Optimisation of hypocrellin production in Shiraia-like fungi via genetic modification involving a transcription factor gene and a putative monooxygenase gene

Figures & data

Table 1. Primers.

Primer	Sequence (5’–3’)
SbTF-F	ATGGCCACTCAACTCCCTAC
SbTF-R	CTATCCCGATCCGTTCAAAT
YZ-SbTF-F	CCCATCCCTTATTCCTTT
YZ-SbTF-R	TGGCACATCGAGCACA
SbMNF-F	ATGGCTATCTCCTCTCAAAACGACAAGCTA
SbMNF-R	TCATTCTCTAGATTCAACATATCCCGCTGC
YZ-SbMNF-F	CCCACTTCATCGCAGCTTGACTAACAGCTA
YZ-SbMNF-R	ATATTTTCTTCGGGTGGCACCATGCACACC

Table 2. SbTF homologous proteins.

Description	Scientific name	Accession number
Malamycin response protein 1	Paraphoma chrysanthemicola	KAH7084744.1
Elsinochrome C biosynthesis regulatory protein elcr-like protein	Parastagonospora nodorum	KAH3966140.1
Aflatoxin biosynthesis regulatory protein	Colletotrichum spinosum	TDZ27476.1
Aflatoxin biosynthesis regulatory protein	Cercospora beticola	XP_023460061.1
Aflatoxin biosynthesis regulatory protein	Elsinoe australis	TKX25779.1
Transcriptional activator protein UGA3	Elsinoe australis	PSK53770.1
Transcriptional activator protein UGA3	Sphaceloma murrayae	PNS21564.1
Fungal Zn (2)-Cys (6) binuclear cluster domain-containing protein 2	Elsinoe fawcettii	KAF4548437.1
Cercosporin biosynthesis regulatory protein CTB8	Fulvia fulva	XP_047765394.1
Aflatoxin biosynthesis regulatory protein	Colletotrichum orbiculare MAFF 240422	TDZ26706.1
Monodictyphenone cluster transcription factor	Colletotrichum trifolii	TDZ40841.1
Putative aflatoxin regulatory protein	Septoria linicola	USW47939.1
Zn-II 2Cys6 regulatory protein	Massariosphaeria phaeospora	KAF2866751.1
Zinc finger transcription factor	Colletotrichum graminicola M1.001	XP_008097708.1
AFLR	Aspergillus flavus	AAM02994.1
C6 transcription factor (AFLR)	Rasamsonia emersonii CBS 393.64	XP_013324718.1
Transcription factor AFLR	Aspergillus parasiticus	AAD24767.1
Zinc finger transcription factor	Shiraia sp. slf14	AIW0Q663.1
Hypocrellin pathway transcription factor	Shiraia sp. SUPER-H168	AZP03050.1

Table 3. HPLC gradient elution procedure for hypocrellin.

Time	Components
0–10 min	60% methanol, 40% 0.1% phosphoric acid
10–15 min	60%–70% methanol, 40%–30% 0.1% phosphoric acid
15–25 min	70% methanol, 30% 0.1% phosphoric acid
25–45 min	70%–75% methanol, 30%–25% 0.1% phosphoric acid
45–60 min	75%–100% methanol, 25%–0% 0.1% phosphoric acid
60–80 min	100% methanol

Figure 1. Phylogenetic tree of SbTF homologous proteins based on a maximum likelihood analysis of protein sequences. Maximum likelihood bootstrap support values (≥50%) are indicated above the nodes. The Shiraia-like strain zzz816 is shown in red, while other species with homologous transcription factors are shown in blue.

Figure 2. Variable region of SbTF gene between zzz816 and CNUCC C72.

Figure 3. SbTF overexpression in (a) transformant zzz816 and (b) transformant CNUCC C72.

Figure 4. Images of wild type strains and SbTF-overexpressing transformants cultured for 144 h on PDA plates. (a) Wild type CNUCC C72. (b) Transformant CNUCC C72. (c) Wild type zzz816. (d) Transformant zzz816.

Figure 5. Comparison of wild type strains and SbTF-overexpressing transformants in liquid cultures. (a) Wild type CNUCC C72. (b) Transformant CNUCC C72. (c) Wild type zzz816 (low-yielding strain). (d) Wild type zzz816 (high-yielding strain). (e) Transformant zzz816.

Figure 6. Comparison of qRT-PCR results between wild type and SbTF-overexpressing CNUCC C72.

Figure 7. Location of SbMNF (putative monooxygenase gene) in hypocrellin biosynthesis gene cluster.

Figure 8. Images of wild type strains and SbMNF-overexpressing transformants cultured for 144 h in PDB. (a) Wild type and transformant CNUCC 1353PR. (b) Wild type and transformant CNUCC C72. (c) Wild type and transformant zzz816.

Figure 9. Comparison of wild type strains and SbMNF-overexpressing transformant in liquid cultures. (a) Wild type CNUCC 1353PR. (b) Transformant CNUCC 1353PR. (c) Wild type CNUCC C72. (d) Transformant CNUCC C72. (e) Wild type zzz816 (low-yielding strain). (f) Wild type zzz816 (high-yielding strain). (g) Transformant zzz816.