Mosquitoes (Culicidae) as a vector of Encephalitozoon hellem (Microsporidia)

Microsporidiosis is an emerging infectious disease caused by eukaryotic parasites of the phylum Microsporidia. To date, the disease has been attributed to 17 species across eight genera, including one holding genus labelled as ‘Microsporidium’. These microorganisms exhibit diverse clinical manifestations [1]. Immunocompromised individuals are particularly vulnerable to these parasites. During infection, patients are at a risk of developing prostatitis, pneumonitis, nephritis, keratoconjunctivitis, sinusitis, urethritis, or cystitis. Microsporidians may also cause life-threatening chronic diarrhoea in immunocompromised patients [2]. The most common microsporidian infecting humans is Enterocytozoon bieneusi, followed by three Encephalitozoon species, including E. hellem [3]. Encephalitozoon hellem mainly exhibits distribution among birds and has been detected in avian tissues and faecal samples, particularly during the last decade in Europe. However, monkeys, bats, carnivores, and rodents may also be infected by this microsporidian [4]. Recently, preliminary reports have suggested the presence of E. hellem in mosquitoes [5]. Therefore, to address the question of the potential role of mosquitoes in transmitting this human microsporidiosis agent, we applied the recently developed DNA metabarcoding approach [5] to screen mosquito adults collected along a c.a. 2,000 km longitudinal transect in Europe Figure 1.

Figure 1. Sampling places of mosquitoes with (red) and without (green) Encephalitozoon hellem-positive individuals. The size of circle corresponds to the number of analysed mosquitoes. Numeric value inside the circles: number of microsporidian-positive individuals/number of analysed mosquitoes. BAS: Basel; FRA: Frankfurt; GDA: Gdansk; HAI: Haidary; HAN: Hannover; INN: Innsbruck; KAT: Katowice; LUB: Lublin; POZ: Poznan; YAK: Yakovlivka.

In total, 4,503 mosquitoes, including 2,565 females and 1,938 males, collected from 10 cities located in five European countries were individually screened for microsporidian DNA (Figure; Appendix Table 1) using the metabarcoding method described by Trzebny et al. [5]. This method enables the detection of all microsporidian species, including those that are pathogenic to humans. Briefly, fragments of the cytochrome c oxidase subunit I gene (mini-COI) and the hypervariable V5 region of the 18S rRNA gene were amplified and sequenced to identify the mosquito and microsporidian species, respectively (Appendix Table 2). Bioinformatics analysis was conducted using a custom workflow in Geneious Prime version 2023.2.1 (Biomatters Ltd.), USEARCH version 11, and Qiime2 version 2023.9. Presence of E. hellem was confirmed through quantitative PCR (qPCR) using the polar tube protein 1 gene (PTP1) as a target. The Luna Universal Probe qPCR Master Mix (NEB, USA) with E.hell-PTP_F (AATGACGCCGGGTGTTTCTC) and E.hell-PTP_R (GTCCTGGCTGGCATGGATAA) primer sets and E.hell-PTP_P (GGGGATGGAAGCAACCAGAC) TaqMan probes developed in this study were used. The genotype of E. hellem was determined by sequencing the almost complete 18S rRNA gene [6] and approximately 1,200 bp of the PTP gene [7] (Appendix Table 2). Phylogenetic trees were constructed based on the published 18S rRNA and PTP sequences representing all known E. hellem genotypes (Appendix Table 3) [7]. Trees were reconstructed using maximum likelihood through GARLI and Bayesian inference using MrBayes software, as described by Trzebny et al. [8]. The specificity of infection against the sites was calculated using the Kruskal–Wallis test. The sequences generated in this study were deposited in GenBank under the accession numbers OR780779–OR780786 and OR789801–OR789808 (Appendix Table 3).

Based on the mini-COI sequence data, all the mosquitoes were unambiguously assigned to 14 species belonging to six genera (Appendix Table 4). Encephalitozoon hellem DNA was identified in eight female mosquitoes (0.03%; 95% CI: 0.002–0.006) collected from Germany (1/175), Poland (6/2,161), and Ukraine (1/193) (Figure; Appendix Table 1). Microsporidian DNA has been found in various mosquito species, including Aedes vexans (3), Ochlerotatus cantans (3), Annopheles messeae (1), and Culex pipiens (1) (Appendix Table 5). Presence/absence qPCR analysis confirmed the presence of E. hellem in all samples that were positive in the metabarcoding method (1.190 ⩽ ΔRn ⩽ 1.237; Appendix Table 6). The presence of E. hellem in mosquitoes was not locally limited (p = 0.392). Phylogenetic analysis of 18S rRNA and PTP1 sequences clustered E. hellem within the human pathogenic genotype 1A (Appendix Figure). Previously, genotype 1A has been recorded in humans and companion birds [4,7].

To date, only three microsporidian species (Anncaliia algerae, Tubulinosema acridophagus, and Trachipleistophora hominis) have been identified in culicids [9]. Our results suggest that as many as one in 200 mosquitoes can transmit another microsporidiotic agent, E. hellem. This suggests that mosquito species represented in this study by low numbers of individuals may also transmit E. hellem (Appendix Table 4). Notably, we did not detect any other human pathogenic microsporidians in the tested mosquitoes [8]. This suggests that E. hellem is the most common microsporidian species infecting wild vertebrates. The presence of E. hellem only in female mosquitos clearly indicates that they acquire this microsporidian during feeding and that the microsporidian DNA originates from spores released into the blood of infected vertebrates. Human infection can occur through the mosquito saliva during anesthesia of the bite or, more likely, may be a result from crushing an infected female mosquito, thereby mechanically inoculating the spores into a skin-bite wound [10]. However, these potential transmission mechanisms are speculative and require additional detailed research. Our study provides preliminary data for the future surveillance of mosquito-borne microsporidians and highlights the need for further studies to decipher the transmission dynamics of these parasites. Moreover, clinical awareness of this parasitic infection should be strengthened through educational and interdisciplinary collaboration between clinicians and parasitologists.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This study was supported by grant number 2020/37/N/NZ8/01735 from the National Science Centre of Poland. We gratefully acknowledge Poland’s high-performance computing infrastructure PLGrid (HPC Centers: ACK Cyfronet AGH) for providing computer facilities and support within computational grant number PLG/2023/016110. The authors received financial support to cover the costs of Open Access from the Initiative of Excellence-Research University (05/IDUB/2019/94) at Adam Mickiewicz University, Poznan, Poland; Narodowe Centrum Nauki.