Fw: 5′-GGGTTTTGGGTTTAGTTTAGAGTAT-3′	60				methylation
	Rw(biotin): 5′-CAAATACCCCAAAATCCTTACCTA-3′
	Fw: 5′-TTTATGAATTTATTGTTAAA-3′
	Rw(biotin): 5′-GGGAATTAGGTTTTTTTTTAG-3′
IFI6	Fw: 5′-AAGGCGGTATCGCTCTTCTT-3′	60				qRT-PCR	Kayan et al. (2011)
	Rw: 5′- TTCTGTTTTGCTTGGTTTTGTTT -3′
GAPDH	Fw: 5′-ACCCAGAAGACTGTGGATGG-3′	60				qRT-PCR	Kayan et al. (2011)
	Fw: 5′- ACGCCTGCTTCACCACCTTC -3′

CpG island identification, genomic bisulphite PCR and sequencing

The 5′-flanking regions of published sequences (GenBank accession: NC_010448.4) of IFI6 which contained the promoters of the IFI6 gene were submitted to the MethPrimer program (Li and Dahiya 2002) to identify the CpG islands. The transcription binding sites were determined by the online software from AliBaba (http://www.gene-regulation.com/pub/programs/alibaba2/index.html). Since the polymorphism in IFI6 was found to be associated with meat pH24h, only animals with divergent meat pH24h (high vs low) were selected for methylation study. Genomic DNA was extracted from LTL samples from animals with low and high meat pH groups (n = 5 per group) for methylation and mRNA expression analysis. Meat pH24h of the selected samples had a negative correlation with drip loss (r²=-0.930). In brief, each DNA (1 μg) was modified with the bisulphite conversion reaction according to the manufacturer’s protocol (EZ DNA Methylation-Gold Kit, Zymo Research, CA, USA). The converted DNA was diluted to a concentration of 20 ng/μL with RNase-free water, and 2 μL of each converted DNA was used as a template for PCR and further analysed through pyrosequencing.

Bisulphite PCR and pyrosequencing

Genomic DNA was treated with bisulphite using the EZ DNA Methylation Gold Kit (Zymo Research, CA, USA) according to the manufacturer’s instructions. Primers were designed using pyrosequencing assay design software and listed in Table 2. Converted DNA was amplified by PCR using the PyroMark PCR kit (Qiagen, Hilden, Germany) in a final volume of 25 μL containing 1 × PyroMaster Mix, 1 × CoralLoad, 0.2 μM of each primer, RNase-free water and 2 μg of bisulphite-converted DNA template. Amplification conditions were as follows: 95 °C for 15 min; 45 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, and finally 72 °C for 10 min. Pyrosequencing of PCR products was performed incorporating the CpG sites using a PyroMark Q24 pyrosequencer (Qiagen, Hilden, Germany). The methylation percentages at each CpG site in a pyrogram was calculated by PyroMark Q24 2.0.6.20 software (Qiagen, Hilden, Germany).

mRNA expression study by qRT-PCR

Since the polymorphism is associated with pH24h, the differential expression of the IFI6 gene was performed in animals with divergent meat pH24h. The divergent meat pH24h were randomly selected from the lower 10% meat pH24h (pH 5.44-5.66, n = 5 pigs) and upper 10% meat pH24h (pH 6.17-6.30, n = 5 pigs) of the total 300 pigs. Total RNA was isolated from 20 mg muscle samples by using the QIAamp RNA Mini Kit (Qiagen, Courtaboeuf, France) according to the manufacturer’s recommendations. The purity of the extracted RNA was measured using a NanoDrop spectrophotometer. Real-time PCR analysis was performed using a MyGo Pro^® real-time PCR instrument (IT-IS Life Science Ltd, Middlesbrough, UK) with reaction mixture using QuantiNova SYBR Green RT-PCR Kit (Qiagen, Hilden, Germany), consisting of 10 µL of 2X QuantiNova SYBR Green RT-PCR Master Mix, 1 µL of each 10 µM (0.5 µM) forward and reverse primer, 0.2 µL of QN SYBR Green RT Mix, 5 μL of template and 2.8 µL of nuclease-free water to make a total reaction volume of 20 μL. A two-step amplification program was pre-denaturation at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing and extension at 60 °C for 10 sec. All samples were studied in duplicate as technical replication, and the result was calculated as the mean of the two replications for further analysis. GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) was used as a housekeeping gene. According to GAPDH gene has been reported to be used for the evaluation of post-mortem stability of porcine skeletal muscle RNA (Fontanesi et al. 2008). The final results were reported as the relative expression level after normalisation of the transcript using GAPDH. The PCR primers are shown in Table 2.

Muscle tissue histology

The sample was cut into 0.5 × 0.5 × 1.0 cm pieces at approx. 45 min post-mortem after carcase bleeding, and immediately fixed in 10% buffered neutral formalin solution for 24 h. After fixation, the specimen was dehydrated in alcohol, cleared in xylene, infiltrated, and finally embedded in Paraffin (Khoshoii et al. 2013). The sections were cut at 3 μm thickness and stained with haematoxylin and eosin (H & E) stain for basic histological study. Stained cross-sections were viewed and photographed with a light microscope (Olympus FSX100) at 10X objective lens and a 10X eye piece.

Statistical analysis

The allele and genotype frequencies of SNP were determined. Allele frequencies were calculated using the formula p + q = 1, where the alleles will be A and G. Genotype frequencies were calculated using the formula p² + 2pq + q² = 1, where the genotypes will be AA, AG, and GG. The association of the genotypes with meat quality traits was calculated by analysing the variance of quantitative traits. A generalised linear model (Proc GLM) in SAS (SAS Inst. Inc., Cary, NC, USA) was used for these analyses. The model was as follows: $${\mathrm{Y}}_{\text{ij}}=\mathrm{\mu }+{\text{Genotype}}_{\mathrm{i}}+{\text{YS}}_{\mathrm{l}}+{\mathrm{e}}_{\text{ij}}$$

Where, Y_ij is the observation of the traits (meat quality); µ is the population mean; Genotype_i is the effect of i-th genotype (i = AA, AG and GG); YS_l is the effect of l-th date of slaughter (l = 1 for day 1 of slaughtering until to 6 for day 6 of slaughtering), and e_ij is the random residual error (Kayan et al. 2022; Listyarini et al. 2023). The least square mean values were adjusted by the Tukey-Kramer correction. The additive effect was estimated as half of the difference between the 2 homozygous groups: a = ½(BB-AA), where A and B means the first and the second allele of the analysed markers, respectively. The dominance effect was estimated as the difference between the heterozygous group and the average of the 2 homozygous groups: d = AB-1/2(AA + BB). The estimates of effects were tested by t-test as a significant deviation from zero.

Statistical analysis of the differences between meat pH groups for methylation and qRT-PCR were analysed by t-tests of SAS (SAS Inst. Inc., Cary, NC, USA). Statistically significant differences were determined at p < .05. Results are displayed as least squares means with the standard errors.

Results

Phenotypic traits

Most of the phenotypic traits were found to be significantly correlated (Supplementary file 1). The results represented that drip loss had a negative correlated with meat pH45min and meat pH24h (p < .01). A significant positive correlation was observed with drip loss, thawing loss and cooking loss (p < .05). Shear force had a positive correlation with thawing loss and cooking loss (p < .05). Moreover, lightness showed significant positive correlation with meat pH45min, cooking loss and shear force (p < .05). These results indicated that meat with lower pH value at 45 min and 24 h became more exudative meat. The meat samples were collected from a commercial industry and the supplier was reluctant to be identified. Since no live animal was involved, therefore, ethical approval was not required.

Genotype, allele frequencies and association of IFI6 gene

Allele frequencies of the IFI6 gene for A and G were 0.49 and 0.51, respectively. The genotype frequencies of the IFI6 gene for AA, AG and GG were 0.23, 0.52 and 0.25, respectively (Table 3). The polymorphism of the IFI6 gene was significantly associated with meat pH24h (p < .01) (Table 4). The genotype GG and AG were higher for meat pH24h than genotype AA. The result also identified additive and dominance effect for the IFI6 gene indicating a highly additive effect on meat pH24h (p < .001). The association with drip loss, thawing loss, cooking loss, meat pH45min, shear force and lightness (L*) was not statistically significant (p > .05) in the current population.

Table 3. Genotype and allele frequencies of IFI6 gene.

Gene	Genotype	Commercial pigs (n = 300)	Allele	Commercial pigs (n = 300)
IFI6	AA	0.23	A	0.49
	AG	0.52	G	0.51
	GG	0.25

Table 4. Least square means (LSM) and standard errors (SE) for meat quality traits across genotype of IFI6 gene.

Traits	Genotype (Lsmean ± SE)^1			p-value	Effect (mean ± SE)
	AA	AG	GG		Additive	Dominance
Drip loss (%)	2.850 ± 0.160	2.940 ± 0.100	2.790 ± 0.160	0.742	0.030 ± 0.120	−0.110 ± 0.150
Thawing loss (%)	4.160 ± 0.230	4.200 ± 0.140	4.380 ± 0.230	0.763	−0.110 ± 0.170	0.070 ± 0.220
Cooking loss (%)	30.270 ± 0.140	30.010 ± 0.090	30.220 ± 0.140	0.202	0.030 ± 0.100	0.240 ± 0.130
pH45min	6.660 ± 0.010	6.600 ± 0.020	6.650 ± 0.030	0.213	−0.010 ± 0.020	0.050 ± 0.030
pH24h	5.800 ± 0.020^a	5.880 ± 0.010^b	5.910 ± 0.020^b	0.003	−0.050 ± 0.020***	−0.020 ± 0.020
Shear force	59.040 ± 0.040	59.330 ± 0.030	59.130 ± 0.040	0.772	−0.010 ± 0.030	−0.030 ± 0.040
Lightness (L*)	43.940 ± 0.180	43.870 ± 0.110	43.990 ± 0.180	0.844	−0.030 ± 0.130	0.090 ± 0.170

^a,bDifferent letters denoting significant difference between groups. ***p < .001.

DNA methylation pattern of the IFI6 promoter

The IFI6 promoter region was predicted for the CpG island by using the MethPrimer program. There are four CpG islands identified in the IFI6 gene (Figure 1). The 3^rd CpG island was selected for further methylation percentage study because this position is consisted of the putative transcription factor binding sites for NF-1, ICSBP, Sp1 and C/EBPalp. Note, ten CG sites are included in this position. The pyrosequencing analysis revealed that the methylation percentages were not differed between low and high meat pH groups at CG site 1, 2, 3, 4, 5, 6, 8, 9 and 10 (p > .05) (Figure 2). However, the methylation percentage of CG site 7 was significantly (p < .05) higher in low meat pH24h compared to high meat pH24h (4.80 ± 0.73 vs 1.40 ± 0.87) (Figure 2) and this position was identified as the potential transcription binding site for C/EBPalp.

Figure 1. Methylation sites in the promoter region of IFI6 gene. The IFI6 promoter region was predicted for the CpG island by using the MethPrimer program. There are four CpG islands identified in the IFI6 gene.

Figure 2. Methylation percentage of the CpG islands in the promoter of IFI6 gene. The methylation percentages were determined by pyrosequencing between low and high meat pH groups. The bars represent the mean ± SE. * indicates the difference of promoter methylation percentage was statistically significant (p < 0.05) between groups.

mRNA expression of IFI6 gene

Since a significant association was identified with 24h meat pH, the animals with divergent meat pH24h phenotypic traits were selected for mRNA expression study. Divergently high and low meat pH24h groups (n = 5 per group) had 6.26 ± 0.06 and 5.55 ± 0.04, respectively. The average meat pH24h was 5.86 ± 0.22 in this population. The relative expression level of the IFI6 gene was represented in Figure 3. The expression level of the IFI6 gene in a high meat pH24h group was significantly (p < .01) higher than that of the low meat pH24h group (Figure 3(a)). The expression level of the IFI6 gene in the low and high meat pH24h group was 1.264 ± 0.024 and 1.481 ± 0.037, respectively. The expression difference of the IFI6 gene in the divergent drip loss group (Figure 3(b)) was not statistically significant (p > .05). The expression level of the IFI6 gene in the low and high drip loss group was 1.341 ± 0.029 and 1.394 ± 0.043, respectively.

Figure 3. Expression level of IFI6 gene between divergent phenotypic groups. qRT-PCR analysis of IFI6 gene expression from (a) low pH24h vs high pH24h and (b) low vs high drip loss groups (n = 5 per group) in pigs. GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) was used as a reference gene for the normalisation of transcripts. The bars represent the mean ± SE. *p < 0.05 and **p < 0.01 denote statistically significant difference.

Histology of muscle fibre

The muscle fibre histology has observed that there is greater endomysium thickness, smaller muscle fibre diameter or muscle area, the gap between the muscle bundle is widen, and the higher shrinkage of muscle fibre bundles in the low meat pH24h group compared to high meat pH24h group (Figure 4). More cell nucleus are visible in the high meat pH24h sample compared to the low meat pH24h. This might be more tissue damage occur in the low meat pH24h section. These results indicated that post-mortem apoptosis or muscle cellular components degradation were higher in acidic meat with higher drip loss.

Figure 4. Histological features of muscle from divergent phenotypic groups. The samples were collected at approx. 45 min after carcase bleeding or post-mortem, formalin fixed, stained with H&E, and studied under microscope (10×).

Discussion

Meat quality traits are complex and are influenced by many factors including the genetic makeup of animals, breed, age, sex, diet, stress related to transport, resting of animals at abattoir premises, slaughtering process, time of processing meat after slaughter, preservation, and handling of meat etc. Many of these factors are difficult to control, but improving meat quality through selection breeding is widely being practicing in animal industries (Rosenvold and Andersen 2003; Davoli and Braglia 2007; Cheng and Sun 2008). The falling muscle pH after slaughter is a common phenomenon because muscle glycogen converted into lactic acid once the animal is dead. Low pH (acidification) of meat at post-mortem causes higher drip loss which resulted in tougher (lower meat tenderness) and pale meat (Jankowiak et al. 2021). Hence, the identification of genetic markers for meat pH through association is crucial. Nevertheless, a population of 300 animals is widely used for association study (Kayan et al. 2011; Cinar et al. 2012; Laenoi et al. 2012).

PSE meat had a low pH value, a high L* value or pale colour, high drip loss and cooking loss, thus affect meat price and consumer’s choice (Liu et al. 2023). Previous studies reported that drip loss variance was independent of pH fall rate and ultimate pH, allowing researchers to investigate drip loss mechanisms independent of post-mortem muscle metabolism. There are correlations between the rate of pH decrease or the ultimate pH and the quantity of drip loss in meat (Bihan-Duval et al. 2008; Boler et al. 2010; Traore et al. 2012). Meat pH24 h, the ultimate pH (pHu) in this study is a key meat quality trait which influences other meat quality traits. According to a previous study, the pHu has been classified into three groups: low (L-pH: ≤5.50), intermediate (I-pH: 5.51–5.90), and high (H-pH: ≥5.91) (Wang et al. 2018). In this study, the low and high meat pH24h were 5.55 ± 0.04 and 6.26 ± 0.06, respectively. However, this classification of ultimate meat pH24h might be different among different pig breeds. The genetic relationship between drip loss and pH24h was r_g = −0.72 ± 0.04 (Borchers et al. 2007). This study revealed that the polymorphism in the IFI6 gene was associated with meat pH24h, and the gene expression was higher in muscle with higher meat pH24h. This study represented a negative correlation between meat pH24h and drip loss. The Ca²⁺ release in myocyte cytoplasm influences post-mortem proteolysis in the high pH group. Ca²⁺ is required for skeletal muscular contraction, functions as an activator of proteolytic enzymes, and influences apoptotic activation in post-mortem. All these factors contribute to meat tenderisation (Poleti et al. 2018).

The amino acid sequence similarity between porcine IFI6 proteins and human, chimpanzee and cattle proteins was analysed by the Clustal method. The alignment showed that the porcine IFI6 shares common structures and conserved regions with other species (Supplementary file 2). Methylation of high-density CpG islands (CGIs) has been widely described as a key mechanism involved in gene expression regulation (Moarii et al. 2015). Downregulation of gene expression is mostly associated with DNA methylation. The main function of DNA hypermethylation in the promoter region is thought to suppress gene expression (Rauluseviciute et al. 2020). The methylation percentage of CG site 7 was higher in low meat pH compared to that in high meat pH pigs. The IFI6 mRNA is downregulated in the low meat pH tissues which might be due to the hypermethylation of the promoter region (Figures 2 and 3). The CpG island 7 is located at the potential C/EBPalp transcription binding site. It is well established that the IFI6 gene is an anti-apoptotic gene that inhibits cytochrome c release and suppresses mitochondrial membrane depolarisation (Tahara et al. 2005; Chen et al. 2016). Overexpression of the IFI6 gene causes increased cell proliferation while decreasing cell apoptosis (Jia et al. 2020). Ca²⁺ is released from the sarcoplasmic reticulum (SR) into the skeletal muscle via the Ca²⁺ release channel (Baker et al. 2002), and IFI6 regulates Ca²⁺ channels in the endoplasmic reticulum (Tahara et al. 2005). Thus Ca²⁺ channel activation promotes Ca²⁺ release from the SR into the myocyte cytoplasm (Berchtold et al. 2000). Higher calcium release to cytoplasm and calcium associated consequences such as muscle contraction and activation of the muscle metabolism lead to a rapid decrease in muscle pH due to lactic acidosis (Oliván et al. 2018). Hence, Ca²⁺ content in the cytoplasm regulates the primary cellular activities in the muscle cell and the Ca²⁺ channel controls the muscle pH (Küchenmeister and Kuhn 2003). Furthermore, an increase in cytoplasmic Ca²⁺ leads to an increase in energy production and utilisation, as well as ADP, CO₂, and heat generation (Berchtold et al. 2000). As a result, post-mortem metabolism is increased by activating glycogenolysis and glycolysis, increasing lactate accumulation, a rapid decrease in pH and altering the water holding capacity or drip loss of meat (Allison et al. 2003). One of the underlying cause of PSE meat (low meat pH) is the abnormally rapid post-mortem cellular metabolism, which is controlled by high Ca²⁺ concentrations (Strasburg and Chiang 2009). The high DNA methylation at a specific CG site in the IFI6 promoter might be involved in the down regulation of the IFI6 gene as well as in lowering meat pH via Ca²⁺ channel activation.

Muscle fibre characteristics are important determinants of meat quality and has a strong correlation with meat quality traits (Bulotienė and Jukna 2008). Fibre type and muscle composition are affected by metabolism rate in the post-mortem, thus influence meat quality traits (Ryu and Kim 2005). Furthermore, various muscle fibre characteristics are considered as endogenous factors that can affect the physiological condition of the muscle both in live and slaughtered animals (Fiedler et al. 1999). The results in this study indicated that post-mortem apoptosis or muscle cellular components degradation were higher in acidic meat with higher drip loss. Drip loss is also reported to be correlated with muscle structural characteristics during storage. At 0 h of storage time, a high drip loss group had greater endomysium thickness than a low drip loss group, and at 72 h of storage time, a high drip loss muscle had smaller fibre diameter, fibre area and endomysium thickness (Koomkrong et al. 2017). The current study has identified that meat pH (pH45 min and pH24 h) is inversely related to drip loss. Similar results have been revealed by a previous study that the pH value is negatively related to drip loss (Otto et al. 2004). These results postulated that IFI6 gene might be a potential functional candidate for meat pH.

Conclusions

A detailed study including polymorphism and association analysis, methylation, and expression study indicate that the IFI6 gene might be an important candidate gene controlling meat quality traits especially the meat pH in pigs, hence the marker could be included in the selection program for limiting drip loss.

Ethical approval

The meat samples in this study were taken from a local meat supplier, which did not need contact with animals. This study did not involve any invasive procedure on animals; therefore, ethical approval was not required.

Disclosure statement

No potential conflict of interest relevant to this article is reported.

Data availability statement

The data presented in this study are available on request from the corresponding author upon reasonable request.

Additional information

Funding

This work was financially supported by the Office of the Ministry of Higher Education, Science, Research and Innovation; and the Thailand Science Research and Innovation through the Kasetsart University Reinventing University Program 2021 (grant no RUP2.2/Con-CASAF PD 08) and The Thailand Research Fund (grant no MRG 5680077).