β cell acetate production and release are negligible

Figures & data

Table

Gene	Forward Primer 5’-3’	Reverse Primer 5’-3’
Mct1	TGTTAGTCGGAGCCTTCATTTC	CACTGGTCGTTGCACTGAATA
Mct2	GCTGGGTCGTAGTCTGTGC	ATCCAAGCGATCTGACTGGAG
Mct3	TCGTGGAGCTGTACCTGAC	CCGCTCGAAGTAGAGTCCC
Mct4	TCACGGGTTTCTCCTACGC	GCCAAAGCGGTTCACACAC
β-actin	GTTACAGGAAGTCCCTCACCC	CAGACCTGGGCCATTCAGAAA

Figure 1. Total (intracellular + extracellular) levels of studied metabolites in response to incubation of Min6 cells under low glucose (LG, 2.8 mM) and high glucose (HG, 16.8 mM). (a) Illustration of the mechanism for labeled pyruvate and acetate produced from U-¹³C₆ labeled glucose. GSIS studies (b), and intracellular ATP (c) and intracellular citrate (d) levels of LG and HG incubated Min6 cells. Total levels of (e) pyruvate, (f) pyruvate isotopologues, (g) acetate and (h) acetate isotopologues represented as fold change relative to U-¹³C₆ LG condition. (i) Percentage of total acetate to total pyruvate in U-¹³C₆ LG and HG condition. Experiments were conducted three independent times in triplicate each time. Data was analyzed by student’s t test (1B, 1C, 1D, 1E, 1 G and 1I) or by Two-way ANOVA (1F and 1 H). *p < .05, **p < .01, ***p < .001 and ****p < .0001. Black bar = LG, white bar = HG. Pyruvate Dehydrogenase (PDH), Pyruvate Carboxylase (PC), acetic acid (AA), and pyruvic acid (PA).

Figure 2. Intracellular pyruvate, acetate, and their isotopologue levels following incubation of Min6 cells in U-¹³C₆ low glucose (U-¹³C₆ LG, 2.8 mM) or high glucose (U-¹³C₆ HG, 16.8 mM). (a) Total intracellular pyruvate level represented as fold change relative to U-¹³C₆ LG condition. (b) Intracellular pyruvate isotopologues levels represented as fold change relative to its respective isotopologues levels in U-¹³C₆ LG condition. (c) Percentage of intracellular pyruvate isotopologues within U-¹³C₆ LG or HG condition. (d) Total intracellular acetate level represented as fold change relative to U-¹³C₆ LG condition. (e) Intracellular acetate isotopologues levels represented as fold change relative to its respective isotopologues levels in U-¹³C₆ LG condition. (f) Percentage of intracellular acetate isotopologues within U-¹³C₆ LG or HG condition. Experiments were conducted three times in triplicate each time. Data was analyzed by student’s t test (2A and 2D) or by Two-way ANOVA (2B, 2C, 2E and 2F). *p < .05, **p < .01, ***p < .001 and ****p < .0001. Black bar = U-¹³C₆ LG, white bar = U-¹³C₆ HG.

Figure 3. Extracellular pyruvate and levels of its isotopologues following incubation of Min6 cells in U-¹³C₆ low glucose (LG, 2.8 mM) or high glucose (HG, 16.8 mM). (a) Total extracellular pyruvate level represented as fold change relative to the U-13C₆ LG condition. (b) Percentage extracellular pyruvate to total (intracellular + extracellular) pyruvate in U-¹³C₆ LG and HG condition. (c) Extracellular pyruvate isotopologues levels represented as fold change relative to its respective isotopologues levels in U-¹³C₆ LG condition. (d) Percentage of extracellular pyruvate isotopologues within U-¹³C₆ LG or HG condition. Experiments were conducted three times in triplicate each time. Data was analyzed by student’s t test (3A and 3B) or by Two-way ANOVA (3C and 3D). *p < .05, **p < .01, ***p < .001 and ****p < .0001. Black bar = U-¹³C₆ LG, white bar = U-¹³C₆ HG.

Figure 4. Extracellular acetate and levels of its isotopologues following incubation of Min6 cells in U-¹³C₆ LG and U-¹³C₆ HG. (a) Total extracellular acetate level represented as fold change relative to U-¹³C₆ LG condition. (b) Percentage of extracellular acetate to total (intracellular + extracellular) acetate in U-¹³C₆ LG and HG condition. (c) Extracellular acetate isotopologues levels represented as fold change relative to its respective isotopologues levels in U-¹³C₆ LG condition. (d) Percentage of extracellular acetate isotopologues in U-¹³C₆ LG and HG condition. Experiments were conducted three times in triplicate each time. Data was analyzed by student’s t test (4A and 4B) or by Two-way ANOVA (4C and 4D). *p < .05, **p < .01, ***p < .001 and ****p < .0001. Black bar = U-¹³C₆ LG, white bar = U-¹³C₆ HG.

Figure 5. Glucose concentration does not affect extracellular acetate incorporation into Min6 cells or intracellular/extracellular acetate levels in CD1 islets. (a) ¹⁴C acetate incorporation level of Min6 cells represented as fold change relative to LG condition. (b) Intracellular acetate of CD1 mouse islets represented as fold change relative to LG condition. (c) Concentration (µM) of extracellular acetate CD1 mouse islets. (d) Fold change of MCT1–4 expression in CD1 mice islets, liver, muscle, LG incubated Min6 cells, or HG incubated Min6 cells relative to CD islet MCT1 expression. For 5A, experiment was conducted three times in triplicate each time. For 5B and 5C, n = 3 samples, each sample has 100 ~ 200 islets. For 5D, CD1 islets, liver, and muscle, the n = 4, and for min6 LG and min6 HG, the n = 6. Data was analyzed by student’s t test (5A, 5B and 5C) and One-way ANOVA (5D), *p < .05, **p < .01, ***p < .001 and ****p < .0001. Black bar = LG, white bar = HG.

Brennan L, Shine A, Hewage C, Malthouse JPG, Brindle KM, McClenaghan N, Flatt PR, Newsholme P. A nuclear magnetic resonance-based demonstration of substantial oxidative l -Alanine metabolism and l -Alanine-enhanced glucose metabolism in a clonal pancreatic β-Cell Line. Diabetes. 2002;51(6):1714–1721. doi:10.2337/diabetes.51.6.1714.

 PubMed Web of Science ®Google Scholar