The antioxidant response mechanism of flavonoids in ‘Tainong 1’ mango pulp under enhanced UV-B radiation

Abstract

In this study, UV-B radiation of 96 kJ·m⁻²·d⁻¹ exposed to the ‘Tainong 1’ mango tree, and trees as the control group under natural lighting. The relative conductivity and the contents of MDA, superoxide anion, H₂O₂ were lower in the treatment group than in the control group before 60 DAF, and the opposite occurred after 60 DAF. The total flavonoid content in the treatment group was higher than that in the control group, but the opposite occurred later. The 60 DAF serves as the critical point. Before 60 DAF, the treatment enhanced the activity of each enzyme by inducing the upregulated expression of genes such as CHS, R02446, and CYP98A so that gallochol, leucoside, kaempferoside, quercetin, isoquercetin and luteolin, and then removed ROS through the reduction of flavonoids. After 60 DAF, the treatment enhanced the activity of each enzyme by inducing the upregulated expression of HCT and R02446, but the synthesized flavonoids are consumed by ROS. Meanwhile, ROS also accumulate continuously because of the enhanced continuous exposure of UV-B radiation. The downregulated expression of CYP75A led to a decline in enzyme activity. The accumulation rate of flavonoid compounds was lower than that of ROS, which led to ROS damage in pulp.

PUBLIC INTEREST STATEMENT

Understand the induction mechanism of high-dose enhanced UV-B radiation treatment for the metabolism of flavonoids and polyphenols in mango pulp, clarify the composition characteristics of monomer compounds, analyze the physiological and biochemical mechanisms of the antioxidant response of these reducing components, and explore the possibility of improving the health quality of mango pulp.

Enhancing UV-B radiation is still likely to become the future agricultural adversity for a certain period, and many crops will gradually encounter the light stress of enhanced UV-B radiation. In addition, different plant species such as Sorghum bicolor and Triticum aestivum equivalent crops have different sensitivity and damage performance of enhancing UV-B radiation, so it is necessary to study the biological effects of the enhanced UV-B radiation on specific crops.

Therefore, the molecular biological mechanism of the reduced composition of antioxidant response of mango pulp under high-dose enhanced UV-B radiation treatment is worth prospective study. This will also lay the molecular biological foundation for exploring other growth and development problems of mango pulp. At the same time, it also provides the theoretical basis for the technical guidance of tropical fruit tree cultivation.

Keywords:

• UV-B
• mango
• flavonoids
• antioxidant response

REVIEWING EDITOR:

• M. Luisa Escudero-Gilete, Universidad de Sevilla, Spain

SUBJECTS:

• Agriculture; Horticulture; Plant Biology

1. Introduction

The exhaust gases emitted by modern vehicles and the use of Freon refrigerants can cause damage to the atmospheric ozone layer, resulting in enhanced UV-B radiation (Zlatev et al., 2012). Reportedly, the intensity of UV-B radiation will continue to increase, reaching approximately 120% of the current level (K et al., 2009). Importantly, enhanced UV-B radiation can become an adversity that affects plant growth and development.

UV-B radiation also has certain benefits for plants. Early research found that it raised the net photosynthetic rate of leaves, which promoted the early maturity of ‘Guifei’ mango by the rapid accumulation of photosynthetic products, and it has a regulator of growth and development (Lin et al., 2021). On the other hand, Studies have found that enhanced UV-B radiation reduces the morphological size of grapes and reduces the formation of pigments (Wu et al., 2008); and enhanced UV-B radiation reduces leaf photosynthesis efficiency and yield (Sun et al., 2000). In addition, another study found that UV-B radiation induces the expression of anthocyanin biosynthetic genes such as chalcone synthase (CHS) and chalcone isomerase (CHI) (Fuglevand et al., 1996). It has been found that enhanced UV-B radiation can not only inhibit the hypocotyl growth of Arabidopsis seedlings (Dukowic-Schulze et al., 2022) but also induce the synthesis of cyclobutane pyrimidine dimer and pyrimidine-pyrimidinone photoproducts, causing DNA damage and thereby affecting Arabidopsis thaliana growth and development (Wong et al., 2022). In addition, UV-B radiation can delay Anatolian black pine seed germination and seedling development (Ozel et al., 2021), affect the concentration of photosynthetic pigments in plant leaves (Jovanić et al., 2022), and inhibit algae growth (Fu et al., 2021). Reactive oxygen species (ROS) damage is the main biochemical mechanism that causes various injuries to plant organs and tissues, such as loss of thylakoid membrane integrity, photosystem II (PSII) damage, and reduced carbon assimilation and oxygen release (Hollósy, 2002; Kakani et al., 2003; Rojas-Lillo et al., 2014). Therefore, it is necessary to carry out forward-looking research on the response characteristics of plants to enhanced UV-B radiation stress and the mechanism of ROS damage, which can lay a theoretical foundation for formulating agricultural production measures to resist enhanced UV-B radiation hazards, with possible role of screening techniques in fresh vegetables and fruits improvement (Brestic et al., 2023).

Similar to other environmental stress factors, such as drought, flooding and severe cold and other abiotic stresses, enhanced UV-B radiation affects the normal growth and development of plants (Xu et al., 2023) and induces ROS damage and antioxidant response mechanisms (Bandyopadhyay et al., 1999). Enhanced UV-B radiation can induce plants to produce many secondary metabolites while causing plant damage (Ramani & Chelliah, 2007; Takshak & Agrawal, 2019), thereby promoting the accumulation of reducing substances such as flavonoids and isoflavones (Gai et al., 2022; Jiao et al., 2015, 2018), which are potent antioxidant metabolites (Agati et al., 2011). Phenolic compounds or polyphenols are one of the most numerous and widely distributed plant secondary metabolites (Soobrattee et al., 2005) and are also natural antioxidants in plants (Zheng & Wang, 2001), and flavonoids are the most common and widely distributed subgroup of phenolic substances, with complex and diverse structures (Agati et al., 2012). They can participate in plant nonenzyme antioxidant protection mechanisms (Winkel-Shirley, 2002) and can effectively help prevent human cancer, cardiovascular disease and other chronic diseases (Veiga et al., 2020).

Mango (Mangifera indica L.) is an evergreen tree belonging to the family Anacardiaceae and is known as the “king of tropical fruits” in China. Hainan Province is one of the most important producing areas of mango (Gao et al., 2019), which is in a region with low tropical latitude and strong ultraviolet radiation in China, and mango is one of the most important economic pillars for local farmers. In the future, UV-B radiation will be enhanced, and low-latitude and high-altitude areas will be most affected, so the effect on tropical perennial fruit trees will be particularly prominent. Although the fruit can adapt well to natural strong ultraviolet radiation, artificial simulation of enhanced UV-B radiation will cause ROS damage to the leaves of ‘Tainong 1’, destroy the optical microstructure and chloroplast submicrostructure of the leaf photosynthetic tissue, downregulate the expression of rbcL, cause stomatal and nonstomatal restriction and inhibit photosynthesis, resulting in a decrease in yield per plant and a deterioration in fruit nutritional and flavor quality. At the early stage of enhanced UV-B radiation, leaves minimize the damage of ROS by increasing SOD, POD and CAT activities, consuming vitamin C, and accumulating reduced GSH and some protective pigments such as flavonoids and carotenoids. At the later stage of enhanced UV-B radiation, the accumulative effect of ROS stress leads to a decrease in antioxidant enzyme activity, the accumulation of reducing components, and the contents of protective pigments, which in turn causes the accumulation of ROS and ROS damage in leaves (Chen et al., 2023; Peng et al., 2010; Wang et al., 2021). Since the damage and stress response of enhanced UV-B radiation to mango pulp have not been studied in depth and in view of simulated enhanced UV-B radiation that is strongly targeting, regional, green pollution-free and easy to operate (Schreiner et al., 2016), it is necessary to deeply explore the effects of enhanced UV-B radiation on the damage and secondary metabolism of mango fruit. The aim of this study is to reveal the protective mechanisms of ROS damage and the molecular mechanisms underlying changes in the nutritional quality of mango under enhanced UV-B radiation. Our team’s preliminary research found that artificial simulation to enhance UV-B radiation intensity to reach 42 kJ·m⁻²·d⁻¹ began to cause mango fruit yield decline and fruit flavor quality deterioration (Kaibing et al., 2018; Mengling et al., 2018).

In this study, full-grown trees treated with an additional 96 kJ·m⁻²·d⁻¹ UV-B radiation were used as the treatment group, and trees under natural lighting with no additional radiation exposure were used as the control group. The physiological and biochemical mechanisms of ROS damage to pulp were explored, and the molecular mechanism by which enhanced UV-B radiation stress affected mango pulp was analyzed based on transcriptomic and metabolomic conjoint analysis. UV-B is also an important stress factor. In addition to the damage, study the process of adaptation to UV-B and discuss the nutritional and health benefits of UV-B-induced UV-absorbing compound accumulation. Our study can provide theoretical guidance for developing reasonable cultivation techniques for mango that adapt to enhanced UV-B radiation environments and can also provide certain theoretical references for studying the mechanisms of other crops’ resistance to enhanced UV-B radiation stress.

2. Materials and methods

2.1. Experimental location and materials

In the mango orchard of Shengchang Village, Haitang District, Sanya City, Hainan Province, 10 full-grown ‘Tainong 1’ mango trees grafted onto the rootstock ‘Changjiang Tumang’ mango with consistent growth and robustness were selected as the experimental materials. The crop load was determined according to the ratio of the number of leaves to the number of fruits, which was determined to be 27. The average annual precipitation is approximately 1700 mm, the average annual temperature is approximately 25 °C, and the garden soil is brick red sandy soil. To make mangoes available for sale during the Chinese Spring Festival, production period adjustment technology was implemented in late July. The main phenological periods were as follows: from 2021–2022, the flower bud differentiation period was from August to September, the flower bud emergence period was in early October, the flowering period was in mid to late October, the physiological flower and fruit drop period was in early to mid-November, the fruit expansion period was from December to January of the following year, and the fruit harvest period was in early to mid-February. From 2022 to 2023, each phenological period was correspondingly advanced by one month.

2.2. Test treatment

Using natural light as the control, 96 KJ·m⁻²·d⁻¹ ultraviolet lamp irradiation was artificially provided to enhance UV-B radiation treatment under natural light, and this treatment was repeated 5 times for each single plant. Under natural light whose average intensity was approximately 600 kJ·m⁻²·d⁻¹ during the period of the field experiment, an ultraviolet lamp stand was built with an aluminum alloy tube, and four 40 W ultraviolet lamps were hung vertically at the top of the tree and approximately 30 cm away from the top of the tree. The ultraviolet lamp was produced by Beijing Electric Light Source Research Institute, the wavelength peak was 313 nm, and its light intensity was approximately 96 kJ·m⁻²·d⁻¹. The high-dose enhanced UV-B radiation treatment, which was equivalent to 15% enhancement, was artificially simulated. The sunrise was open, the sunset was off, and the irradiation treatment was stopped in rainy weather, which is strictly consistent with the natural solar radiation duration. We sampled and maintained lamps at the base once every 10 days and were only able to measure the UV-B radiation intensity of the UV-B lamps under natural light during the sampling period. The radiation intensity at 30 cm under the UV-B lamps was 24 kJ·m⁻²·d⁻¹, which is relatively stable; a list of UV-B radiation intensities under natural light (10–11 a.m.) is shown in Table 1.

Table 1. List of UV-B radiation intensities in natural light (10–11 a.m.).

	First year (2021–2022)	Second year (2022–2023)
First sampling	617 kJ·m^−2·d^−1	609 kJ·m^−2·d^−1
Second sampling	608 kJ·m^−2·d^−1	598 kJ·m^−2·d^−1
Third sampling	589 kJ·m^−2·d^−1	621 kJ·m^−2·d^−1
Fourth sampling	611 kJ·m^−2·d^−1	622 kJ·m^−2·d^−1
Fifth sampling	602 kJ·m^−2·d^−1	588 kJ·m^−2·d^−1
Sixth sampling	628 kJ·m^−2·d^−1	631 kJ·m^−2·d^−1
Seventh sampling	607 kJ·m^−2·d^−1

From the beginning of the treatment, the first sampling was conducted. At this time, 5 healthy fruits of the same size were selected around the periphery of the middle canopy as the standard fruits for dynamic periodic sampling thereafter; that is, fruits of the same size as these fruits were picked as samples. In 2021, 30 d after flower (December 18) to 90d after flower (February 17, 2022), the next year met the actual production to meet the demand of the Spring Festival, the production adjustment (10 d later than the first year), 40 d (December 1 after 2022) to 90 d (January 21, 2023), every 10 d for 7 times and 6 times respectively. After each fruit sample was taken in the orchard, it was peeled on the spot, cut into small pieces, quickly frozen in liquid nitrogen, placed in a 50 mL centrifuge tube, placed in a liquid nitrogen tank and taken back to the laboratory for storage in an ultralow temperature freezer (-80 °C) for later use.

2.3. Experimental measurement methods

2.3.1. MDA content and relative conductivity determination

The content of pulp malondialdehyde (MDA) was determined by thiobarbituric acid colorimetry (Sen & Alikamanoglu, 2013). The relative conductivity of the pulp was determined by conductivity meter immersion (Wang et al., 2021).

2.3.2. Determination of the main active oxygen components

Approximately 0.1 g of tissue was weighed, and 1 mL of reagent was added for ice bath homogenization. The sample was centrifuged at 8000 × g at 4 °C for 10 min, and the supernatant was removed and placed on ice for testing. Superoxide anion and H₂O₂ contents were determined by an ADS-W-YH008 Superoxide Anion (O^2-) Kit and an ADS-W-YH001 H₂O₂ kit (Jiangsu Kete Biotechnology Co., Ltd., Yancheng, Jiangsu, China) following the manufacturer’s protocol.

2.3.3. Determination of total flavonoid content

One gram of pulp sample was placed in a mortar, a small amount of quartz sand and 8 ml of anhydrous methanol were added under ice bath conditions, and the mixture was poured into a test tube and extracted at 4 °C in the dark for 2 h, during which an ultrasound-assisted extraction was performed. The extract was then centrifuged at 12,000 r/min for 20 min prior to measurement. The extraction and determination of total flavonoids in pulp were performed according to the method of Zeraik & Yariwake (2010). Anhydrous methanol was used as a control, and rutin was used as a standard to calculate a standard curve to determine the content.

2.3.4. Metabolic component detection

Samples from 30 DAF (12/18/21), 50 DAF (1/8/22) and 90 DAF (2/17/22) were selected, and three biological replicates were set up for each time point. Fresh pulp samples were used for metabolome determination (Wuhan Maiwei Biotechnology Co., Ltd., Wuhan, China). Samples were vacuum freeze-dried in a lyophilizer (Scientz-100F); ground (30 Hz, 1.5 min) into powder using a grinder (MM 400, Retsch); weighed to 100 mg of powder and dissolved in 1.2 mL of 70% methanol extract; vortexed every 30 min for 30 s for a total of 6 times, and placed in a 4 °C freezer overnight. After centrifugation (12000 rpm, 10 min), the supernatant was aspirated, and the sample was filtered with a microporous membrane (0.22 μm) and stored in an injection bottle for UPLC–MS/MS analysis. Data acquisition instrumentation systems included ultra-performance liquid chromatography (UPLC, SHIMADZU Nexera X2, https://www.shimadzu.com.cn/) and tandem mass spectrometry (MS/MS, Applied Biosystems 4500 QTRAP, http://www.appliedbiosystems.com.cn/).

The UPLC–MS/MS detection platform and self-built database were used for metabolite detection. The screening conditions for differentially expressed metabolites were 丨log₂ (fold change) 丨≥ 1 and VIP ≥ 1.

2.3.5. Transcription sequencing analysis and real-time PCR validation

According to the dynamic change characteristics of antioxidant substances in the early stage of our experiment, 15 samples were selected, and the date was consistent with the date of the metabolome samples sent for testing. The treatment and control were divided into 5 groups for transcriptome sequencing (RNA-seq) analysis, and each group of samples had 3 biological replicates. The obtained pulp samples were sent to Shanghai Bioengineering Co., Ltd. for RNA-seq of the constructed cDNA library using the Illumina HiSeq platform. Data processing using Trimmomatic was performed in the following steps: removal of sequences with N bases; removal of the connector sequence from reads; removal of low-mass bases (Q < 20) starting from reads 3′ to 5′; use of the sliding window method to remove bases with a mass value below 20 at the tail of reads (window size of 5 bp); and removal of reads themselves and their paired reads that were less than 35 nt in length. The reference genome (https://www.ncbi.nlm.nih.gov/genome/?term=mango) was used as the reference sequence, the quality control sequence was compared with the reference genome using HISAT2, and the results were statistically compared by RSeQC. The read count table was analyzed by DESeq2 (Love et al., 2014) for differential expression analysis. The differentially expressed gene (DEG) screening criteria were q ≤ 0.05 and 丨log₂ (fold change) 丨≥ 1 with TPM ≥ 5 in one sample or group. Eleven genes, including flavanone lyase-encoding genes, were randomly selected, and their expression was measured using qRT–PCR to validate the RNA-seq results. The qRT–PCR primers were designed using TBtools (Table 2) and synthesized (Shanghai Bioengineering Co., Ltd., Shanghai, China.). The purification method was polyacrylamide gel electrophoresis (PAGE). The extracted pulp RNA was reverse transcribed into cDNA using a cDNA synthesis kit (HiScript II First Strand cDNA Synthesis Kit; Novizan Biotechnology Co., Ltd., Nanjing, China) and a PCR instrument (T100TM Thermal Cycler; BIORAD Inc., Hercules, CA, USA). qRT–PCR validation was performed using the Tolo Biotech 2 × Q3 SYBR qPCR Master mix (Universal) and a real-time PCR instrument (qTOWER3; Analytik Jena Inc., Jena, Germany). The relative expression of genes was calculated using the 2^−ΔΔCt method, with actin as the internal reference gene (Bin et al., 2021), and the primers are detailed in Table 2.

Table 2. Primers used for the qRT–PCR assay.

Primer name	Left primer sequence (5′ to 3′)	Right primer sequence (5′ to 3′)
Mi00g09240.1	GGTGGAGGTCCCGGTTTC	GCACAGGGCGTAGAAGCA
Mi20g06400.1	GGGTTCAGGCTCTGGCAG	TCTTTTCGCGGTCGACGG
Mi09g04940.1	TGCGGCTCTTTGGGTCAC	TGGCGCAACACAATCCCA
Mi04g19560.1	ACATTCTCCAGCCCGCAC	ATCCGCCAAGTCCAAGCC
Mi04g07590.1	AGGGAGTCAGCGAGGAGG	TCAGCCTCAGATTCGCCG
Mi20g02530.1	GCCTGATGGAACGCCTGT	AGAACTGTCCGGCATGGC
Mi08g07240.1	AACGGAGGGGCATTGGTG	GTGTGATGCCCATCTGCCT
Mi05g08960.1	TGGAGGGGTGGTGCTCTT	CACCCCCTTTGGTTCCACA
Mi08g01120.1	GAGGTTGGCTGAGGCTGG	GGCCCTTGGTGTCAAGCA
Mi07g00970.1	TGTTGGCAACCGGGAGTG	CCTCTGCACAGTCGGCAA
Mi10g10300.1	AGGAGTCCTGGTGGGTGG	GCGTTTTGGGGCCCATTG
actin	ATCTGCTGGAAGGTGCTGAC	CCAAGCAGCATGAAGATCAA

2.4. Statistical analysis

The data were analyzed by using statistical software (SAS9.4, SAS Institute Inc., Cary, NC, USA). Analysis of variance (ANOVA) was used to analyze the variance of the dynamic changes in the treatment and control indexes, and the Duncan method was used for multiple comparative analyses at different times. Student’s t test was used for the significance analysis of the difference between the treatment and control groups. TBtools software was used to produce heatmaps of DEG expression (Chen et al., 2020).

3. Results and analysis

3.1. Effect of enhanced UV-B radiation on MDA content and relative conductivity in mango pulp

As shown in Figure 1(a), the content of MDA in the pulp of the enhanced UV-B radiation treatment and control group showed a trend of first decreasing and then rising. At 40 DAF, the MDA content in the treatment group was significantly lower than that in the control group. At 90 DAF, the MDA content of the treatment group was significantly higher than that of the control, and there was no significant difference between the two groups at the remaining times. As shown in Figure 1(b), from 40 to 80 DAF, the content of MDA in the pulp of the two groups in the following year decreased first and then increased. At 90 DAF, the MDA content in the control group decreased, and the treatment was the opposite. In addition, the MDA content in the pulp of the treatment group was significantly higher than that in the control group at 40, 80, and 90 DAF, and there was no significant difference in the MDA content between the treatment and the control group in the remaining stages.

Figure 1. Effect of enhanced UV-B radiation on dynamic changes in MDA content (a, b) and relative conductivity value of pulp (c, d).

Note: * indicates a significant difference at the level of p < 0.05. CK (control check) indicates the natural light control, T (UV-B treatment) indicates enhanced UV-B radiation treatment, and the same applies below.

As shown in Figure 1(c), over time, the relative conductivity in the treated and control groups fluctuated significantly, and that of the treatment was significantly higher than that of the control at 40, 50 and 60 DAF. At the remaining times, there were no significant differences between the treatment and control groups. As shown in Figure 1(d), the trend of the relative conductivity of the two groups in the following year was similar, and it decreased first from 40 to 50 DAF and then showed an overall upward trend. At 40 and 50 DAF, the relative conductivity in the treatment group was significantly higher than that of the control. At the remaining times, there were no significant differences between the treatment and control groups.

Based on the changes in MDA content and relative conductivity between the treatment and control groups, pulp tissue cells were not damaged in the early stage of enhanced UV-B radiation, and with the accumulation effect of treatment, obvious membrane lipid damage appeared in pulp tissue cells in the later stage.

3.2. Effect of enhanced UV-B radiation on the contents of superoxide anion and H₂O₂ in mango pulp

As shown in Figure 2(a), the content of superoxide anion radicals in the treatment and control groups showed a similar upward trend. Only at 90 DAF was the superoxide anion radical content of the treatment significantly higher than that of the control, and there was no significant difference in superoxide anion radical content between the treatment and control groups at the remaining times. As shown in Figure 2(b), the content of superoxide anion radicals in the following year showed a similar trend, and unlike the first year, that of the treatment was significantly higher than that of the control from 70 to 90 DAF. There was no significant difference between the superoxide anion radical content of the treatment and the control at the remaining times. As shown in Figure 2(c), the H₂O₂ content of the treatment and control groups showed a similar trend of first decreasing and then rising. At 40 DAF, the H₂O₂ content of the treatment group was significantly lower than that of the control. At 60, 80 and 90 DAF, the H₂O₂ content of the treatment group was significantly higher than that of the control. At the remaining times, there were no significant differences between the H₂O₂ content of the treatment and control groups. As shown in Figure 2(d), the H₂O₂ content of the treatment group first increased and then decreased, while the H₂O₂ content of the control showed a trend of rising, decreasing, rising and decreasing. At 60 DAF, the H₂O₂ content of the treatment group was significantly lower than that of the control; at 70, 80 and 90 DAF, the H₂O₂ content of the treatment group was significantly higher than that of the control. At the remaining times, there were no significant differences in the H₂O₂ content between the treatment and control.

Figure 2. Effect of enhanced UV-B radiation on dynamic changes in superoxide anion (a, b) and H₂O₂ content (c, d).

In the early stage of enhanced UV-B radiation, the two types of ROS contents of the treatment group showed a lower trend than that of the control. In the middle and late stages of treatment, the two ROS contents of the treatment group were significantly higher than those of the control, indicating that in the early stage of treatment, enhanced UV-B radiation resulted in an increase in ROS clearance and defense capabilities and reduced ROS accumulation, and in the middle and late stages of the treatment, the production of ROS in pulp exceeded ROS clearance and defense capabilities, leading to ROS accumulation.

3.3. Effect of enhanced UV-B radiation on the contents of total flavonoids in mango pulp

As shown in Figure 3(a), the total flavonoid contents of the treatment group showed a downward trend overall, while those of the control showed a declining, rising and declining trend. As shown in Figure 3(b), the total flavonoid contents of the treatment group showed a rising, declining and rising trend in the following year, while those of the control showed a declining, rising, declining and rising trend, but both showed a downward trend overall. The total flavonoid contents of the treatment group were significantly higher than those of the control at 40 and 60 DAF in the first year and 50 and 60 DAF in the following year. At 60, 80, and 90 DAF in the first year and 70 DAF in the following year, the total flavonoid contents of the treatment group were significantly lower than those of the control. At the remaining times, there were no significant differences between the total flavonoid contents of the treatment and control groups.

Figure 3. Effect of enhanced UV-B radiation on dynamic changes in total flavonoid (a, b) contents in pulp.

The total flavonoid content in the treatment group was significantly higher than that in the control group in the early stage and significantly lower than that in the control group in the later stage, indicating that enhanced UV-B radiation first increased the accumulation of flavonoids and was used as the main antioxidant to remove ROS and thus resist ROS damage. In the later stages of enhanced UV-B radiation treatment, ROS damage occurs due to the accumulation of ingested antioxidants exceeding the pulp.

3.4. RNA-seq analysis

3.4.1. Screening and functional analysis of differentially expressed genes

As shown in Figure 4(a), a total of 126 DEGs were screened in the treatment and control groups at 50 DAF, of which 57 were upregulated and 69 were downregulated. A total of 13 DEGs were obtained in the treatment group at 90 DAF, of which 9 were upregulated and 4 were downregulated.

Figure 4. Bar plot of differentially expressed genes at 60 and 90 days after flowering (a) and KEGG enrichment analysis (b).

The results of DEG KEGG functional annotation at 50 DAF are shown in Figure 4(b). A total of 48 DEGs were annotated into four first-level categories: cellular processes, environmental information processing, genetic information processing, and metabolism. DEGs enriched in metabolism accounted for 58%, of which metabolic pathways mainly included amino acid metabolism, biosynthesis of other secondary metabolites, carbohydrate metabolism, lipid metabolism, metabolism of terpenoids and polyketides, glycan biosynthesis and metabolism, and nucleotide metabolism. DEGs related to environmental information processing accounted for 10% of total DEGs, and they were mainly enriched in signal transduction and membrane transport. DEGs involved in cellular processes accounted for 8% of total DEGs, which were mainly enriched in transport and catabolism. In addition, DEGs involved in genetic information processing accounted for 6% of total DEGs, mainly enriched in transcription and translation. Therefore, enhanced UV-B radiation mainly affects secondary metabolism, vitamin metabolism and energy metabolism and produces active antioxidant substances to resist adversity.

3.4.2. Real-time PCR validation

Eleven genes were randomly selected for real-time PCR verification, and the results are shown in Figure 5. The linear relationship between transcriptome data and real-time PCR was significantly positively correlated (R² ₂₀₂₁ = 0.8599, R² ₂₀₂₂ = 0.7585), indicating the reliability of the transcriptome data.

Figure 5. Correlation analysis between real-time PCR and transcriptome expression.

3.5. Analysis of differentially expressed metabolites in the treatment and control groups

The differentially expressed metabolite quantities in pulp at 3 different stages are shown in Table 3. At 60 DAF, a total of 71 differentially expressed metabolites were obtained in the treatment and control groups, of which 30 were upregulated and 41 were downregulated. At 90 DAF, a total of 62 differentially expressed metabolites were obtained from the treatment and control groups, of which 33 were upregulated and 29 were downregulated.

Table 3. Statistical table of the number of different metabolites (the former compared to the latter).

Group name	Total	Downregulated	Upregulated
CK-60DAF_vs_CK-90DAF	121	57	64
CK-60DAF_vs_T-60DAF	71	41	30
CK-90DAF_vs_T-90DAF	62	29	33
CK-30DAF_vs_CK-60DAF	190	106	84
CK-30DAF_vs_CK-90DAF	233	132	101
CK-30DAF_vs_T-60DAF	194	115	79
CK-30DAF_vs_T-90DAF	238	139	99
T-60DAF_vs_T-90DAF	149	58	91

The above differentially expressed metabolites are classified as shown in Figure 6(a). In Class I, the main metabolites included flavonoids (19.72%), phenolic acids (15.49%), and amino acids and their derivatives (14.08%), and 18.31% of the metabolite classes were classified as other. The remaining metabolites accounted for less than 10%, including alkaloids, lignans, coumarins, lipids, nucleotides and their derivatives, organic acids, quinones, tannins, and terpenes. Class II contained more flavonoids and flavonoid metabolites, of which flavonols accounted for 2.82%, flavanones accounted for 2.82%, flavones accounted for 2.82%, flavonoid carbosides accounted for 2.82%, flavonols accounted for 7.04%, and other flavonoids accounted for 1.41%.

Figure 6.  Differentially expressed metabolite classification plot (a) under enhanced UV-B radiation versus natural light, differentially expressed metabolite KEGG enrichment analysis plot (b) at 60 days after flowering (DAF), differentially expressed metabolite KEGG enrichment analysis plot (c) at 90 DAF and differential metabolic expression heatmap at 60 and 90 DAF (d).

Note: CK-1 and T-1 represent the control and treatment at 60 DAF, respectively. CK-2 and T-2 represent the control and treatment at 90 DAF; b-1, b-2, b-3, b-4, b-5, b-6 and c-1, c-2, c-3, c-4, c-5, c-6 represent three sample replicates in the treatment and control.

As shown in Figure 6(b), KEGG enrichment analysis of differentially expressed metabolites at 60 DAF showed that 4.35% and 13.04% of metabolites were involved in flavonoid biosynthesis and flavone and flavonol biosynthesis, respectively. As shown in Figure 6(c), a total of 13.33% of metabolites were involved in flavonoid biosynthesis and flavonoid and flavonol biosynthesis at 90 DAF.

The contents of differentially expressed metabolites are shown in Figure 6(d). At 60 DAF, the content of flavonoids in the treatment group was lower than that in the control group. At 90 DAF, the content of flavonoids in the treatment group was significantly higher than that in the control group, which indicated that in the early stage of fruit growth and development, flavonoids are consumed by scavenging ROS. In the later stage of fruit growth and development, an attempt is made to eliminate ROS by accumulating more flavonoids, thereby avoiding ROS damage as much as possible. In addition, the quinone content in the treatment group was higher than that in the control group.

3.6. Flavonoid synthesis pathway in mango pulp under enhanced UV-B radiation

Based on the results of the transcriptomic and metabolomic analyses, the expression levels of key genes and the contents of metabolites in the flavonoid metabolic pathway were analyzed, and the results are shown in Figure 7. At 30 DAF, the high expression of the CHS gene in the treatment and control groups led to the accumulation of a variety of precursors of flavonoid metabolic end products, such as 4'-O-glucoside, and all related genes in the metabolic process were significantly upregulated compared with 60 and 90 DAF. This resulted in gallocatechol, kaempferin, quercetin, isoquercetin and luteoloside accumulation in the pulp, which means that the pulp already has a certain antioxidant capacity at 30 DAF. At 60 DAF, the expression of hydroxycinnamoyl transferase (HCT)-encoding genes in the treatment group was higher than that in the control group, while the expression of the 5-O-(4-coumaryl)-D-quinate 3'-monooxygenase gene (CYP98A) was not significantly different from that in the control group, resulting in lower levels of coumaryl shikimic acid and caffeoylquinic acid than in the control group. The expression of the CHS and chalcone isomerase (R02446) genes in the middle reaches of the flavonoid metabolic pathway increased compared with the control; furthermore, the expression of the 3',5'-hydroxylase (CYP75A) and 3'-monooxygenase (CYP75B1) genes downstream of the flavonoid metabolic pathway decreased compared with the control, resulting in the accumulation of naringenin chalcone, caffeoyl-CoA, 3,4,2',4',6'-pentahydroxychalcone and kaempferin. The expression of the CYP75A and CYP75B1 genes decreased and led to a decrease in the content of shekoside, isoquercetin, quercetin-3-O-sambudiglycoside and quercetin. In addition, the contents of cheryl glycosides, kaempferin, isovitexin, apigenin-7-O-glucoside and vitexin were significantly reduced. At 90 DAF, the end product contents of the flavonoid metabolic pathway in the treatment group decreased significantly, such as gallochol, leucoside, quercetin-3-O-sambudiglycoside, apigenin-7-O-glucoside, vitexin, 3',4,4',5,7-pentahydroxy­flavan, pyrosides, cheryl glycosides and gallocechol, while there was no significant difference in the expression level of the related enzyme-coding genes. In conclusion, the above results indicate that the treatment defends against ROS by consuming flavonoids to resist ROS damage, thereby maintaining normal physiological activities.

Figure 7. Integrative analysis of the metabolome and transcriptome of flavonoids and flavonoid compounds in mango pulp of the treatment and control groups.

Note: CS1, CS2, CS3 and TS1, TS2, TS3 represent natural light control and enhanced UV-B radiation treatment at 30, 60 and 90 days after flowering.

4. Discussion

Flavonoid compounds are the most common and important class of secondary metabolites in plants, with more than 6,000 different structures (Šamec et al., 2021) that regulate cell growth, attract pollinators, resist adverse biotic and abiotic stress (Rodríguez De Luna et al., 2020), have antioxidant activity (Wojdylo et al., 2007), and can delay the oxidative degradation of lipids, thereby improving the quality and nutritional value of fruit (Kähkönen et al., 1999). Flavonoid compounds can also be used as signaling molecules, ultraviolet filters, and ROS scavengers (Di Ferdinando et al., 2012; Panche et al., 2016), and under UV-B radiation, the metabolic changes in flavonoid compounds in olives are the main antioxidant response protection mechanism (Dias et al., 2020); in addition, flavonoid compounds can be used as key substances for the removal of ROS (Khan & Dilshad, 2023). Studies have shown that the photosynthetic activity of non-primed seedlings is hindered by the imbalance of antioxidant defense mechanisms due to the influence of UV-B radiation. In addition to photosynthetic inhibition, PEG stress-induced ROS can disrupt the mitochondrial membrane and protein in seedlings. Increased ROS content by decreasing mitochondrial and photosynthetic activity causes cellular damage, which makes plants more susceptible to polyethylene glycol stress, which may reduce the photosynthetic rate by reducing CO 2 assimilation due to PEG-induced stomatal closure (Sen et al., 2022). In our study, by artificially simulating enhanced UV-B radiation on mango fruit, it was found that MDA and relative conductivity caused lipid peroxidation of the pulp and electrolyte leakage in the tissues due to ROS, respectively (Tsikas, 2017; Prášil & Zámečník, 1998). In the determination of ROS content, around 60 DAF is the tipping point for the fruit to cope with UV-B radiation. Before 60 DAF, the ROS contents of the treatment group were significantly higher than those of the control, and UV-B radiation enhancement resulted in an increase in ROS clearance and defense capabilities and reduced ROS accumulation. After 60 DAF, the production of ROS in the pulp exceeded the ROS clearance and defense capabilities, leading to ROS accumulation. The results of this study also showed that flavonoid compounds were the key antioxidants in response to enhanced UV-B radiation. In addition, before 60 DAF, the pulp scavenged the ROS induced by the enhanced UV-B radiation by increasing the synthesis of flavonoid compounds so that the fruit maintained normal physiological activities, and the nutritional quality of the pulp was also improved during this period. After 60 DAF, due to the enhancement of the accumulation effect of UV-B radiation stress, the production of a large number of ROS in the pulp was induced, and the flavonoids synthesized in the pulp could not completely remove the ROS, and thus the pulp gradually exhibited ROS damage.

In this study, the fruit output of mango fruit was determined for two consecutive years, and there was a difference in sampling time, which is the reason for the timing adjustment made according to the actual production. In this paper, the two growing season tests are mainly to investigate the repetition of the dynamic change trend difference. The test results after years of field treatment have sufficient reliability and sufficient time to verify the reproducible research of the results. In the metabolism of the flavonoid pathway, at 30 DAF, the expression of CHS, CYP75A, CYP75B1, R02446, and CYP98A led to the accumulation of many flavonoid compounds. Immediately before 60 DAF, the total flavonoid content under UV-B radiation treatment increased. At 60 DAF, the upregulated expression of CHS, HCT, and R02446T led to the accumulation of downstream metabolic end products such as baimaside, which is a scavenger of the superoxide anions. But isovitexin, kaempferin and quercetin, and most of the detected components were significantly lower than the control. These substances, as important natural antioxidants, have various physiological activities such as anti-inflammatory relief (He et al., 2016; Shin et al., 2013; Yin et al., 2013), which indicates that flavonoids are consumed in large quantities. Moreover, under the destructive UV-B radiation intensity, the normal ROS content level can be maintained within 30 d of continuous irradiation, indicating that flavonoids have a photoprotective effect on UV-B (Agati & Tattini, 2010). On the other hand, the expression of CYP75A in the treatment group was significantly downregulated, and the expression of CYP75B1 was also downregulated compared with that of the control; this was also one of the reasons for the decline in the contents of various metabolites, such as leucoside and quercetin-3-O-sambudiglycoside. This is manifested in the fact that at the critical point of 60 DAF, the ROS content under UV-B radiation treatment began to rise, while the total flavonoid content began to decrease. At 90 DAF, only HCT in the flavonoid synthesis pathway was upregulated compared with the control, while most flavonoids, such as isoquercetin, were significantly downregulated, indicating that flavonoids, as the main antioxidant active substances, were continuously consumed in large quantities. In plant leaf-Color, it have found that the level of UV radiation plays a dominant role in the accumulation of flavonoids, anthocyanins and methoxy cassia bark acid, but in the flesh we found that the accumulation of flavonoids under enhanced UV-B radiation is dominant (Bilger et al., 2001). The above indicates that because the relevant control expression genes for total flavonoids began to be downregulated under continuous UV-B irradiation, ROS began to accumulate after 60 DAF, causing increases in MDA content, and the ROS in the mango pulp is regulated by regulating the metabolism of flavonoid substances.

Damage to mango fruit by enhanced UV-B radiation stress has been rarely reported. This study showed that enhanced UV-B radiation stress induced an anti-reactive oxygen species effect in the early stage of treatment, indicating that flavonoids are one of the most important reducing components of anti-reactive damage. The main flavonoid monomer species induced were identified, the main flavonoid metabolic pathways were enriched, and the key genes causing the accumulation and alteration of these flavonoid monomer compounds were identified. This study also found that the contents of some quinones in the treatment group were significantly lower than those in the control group, indicating that these substances may play an important protective role when the pulp is damaged by ROS.

5. Conclusion

The 60 DAF serves as the critical point. The pulp increases the accumulation of ROS scavenging capacity by accumulating phenolic compounds dominated by flavonoids, thus, reduces the ROS content and protects the flesh. Before 60 DAF, the treatment enhanced the activity of each enzyme by inducing the upregulated expression of genes such as CHS, R02446, and CYP98A so that the pulp synthesized many of the main monomeric flavonoid compounds, such as gallochol, leucoside, kaempferoside, quercetin, isoquercetin and luteolin, and then removed ROS through the reduction of flavonoids and it acts to block the ultraviolet light; thus, the treated pulp had no obvious ROS damage in the early stage, and the nutritional quality of the fruit was also improved during this period. After 60 DAF, the treatment enhanced the activity of each enzyme by inducing the upregulated expression of HCT and R02446, but the synthesized flavonoids are consumed by ROS. Meanwhile, ROS also accumulate continuously because of the enhanced continuous exposure of UV-B radiation. The downregulated expression of CYP75A led to a decline in enzyme activity. Then, the accumulation rate of flavonoid compounds was lower than that of ROS in pulp, which led to ROS damage in pulp. It also shows that flavonoids can be used as high-efficiency antioxidants to deal with UV-B radiation. In production, ROS accumulation can be controlled by spraying antioxidants and other methods, so as to normally deal with the high-dose UV-B radiation environment and avoid ROS damage. This study lays a foundation for further provides theoretical guidance for the formulation of future cultivation technologies such as UV-B radiation prevention and the improvement of fruit health and quality.

Through our project research, identify also beneficial to human health flavonoids and polyphenols antioxidant monomer compounds, cloning pulp reduction components of antioxidant response key gene full length sequence, figure out the pulp reduction component antioxidant response gene transcription regulation mode, for the subsequent explore mango enhance UV-B radiation stress trait genetic rule lay molecular genetics foundation, thus through genetic engineering technology to improve or breeding better quality and enhance UV-B radiation adversity varieties.

In order to study the molecular mechanism of antioxidant response of flavonoids and polyphenols under enhanced UV-B radiation treatment, the monomer compounds must be identified first; although the preliminary test results show that the content of polyphenols changes significantly, the characteristics of the metabolism and key enzymes and their genes; finally, the transcription regulation mode of flavonoids and polyphenols, among which the key enzymes in the polyphenols biosynthesis pathway may be explored.

Authors’ contributions

On behalf of all the authors of this paper, I guarantee this paper has not been published, no more contributions, no infringement phenomenon, abiding by academic ethics. We will take all responsibilities connected with this paper ourselves forever. On behalf of all authors, I agree to participate in and publish this article. Professor Kaibing Zhou, Department of Horticulture, Hainan University, Haidian Campus of Hainan University, Haikou City, Hainan Province.

Disclosure statement

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability statement

All data generated or analysed during this study are included in this published article.

Additional information

Funding

Foundation items: National Natural Science Foundation of China (NSFC) (No. 32160677).

Notes on contributors

Kai-bing Zhou

Kai-bing Zhou is a professor, and Xian Shui, Tian-tian Chen, Jun-jie Peng and Jing-jia Du are graduate students, and they work on the research on tropical fruit tree culture and physiology. Feng Liu is a assistant researcher, and works on the research on tropical fruit tree stress physiology. Minjie Qian is a assistant professor, and works on the research on fruit tree biotechnology. In this paper, the key reduction monomer compounds in mango pulp and the key genes related to the metabolism of these compounds have been identified and screened, then it makes the base for the research on the molecular mechanism on enhanced UV-B radiation resistance and the genetic engineering breeding of mango.